This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dai, B. Articles by Singh, P. Search for Related Content PubMed PubMed Citation Articles by Dai, B. Articles by Singh, P.

Cloning of the Functional Promoter for Human Insulin-Like Growth Factor Binding Protein-4 Gene: Endogenous Regulation¹

Departments of Anatomy and Neurosciences (B.D., P.S.), Human Biological Chemistry and Genetics (R.M., S.G.W., P.S.) and Sealy Center for Molecular Science (S.G.W.), The University of Texas Medical Branch, Galveston, Texas 77555-1043

Address all correspondence and requests for reprints to: Dr. Pomila Singh, Professor, Department of Anatomy and Neurosciences, 10.138 Medical Research Building, 1043, University of Texas Medical Branch, Galveston, Texas 77555-1043. E-mail: psingh{at}mbian.utmb.edu

	Abstract

Top Abstract Introduction Material and Methods Results Discussion References

 
The majority of the colon cancers analyzed to-date express insulin-like growth factor binding protein (IGFBP)-4, and antisense inhibition of IGFBP-4 messenger RNA (mRNA) confers a growth advantage to the cells in response to endogenous and exogenous IGFs. We recently reported a significant up-regulation of IGFBP-4 expression in a human colon cancer cell line (CaCo2) on spontaneous differentiation of the cells in culture. This suggests that the expression of IGFBP-4 may be related to growth and differentiation of colon cancer cells. To study the endogenous factors involved in the transcriptional regulation of IGFBP-4, we have isolated and sequenced the human (h) IGFBP-4 promoter. The approximately 1.3 kilobase pair (kb) 5' flanking region of the IGFBP-4 gene is GC rich and possesses several potential regulatory elements. These elements include a typical TATA box with sequence TATAA, located -299 nt from the initiation ATG codon. The cap site is located 14 nt downstream of the TATA box as determined by primer extension analysis. A 1.4-kb DNA fragment including the 1.254 kb 5' flanking region of the hIGFBP-4 gene was subcloned into a luciferase reporter vector (pGL-2 basic) either in the sense (BP-4-S-pGL) (S) or antisense (BP-4-AS-pGL) (AS) (negative control) orientation, relative to the luciferase coding sequence in the vector. CaCo2 cells were transfected with either the S or the AS vectors on days 2–10 of culture; cotransfection with the SV40-ß-Galactidose (Gal) vector was used to correct for transfection efficiency. The ratio of luciferase/ß-Gal expression by CaCo2 cells transfected with the S vectors increased significantly from days 3 and 4 to days 5 and 6 of culture, followed by a sharp decline on days 7–9, resembling the pattern of endogenous expression of IGFBP-4 by the cells; the expression of luciferase by the AS vectors remained low and insignificant. These results thus suggest that the approximately 1.4 kb 5' flanking region of the IGFBP-4 gene contains the cis elements required for regulation of the IGFBP-4 gene. Cloning and sequencing of the functional hIGFBP-4 promoter will enable us, for the first time, to study the endogenous factors/mechanisms responsible for the growth/differentiation (cell density) associated regulation of IGFBP-4 expression in colonic epithelial cells.

