This Article Full Text Full Text (PDF) All Versions of this Article: 147/9/4292    most recent Author Manuscript (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hashimoto, K. Articles by Mori, M. Search for Related Content PubMed PubMed Citation Articles by Hashimoto, K. Articles by Mori, M.

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Department of Medicine and Molecular Science, Graduate School of Medicine, Gunma University, Maebashi, Gunma 371-8511, Japan

Address all correspondence and requests for reprints to: Koshi Hashimoto, M.D., Ph.D., Department of Medicine and Molecular Science, Graduate School of Medicine, Gunma University, 3-39-15 Showa-machi Maebashi, Gunma 371-8511, Japan. E-mail: khashi{at}med.gunma-u.ac.jp.

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T₃ regulates the mouse SREBP-1c mRNA expression. We found that T₃ negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T₃ negatively regulates the mouse SREBP-1c gene promoter (–574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T₃. Gel shift assays showed that retinoid X receptor-/thyroid hormone receptor-ß heterodimer bound to Site2, but retinoid X receptor-/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T₃ induced thyroid hormone receptor-ß recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T₃ in vivo and that T₃ negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

This article has been cited by other articles:

				A. Wulf, M. G Wetzel, M. Kebenko, M. Kroger, A. Harneit, J. Merz, and J. M Weitzel The role of thyroid hormone receptor DNA binding in negative thyroid hormone-mediated gene transcription J. Mol. Endocrinol., July 1, 2008; 41(1): 25 - 34. [Abstract] [Full Text] [PDF]

				Y. Kamei, S. Miura, T. Suganami, F. Akaike, S. Kanai, S. Sugita, A. Katsumata, H. Aburatani, T. G. Unterman, O. Ezaki, et al. Regulation of SREBP1c Gene Expression in Skeletal Muscle: Role of Retinoid X Receptor/Liver X Receptor and Forkhead-O1 Transcription Factor Endocrinology, May 1, 2008; 149(5): 2293 - 2305. [Abstract] [Full Text] [PDF]

				K. Hashimoto, S. Matsumoto, M. Yamada, T. Satoh, and M. Mori Liver X Receptor-{alpha} Gene Expression Is Positively Regulated by Thyroid Hormone Endocrinology, October 1, 2007; 148(10): 4667 - 4675. [Abstract] [Full Text] [PDF]

				M. D. Erion, E. E. Cable, B. R. Ito, H. Jiang, J. M. Fujitaki, P. D. Finn, B.-H. Zhang, J. Hou, S. H. Boyer, P. D. van Poelje, et al. From the Cover: Targeting thyroid hormone receptor-beta agonists to the liver reduces cholesterol and triglycerides and improves the therapeutic index PNAS, September 25, 2007; 104(39): 15490 - 15495. [Abstract] [Full Text] [PDF]