help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0116
This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hashimoto, K.
Right arrow Articles by Mori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hashimoto, K.
Right arrow Articles by Mori, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LIOTHYRONINE
Endocrinology Vol. 147, No. 9 4292-4302
Copyright © 2006 by The Endocrine Society

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Koshi Hashimoto, Masanobu Yamada, Shunichi Matsumoto, Tsuyoshi Monden, Teturou Satoh and Masatomo Mori

Department of Medicine and Molecular Science, Graduate School of Medicine, Gunma University, Maebashi, Gunma 371-8511, Japan

Address all correspondence and requests for reprints to: Koshi Hashimoto, M.D., Ph.D., Department of Medicine and Molecular Science, Graduate School of Medicine, Gunma University, 3-39-15 Showa-machi Maebashi, Gunma 371-8511, Japan. E-mail: khashi{at}med.gunma-u.ac.jp.

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (–574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-{alpha}/thyroid hormone receptor-ß heterodimer bound to Site2, but retinoid X receptor-{alpha}/liver X receptor-{alpha} heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-ß recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.




This article has been cited by other articles:


Home page
EndocrinologyHome page
K. Hashimoto, E. Ishida, S. Matsumoto, S. Okada, M. Yamada, T. Satoh, T. Monden, and M. Mori
Carbohydrate Response Element Binding Protein Gene Expression Is Positively Regulated by Thyroid Hormone
Endocrinology, July 1, 2009; 150(7): 3417 - 3424.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Matsumoto, K. Hashimoto, M. Yamada, T. Satoh, J. Hirato, and M. Mori
Liver X Receptor-{alpha} Regulates Proopiomelanocortin (POMC) Gene Transcription in the Pituitary
Mol. Endocrinol., January 1, 2009; 23(1): 47 - 60.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
A. Wulf, M. G Wetzel, M. Kebenko, M. Kroger, A. Harneit, J. Merz, and J. M Weitzel
The role of thyroid hormone receptor DNA binding in negative thyroid hormone-mediated gene transcription
J. Mol. Endocrinol., July 1, 2008; 41(1): 25 - 34.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Kamei, S. Miura, T. Suganami, F. Akaike, S. Kanai, S. Sugita, A. Katsumata, H. Aburatani, T. G. Unterman, O. Ezaki, et al.
Regulation of SREBP1c Gene Expression in Skeletal Muscle: Role of Retinoid X Receptor/Liver X Receptor and Forkhead-O1 Transcription Factor
Endocrinology, May 1, 2008; 149(5): 2293 - 2305.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Hashimoto, S. Matsumoto, M. Yamada, T. Satoh, and M. Mori
Liver X Receptor-{alpha} Gene Expression Is Positively Regulated by Thyroid Hormone
Endocrinology, October 1, 2007; 148(10): 4667 - 4675.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Erion, E. E. Cable, B. R. Ito, H. Jiang, J. M. Fujitaki, P. D. Finn, B.-H. Zhang, J. Hou, S. H. Boyer, P. D. van Poelje, et al.
From the Cover: Targeting thyroid hormone receptor-beta agonists to the liver reduces cholesterol and triglycerides and improves the therapeutic index
PNAS, September 25, 2007; 104(39): 15490 - 15495.
[Abstract] [Full Text] [PDF]




HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals
Copyright © 2006 by The Endocrine Society