	Introduction

Top Abstract Introduction Material and Methods Results Discussion References

 
AT LEAST SIX insulin-like growth factors (IGFBPs) have been identified and their complementary DNAs (cDNAs) cloned from several species (1). Of the six IGFBPs identified to-date, most human colon cancers express IGFBP-2 and IGFBP-4; less than 50% also express IGFBP-3, IGFBP-5, and/or IGFBP-6 and none express IGFBP-1 (2). We now know that IGFBPs play an important role in modulating the mitogenic effects of insulin-like growth factors (IGFs) that are available to the cells by endocrine/paracrine/autocrine routes (3, 4). In recent years, both inhibitory and stimulatory effects of IGFBP proteins have been reported (4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15). The inhibitory effects have been attributed primarily to competitive scavenging of the IGFs away from the IGF-I receptors (3, 4, 9, 10, 11). The stimulatory effects are less well understood. Significant potentiation of IGF effects by IGFBP-3 and IGFBP-5 have been reported on specific cell types under certain cell culture conditions (4, 6, 12, 13, 14). Besides IGF-dependent effects, IGF-independent effects of some binding proteins have also been reported in recent years (6, 11, 12, 15, 16). Based on our studies so far, it appears that IGFBP-4 primarily functions as an inhibitory protein for colon cancer cells (2, 3, 11, 17). We recently reported that differential expression of IGF-II and IGFBP-4 plays an important role in the proliferation and differentiation of a human colon cancer cell line (CaCo2) that undergoes spontaneous enterocytic differentiation in culture; the differentiation of the cells required an attenuation of IGF-II effects (17). The attenuation was apparently achieved by significant down-regulation of IGF-II expression accompanied by a significant up-regulation of IGFBP-4 messenger RNA (mRNA) expression, which may have provided the initial signal for the onset of differentiation of the cells in culture (17). It thus appears likely that transcriptional regulation of IGFBP-4 in colon cancer cells may provide an important mechanism by which the proliferative and differentiation potential of the cells, in response to the endogenous mitogen, is further fine-tuned and modulated. While the human IGF-II promoter is cloned and is currently being characterized by several laboratories (18, 19), the functional promoter for the human (h) IGFBP-4 gene has yet to be characterized. Endogenous factors that may be involved in the differential regulation of the IGFBP-4 expression therefore remain to be characterized. The present study was undertaken to clone and sequence the functional promoter for the hIGFBP-4 gene, which would then help us to characterize the endogenous factors involved in the growth and differentiation of colonocytes via the IGF system. In the present study, we report the cloning and sequencing of approximately 1.4 kilobase pairs (kb) of the promoter sequence, 5' of the start codon, that apparently contains all the cis elements required for regulation of IGFBP-4 expression in a cell density (growth vs. differentiation)-dependent manner in CaCo2 cells.

	Material and Methods

Top Abstract Introduction Material and Methods Results Discussion References

 
Isolation of the 5' flanking region of the human (h) IGFBP-4 gene
A human genomic library in the bacteriophage P1 vector was screened by PCR (20) by Genome Systems, Inc. (St. Louis, MO). The PCR primers used for screening were the sense (GCCGACCTGGGCGACGAAGCCATCCACTG) and antisense (TTGCCCGTGCATCAGTGTGTGCAGGGGCTT) primers, specific for the hIGFBP-4 cDNA (21). Three positive clones (C1-C3) were isolated containing approximately 100 kb inserts which were amplified and confirmed to be positive by Southern hybridization with a 505-bp hIGFBP-4 cDNA fragment (position: +211 to +716 from the ATG codon of hIGFBP-4 cDNA, released by EcoRI and HindIII from plasmid pHBP4-503, obtained from Dr. S. Shimasaki). The fragment was labeled using Nick-Translation System from Life Technology (Gaithersburg, MD). The C1–C3 clones were also positive by Southern hybridization with ³²P-dCTP labeled PCR product (235 bp) corresponding to nucleotides +50 to +290 (relative to the ATG initiation codon) of the hIGFBP-4 cDNA (amplified with primers used for screening purposes as described above). The inserts from the three positive clones were then further digested with the restriction endonucleases, BamH-I and Hind-III (Promega, Madison, WI), as recommended by the supplier. The digests were separated on a 0.7% agarose gel and transferred to a modified nylon-66 membrane (Schleicher & Schuell, Keene, NH) as suggested by the manufacturer. The 235-bp PCR product (as described above) was labeled with ³²P-dCTP by Nick translation and used as a probe for Southern hybridization. The nylon filters were incubated in 50% formamide, containing 6 x SSPE, 0.5% SDS, 50 µg/ml low mol wt denatured DNA, at 42 C overnight. The filters were washed twice with 6 x SSPE/0.2% SDS at room temperature for 15 min and twice with 1 x SSPE/0.2% SDS at 37 C for 15 min and finally soaked in 0.1 x SSPE/1% SDS at 65 C for 30 min. The filters were exposed to x-ray films at -80 C overnight. Positive fragments (Fig. 1) from the digestions were further purified from the agarose gel using QIAquick gene extraction kits (Qiagen Inc., Chatsworth, CA) as per the protocol provided by the company. The positive fragments which contained the 5' sequences for the hIGFBP-4 cDNA were then subcloned into pBluescript II SK⁺ (Stratagene Cloning Systems, La Jolla, CA) vectors for sequencing.

View larger version (14K): [in this window] [in a new window]   Figure 1. Isolation of DNA fragments containing 5' flanking region of the human IGFBP-4 gene. A human genomic library in the bacteriophage PI vector was screened by PCR using primers for human IGFBP-4 that were close to the 5' end of human IGFBP-4 cDNA (near the ATG codon), described in Materials and Methods. Three positive clones, C1, C2, and C3 were isolated, which contained 100-kb inserts and were confirmed by Southern hybridization using a human IGFBP-4 cDNA probe, as described in Materials and Methods. Clones C1, C2, and C3 were digested with BamH-I and C2 was digested with Hind-III and subjected to Southern hybridization with a human IGFBP-4 cDNA probe, and the results are shown in the figure. DNA fragments BI (5 kb) and HI (7 kb) from C2 digests were subcloned into pBluescript II SK+ vectors and designated HGBP-4A and HGBP-4B and used further for sequencing purposes.

Primer extension analysis
A synthetic 18-bp oligonucleotide (5'-ACGTAGCGGGGGAAGTTA-3') that was complementary to nucleotides 134 to 151 downstream from the TATA box of the human IGFBP-4 gene was used for primer extension analysis. The primer was 5' end-labeled with ³²P-ATP using bacteriophage T₄ polynucleotide kinase. Primer extension analysis was conducted using 5 µg poly-A⁺ RNA from a human colon cancer cell line (Colo-205) (which is known to express high concentrations of IGFBP-4) (2), with the AMV reverse transcriptase primer extension system obtained from Promega as per the protocols provided by the company. Briefly, 100 fmol labeled oligonucleotide was annealed to poly-A⁺ RNA in primer extension buffer (50 mM Tris-HCl, pH 8.3; 50 mM KCl; 10 mM MgCl₂; 10 mM DTT; 1 mM of each dNTP; 0.5 mM spermidine) at 58 C for 20 min and cooled at room temperature for 10 min. The primer was next extended with 10 U AMV reverse transcriptase at 42 C for 30 min in primer extension buffer. The reaction (Rx) products were separated by electrophoresis on a 6% polyacrylamide-8 M urea sequencing gel in parallel with a sequencing Rx using the same primer to determine the CAP site (the initiation site for the transcription of human IGFBP-4 mRNA). Poly-A⁺ RNA was prepared from total RNA of Colo-205 cells by a single step guanidine thiocyanate method with the help of a kit purchased from Qiagen (Chatsworth, CA). The concentration of poly-A⁺ RNA was quantified by absorbance at 260 nm. The purity of poly-A⁺ RNA was assessed after fractionating an aliquot on 1% formaldehyde-agarose gels followed by ethidium bromide staining. Absence of 28S and 18S RNA bands was taken as a measure of the purity of poly-A⁺ RNA prepared.

Construction of human IGFBP-4-luc expression vector for transfections
To determine the promoter activity of the 5' flanking fragment of the human IGFBP-4 gene, an approximately 1.4-kb DNA fragment was fused to the luciferase reporter gene, as diagramatically presented in Fig. 2. Briefly, the 1.467-kb DNA fragment was amplified by PCR from the pB-7BP4 Bluescript vector (described above), using the 5' sense primer 5'-TCACCGTGCTAGCAGGATGGT-3' (BP4-1) (nt -1250 to -1230) and the 3' antisense primer 5'-AGGGCACACGGCGGCAG CGCT-3' (BP4-2) (nt +196 to +216). The PCR Rx was performed in the presence of AmpliTaq DNA Polymerase (Perkin Elmer Corp., Foster City, CA) as described previously (23). The PCR product was subcloned into the PCR-II vector using the TA-cloning kit (Invitrogen, San Diego, CA) as the per the protocols provided by the supplier. The approximately 1.4-kb DNA fragment was released from the PCR II vector either by KpnI and XhoI or by HindIII and Xho-I endonucleases. Both DNA fragments were subcloned into the promoterless luciferase reporter vector, pGL2-basic (Promega), predigested with either KpnI and XhoI or with HindIII and XhoI, in either the sense (BP-4-S-pGL) (S) or the antisense (BP-4-AS-pGL) (AS) orientation, relative to the luciferase codon sequence, respectively. The S and AS vectors were confirmed by DNA sequencing using pGL Primer-1, 5'-TCTATCTTATCCTACTGTAACTG-3' (10 bp upstream from multiple cloning site of pGL-2 basic vector) and pGL primer-2, 5'-CTTTATGTTTTTGGCGTCTTCC-3' (20 bp downstream from multiple cloning site of pGL-2 basic vector).

View larger version (27K): [in this window] [in a new window]   Figure 2. Construction of the sense and antisense IGFBP-4-Luc expression vectors. The strategy used for constructing the sense (BP-4-S-pGL) and the antisense (BP-4-AS-pGL) vectors is diagrammatically shown in the figure. The sequence of the primers, (BP4-1) and (BP4-2), used for amplifying the DNA fragment containing the 5' flanking region of the hIGFBP-4 gene is provided in Material and Methods. The DNA fragment thus amplified by PCR was subcloned into the TA vector followed by subcloning of the BP-4 promoter fragment in either the sense (BP-4-S-pGL) or the antisense (BP-4-AS-pGL) orientation relative to the start codon of luciferase, into the pGL2-basic vector using the indicated endonucleases. Further details are provided in the text in Materials and Methods.

Luciferase and ß-Gal assays
Cells were washed twice with PBS and lysed using the reporter lysis buffer (Promega) as per the protocols provided by the company. Lysis buffer (200 µl) was used for each 35-mm dish. The cellular debris were pelleted and the supernatant saved for analysis of luciferase and ß-Gal activities. Luciferase activity was measured with the Luciferase Assay System (Promega), using 20 µl cell extract and 100 µl luciferase assay buffer (20 mM tricine; 1.07 mM (MgCO₃)₄ Mg(OH)₂.5H₂O; 2.67 mM MgSO₄; 0.1 mM EDTA; 33.3 mM DTT; 270 µM coenzyme A; 470 µM luciferin; 530 µM ATP) at room temperature. Luciferase activity was measured within 15 sec of adding the substrate, luciferin, with a Turner TD-20e Luminometer (Turner Designs, Sunnyvale, CA). The ß-Gal assay was performed with the ß-Galactosidase Enzyme Assay System (Promega) as per the protocols provided by the company. Ninety-six well plates were used for this assay. Thirty microliters of the cell extracts were mixed with 20 µl 1x reporter buffer and 50 µl 2x assay buffer (120 mM Na₂HPO₄, 80 mM NaH₂PO₄; 2 mM MgCl₂, 100 mM ß-mercaptoethanol, 1.33 mg/ml o-nitropheynl-ß-D-galactopyranoside) in each well and incubated at 37 C for 30 min. The reactions were stopped by adding 150 µl of 1 M sodium carbonate. Absorbance of the samples were read at 405 nm in a Umax Kinetic Microplate reader (Molecular Devices, Menlo Park, CA).

RT-PCR analysis of IGFBP-4 mRNA levels in CaCo2 cells
Duplicate 35-mm dishes containing CaCo2 cells that were in culture for days 3–9 under conditions similar to that described above for measuring luciferase activity were processed for RNA extraction by a single-step guanidine thiocyanate method (25). cDNA was prepared from 1 µg total RNA from triplicate dishes at each time point using 10 units AMV reverse transcriptase (Promega) in 5 mM MgCl₂, 10 mM Tris-HCl; 50 mM KCl, 0.1% Triton X-100, 0.5 µg poly-(dT)₁₅, 1 U/µl rRNasin, 1 mM each dNTP, at 42 C for 30 min. Ten % of cDNA made from 1 µg total RNA was used for amplification by PCR, using 15–32 PCR cycles. The primers used for amplification included the sense primer, 5'-TGCAGAAGCACTTCGCCAAA-3' (representing nt +700 to +720; 416 to 436 nt downstream from the ATG codon of human IGFBP-4 cDNA) and antisense primer 5'-ACAGGACTCAGACTCAGACT-3' (representing nt +1130 to +1150; 852 bp to 872 bp downstream from ATG codon of human IGFBP-4 cDNA). To detect the PCR products (especially those that were amplified for <30 cycles), the PCR reaction was performed in 50 µl buffer containing 2 µl cDNA, 20 pmol of each primer, 250 µM dNTPs, 2 µCi -³²P dCTP (3000Ci/mmol) 10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.01% gelatin, 2.0 mM MgCl₂, 0.3 units Taq polymerase. The reactions were denatured at 94 C for 30 sec, annealed at 60 C for 45 sec, and elongated at 72 C for 1 min/cycle. Twenty microliters of mixture from each reaction were then electrophoresed on 1% agarose and transferred to Nytran membranes. The membranes were air dried and exposed to x-ray film at -80 C overnight. In a second set of experiments, cDNA equivalent to 1 µg total RNA from each duplicate dish as described above was subjected to PCR for 32 cycles using the same primer set and under similar conditions but in the absence of radiolabeled nucleotides. The reaction products were detected by ethidium bromide staining of the agarose gels. The relative concentrations of IGFBP-4 mRNA were then determined by densitometric analysis of either the autoradiographs (of samples amplified in the presence of radiolabeled nucleotides) or of the photographs of ethidium bromide stained reaction products. The densitometric analysis was done with the help of Ultrascan XL Enhanced Laser Densitometer and the GelScan software (Pharmacia, Piscataway, NJ).

	Results

Top Abstract Introduction Material and Methods Results Discussion References

 
Isolation of the 5' flanking region of the human IGFBP-4 gene
A human genomic library in the bactrophage P1 vector was screened by PCR by Genome Systems, Inc. as described in Materials and Methods. Genome Systems provided us with three positive clones (C1–C3) containing approximately 100-kb inserts. The three inserts were digested with the restriction endonuclease, BamH-I, and the digests electrophoretically separated on 0.7% agarose gels and transferred to nylon membranes. The membranes were subjected to Southern hybridization with a 240-bp radiolabeled hIGFBP-4 cDNA fragment, and a representative autoradiogram is shown in Fig. 1. BamH-I digests of all the three clones demonstrated the presence of a positive 5-kb fragment. The C2 clone was also digested with HindIII, and the digest was similarly subjected to Southern hybridization. The HindIII fragment of the C2 clone demonstrated the presence of a positive 7-kb fragment (Fig. 1). We arbitrarily chose the 5 kb BamH-I fragment and the 7-kb Hind-III fragment of the C2 clone for subcloning into the pBluescript II SK⁺ vector for sequencing purposes.

Determination of the start site of transcription
The transcription initiation site was determined by primer extension analysis as described in Materials and Methods. The primer extension experiments revealed three bands of sizes 124, 129, and 134 nucleotides in length, of which the band sized approximately 135 nucleotides was the most prominent (Fig. 3). Based on the fact that we used an oligonucleotide primer complementary to nucleotides 129–146 downstream from the TATA box of the human IGFBP-4 gene for primer extension analysis, it is predicted that the major start site of transcription is approximately 13-bp downstream from the TATA box of the hIGFBP-4 gene (Fig. 3). We have so far determined the start site of transcription for only human colon cancer cell lines. Representative data from one human colon cancer cell line, Colo-205, is shown in Fig. 3. Primer extension analysis with two other human colon cancer cell lines, CaCo2 and HT-29, gave similar results (data not shown).

View larger version (51K): [in this window] [in a new window]   Figure 3. Primer extension analysis. A synthetic 18-bp oligonucleotide (5'-ACGTAGCGGGGGAAGTTA-3') that was complementary to nucleotides 134 to 151 downstream from the TATA box of the human IGFBP-4 gene was used for primer extension analysis. The primer was 5' end labeled with 32P-ATP. Primer extension analysis was conducted with AMV reverse transcriptase using 5 µg poly-A RNA from a human colon cancer cell line (Colo-205) (which is known to express high concentrations of IGFBP-4) (2). The Rx products were separated by electrophoresis on a 6% polyacrylamide-8 M urea sequencing gel in parallel with a sequencing Rx using the same primer to determine the CAP site. The initiation site for the transcription of human IGFBP-4 mRNA was determined to be 14 bp downstream from the TATA box as shown in the figure.

View larger version (142K): [in this window] [in a new window]   Figure 4. Nucleotide sequence of the human IGFBP-4 promoter and comparison to the rat IGFBP-4 promoter region. A, Nucleotide sequence of the human promoter region is shown. The sequence shown corresponds to 1254 nucleotides upstream and 287 nucleotides downstream of the major transcription initiation site as determined by primer extension analysis (Fig. 3). Nucleotide +1 is indicated by an arrowhead above. Minor initiation sites at nt +6 and +11 are underlined. The putative TATAA element at nt -18 to -14 is boxed. The primers used to generate the PCR product for insertion into the luciferase vector are indicated by arrows above the corresponding sequences. An alu repetitive element, spanning nt -1150 to -848, is underlined. Potential binding sites for the transcription factors ATF/CREB (nt -1169 to -1161), AP-I (nt -866 to -859) and Egr-I (nt -562 to -554, nt +228 to +235, nt +261 to +269) and Sp1 (nt -1204 to -1199, nt -904 to -899, nt -313 to -305, nt -72 to -64, nt +36 to +45, and nt +153 to +159) are indicated. The translation initiation codon begins at nt +285. B, Comparison of the human and rat IGFBP-4 promoter regions is shown. The corresponding region of the rat IGFBP-4 gene (GenBank accession number L08276) was compared with the human sequence listed above using the Bestfit program of the GCG Sequence Analysis Package using the default parameters (49, 50). Numbering of both sequences is relative to the major transcription initiation site (nt +1).

View larger version (23K): [in this window] [in a new window]   Figure 5. A, Transcriptional activity (in terms of the ratio of Luc/ß-Gal activity/dish) are shown for the sense and the antisense hBP-4 promoter-Luc expression vector in CaCo2 and Swiss 3T3 Cells. CaCo2 and Swiss 3T3 (negative control cells) were transfected with either the sense or the antisense hBP-4-Luc expression vectors on day 5 of culture as described in Materials and Methods. The cells were cotransfected with the ß-Gal expression vector that was under the transcriptional control of a strong SV40 promoter (for normalization purposes). B–E, Transcriptional activity of the approximately 1.4 kb hBP-4 promoter-Luc expression vector in CaCo2 cells on different days of culture. CaCo2 cells were transfected by the Ca++ phosphate precipitation method with the sense hBP-4 Luc expression vector (BP-4-S-pBL) on days 2 to 8 of culture as described in Materials and Methods. The cells were cotransfected with ß-Gal expression vector on all days for normalization purposes. The transfected cells were assayed for luciferase and ß-Gal activities as described in Materials and Methods. The ratio of the Luc/ß-Gal activity measured in the cells (per dish), on different days of culture from a representative experiment is shown in B. Each bar in B represents mean ± SEM of three to four observations from separate dishes/experiment. *, P < 0.05 vs. day 4 values. In five separate experiments, the luciferase and ß-Gal activities were similarly measured on days 3, 5, and 7 of cell culture and the results are presented either as luciferase units (C) or as a ratio of luciferase/ß-Gal activity (D). The data from the five separate experiments (numbered 1–5, on top of the Fig. 5, C and D) are shown. Each point represents mean values of two to three observations from two to three separate dishes/experiment. Variation/data point was <5-12%. The data presented in Fig. 5D are also presented as % change in E, wherein the values measured on day 3 were arbitrarily assigned a 100% value. Values on days 5 and 7 are presented as a % of the values measured on day 3. Each bar graph in E represents the mean ± SEM of the data from the five separate experiments in D. The variation in day 3 values from the mean values (of 5 experiments) is presented as a dotted line. *, P < 0.05 vs. day 3 values.

View larger version (30K): [in this window] [in a new window]   Figure 6. RT-PCR analysis of the relative levels of IGFBP-4 mRNA in CaCo2 cells on different days of culture in relation to cell density (no. of cells)/dish. RNA samples from CaCo2 cells growing in culture for days 3–11 were subjected to RT-PCR for 15–32 cycles, using the primers specific for hIGFBP-4 cDNA, in the presence or absence of radiolabeled dCTP, as described in Materials and Methods. A, The radiolabeled PCR products, amplified for 15–30 cycles, were autoradiographically developed and the data from a representative experiment (of a total of three experiments) is shown. B, The ethidium bromide staining of the reaction products from 32 cycles of PCR is shown. C, The density of the bands, relative to the density of the day 4 band (arbitrarily assigned a value of 1.0), is presented for samples amplified for 15–32 cycles. As can be seen from Fig. 6C, the relative density of the day 5 and 6 samples was increased approximately 180 to >200% compared with the density of the day 4 samples after PCR amplification for 15 to 32 cycles. D, The relative density of the PCR products from the five different cycles are also presented as a % change, wherein the day 4 readings were arbitrarily assigned a 100% value. Each bar represents mean ± SEM of the relative density values (shown in C) measured for the five cycles on days 3–11. *, P < 0.05 vs. day 4 readings. As can be seen from Fig. 6D, the relative levels of IGFBP-4 mRNA were significantly higher at days 5 and 6 compared with that on day 4. E, In duplicate dishes the total number of cells/dish were counted on different days in culture and the results are shown in E. Each data point represents the mean of two to three observations/experiment. The intraexperimental variation for each data point was less than 5–10%.

	Discussion

Top Abstract Introduction Material and Methods Results Discussion References

The major start site of transcription was determined by primer extension analysis to be 284 nucleotides 5' to the start site of translation. A single transcriptional start site is similarly located in the rat IGFBP-4 gene, 249 nucleotides upstream of the translational initiation ATG codon (26). A 2.2-kb transcript is the major transcript for the human IGFBP-4 gene in colon cancer cells including the CaCo2 cells (2, 17). It thus appears likely that the transcription of the 2.2-kb transcript is initiated at the cap site identified in the 5' flanking region of the human IGFBP-4 gene in the present study. In previous studies, we and others have reported a significant regulation of IGFBP-4 mRNA levels in relation to growth and differentiation of the CaCo2 cells in culture (17, 27, 28). By Northern blot analysis, we observed a significant increase in the relative levels of IGFBP-4 mRNA in CaCo2 cells on days 5–7 of cell culture by approximately 200% compared with that on day 2, followed by a rapid decline in the levels of IGFBP-4 mRNA by days 9–13 (17). In the present study, we analyzed the relative levels of IGFBP-4 mRNA by radiolabeled RT-PCR (due to limited availability of RNA samples from cells growing in 35-mm cell culture dishes used in the current studies) and obtained essentially similar results. The relative levels of IGFBP-4 mRNA increased significantly from day 3 to days 5 and 6 and were approximately 150–250% higher compared with that on days 3 and 4. The IGFBP-4 mRNA levels declined rapidly thereafter, reaching very low levels by days 7–11 of culture. An important observation was that the transcriptional activity of the approximately 1.4 kb hIGFBP-4 promoter, measured in transient transfection assays, was significantly higher on day 5 of cell culture compared with that on days 3 and 7, mirroring the pattern of endogenous IGFBP-4 mRNA expression. Because the pattern of promoter activity closely resembled the pattern of mRNA expression by the endogenous IGFBP-4 gene, it is possible that the cis elements required for transcriptional activation (on day 5 of cell culture) and perhaps transcriptional deactivation (on days 7–9 of cell culture) are present in the 1.4 kb 5' flanking region of the IGFBP-4 gene. Our present and previous (17) studies also suggest that endogenous factors required for the up-regulation of the transcriptional activity of the IGFBP-4 gene and of the approximatley 1.4 kb promoter fragment are probably available to the cells in a cell density-dependent manner (wherein cells undergoing rapid proliferation at approximately 50–60% confluency provide the initial cues for activation of the IGFBP-4 gene/promoter). Under the culture conditions of the present study the growth pattern of the cells was almost identical to that published by us previously (17), wherein the cells demonstrated a rapid growth phase between days 2 and 7 of cell culture followed by a plateau phase of growth associated with cell confluence. We have previously reported that the cells are minimally differentiated during the rapid phase of CaCo2 cell growth between days 2–7 and undergo rapid differentiation in postconfluent cells between days 7–13 (17). Under the cell culture conditions of the present study, we similarly observed a significant increase in the differentiation of the cells by day 7 of culture (with negligible differentiation at earlier time points). Thus, a significant increase in the transcriptional activation of the 1.4 kb IGFBP-4 promoter and the endogenous IGFBP-4 gene preceded the on set of rapid differentiation of CaCo2 cells in culture. We therefore speculate that transcriptional activation of IGFBP-4 gene is perhaps an important physiological event that may be required for the rapid on set of differentiation by colonocytes in culture. It is possible that endogenous factors required for transcriptional activation of IGFBP-4 gene are perhaps regulated in a cell density-dependent manner that may be importantly involved in setting up the chain of events culminating in the differentiation of the enterocytes.

The concentration of several IGFBPs (including IGFBP-4) has been reported to significantly increase in the atretic follicles of ovaries from many species (29, 30, 31), suggesting that the increase in the availability of the inhibitory IGFBPs (especially IGFBP-4) plays an equally important role in apoptosis (29). Recent evidence suggests that a significant decrease in the proteolytic activity of IGFBP-4 may play a major role in up-regulating the levels of IGFBP-4 protein in the atretic follicles (30, 31); it remains to be determined if transcriptional activation of IGFBP-4 also plays a role in regulating the availability of IGFBP-4 (and hence IGFs) in the developing and atretic follicles, as suggested by some investigators (29). Thus, transcriptional activation/deactivation of IGFBP-4 gene may play an important role in the growth, differentiation, and apoptosis of epithelial cells in different tissues/organs. While the present studies were not designed to investigate the endogenous factors that may be involved in the transcriptional activation of the IGFBP-4 gene, the cloning and sequencing of the functional promoter for the IGFBP-4 gene has provided us for the first time with some important clues with respect to the possible nature of these factors as discussed below.

The approximately 1.45 kb human IGFBP-4 promoter sequence (5' to the initiation ATG codon) demonstrated only 74% homology to the corresponding rat IGFBP-4 promoter sequence (Fig. 4B). On sequence analysis of the 5' flanking region of the hIGFBP-4 gene, a TATA box consensus sequence was revealed 14 bp upstream of the major start site of transcription (present study). In the rat IGFBP-4 gene, the TATA box is located 27 bp upstream of the start site of transcription (26). The 1,254 bp 5' flanking region of the human IGFBP-4 gene lacked a CAAT box, a common regulatory element, which was reported to be located at nucleotides -100 to -106 in the rat IGFBP-4 gene (26). The location and number of the potential cis elements identified in the 5' flanking region of the human IGFBP-4 gene (present study) were also different from that identified in the corresponding region of the rat IGFBP-4 gene (26). Computer analysis of the 1,467-bp DNA segment, 5' to the translational initiation ATG codon, revealed several potential binding sites for transcription factors in the hIGFBP-4 promoter. Potential ATF/CREB (-1169 to -1161) and AP-I (-866 to -859) binding sites were located upstream from the promoter. Three sequences (-562 to -554; +228 to +235; +261 to +269) matching the early growth response factor I (Egr-I) binding site were found. Numerous potential SPI binding sites were present in the GC rich region of the human IGFBP-4 promoter. In the promoter region of the rat IGFBP-4 gene, on the other hand, at least three potential cAMP response elements (CRE) were located -360 to -353, -831 to -824, and -1264 to -1257, and three putative AP-I binding sites were located at nucleotides -156 to -150, -371 to -365, and -1388 to -1382 (26). Based on this information, even though the specific location and number of potential cAMP response elements and AP-I binding sites were different in the human and the rat IGFBP-4 gene promoter, it appears likely that agents that increase or decrease the levels of intracellular cAMP and/or protein kinases A and C can potentially regulate the transcription of both the rat and the human IGFBP-4 gene. In several human and rat cell types mRNA levels of IGFBP-4 have been reported to be increased in response to treatment with dibutyryl cAMP or agents that are known to increase intracellular levels of cAMP (32, 33, 34). Similarly, IGFBP-4 mRNA levels were significantly increased in response to PTH in SaOS-2 human osteoblasts (35) and in response to forskolin (cAMP agonist) in the TC-1 human bone marrow stromal cells (36). It is therefore possible that the single cAMP response element (ATF/CREB binding site), identified in the 1.4-kb human IGFBP-4 promoter sequence, may be a functional cis element required for the transcriptional activation of the IGFBP-4 promoter by endogenous factors in CaCo2 cells. The consensus octameric cAMP-response element TGACGTCA (CRE) and the heptameric phorbol ester-responsive element TGACTCA (TRE) are similar but are differentially regulated by cAMP and phorbol esters such as TPA (reviewed in 37). While cAMP can stimulate the transcriptional activation of promoters containing the CRE and the TRE elements, TPA has little effect on CRE containing promoters but regulates the transcriptional activity of TRE containing promoters (reviewed in Ref.37). The potential ATF/CREB binding site identified in the human IGFBP-4 gene by computer analysis (GTGACGACC) bears a higher homology with the CRE cis element than with the consensus TRE element.

An AP-I binding site was identified as the second common cis element in the human and the rat IGFBP-4 promoter sequence (Fig. 4A). In the human IGFBP-4 promoter sequence, a single AP-I binding site, bearing an almost 100% homology to the consensus AP-I binding sequence (TGAG/CTCA, 38), was located -870 to -859 upstream from the start site of the promoter. Several nuclear proteins including c-fos, c-jun, and related gene products have been identified as a part of the AP-I protein complex that binds the AP-I site (reviewed in 38). These complexes apparently possess both transcriptional activation and repression properties as per the reported transient transfection assay studies (reviewed in Ref.38). At the present time, the role of transcriptional factors that bind the AP-I binding site in regulating the mRNA levels for IGFBP-4 is not known. The cis element CRE is related to several AP-I binding sites, but the nuclear proteins CREB/ATF bind the AP-I sites with significantly lower affinity than to the CRE sites (38). It thus remains to be seen if the single AP-I binding site identified so far in the human IGFBP-4 promoter sequence is required for transcriptional activation (or repression) of the promoter. Further studies with truncated and mutated promoter sequences will help us to answer this question.

As per current knowledge, IGFs do not appear to have a direct role to play in the transcriptional regulation of IGFBP-4 mRNA levels but are mainly involved in the post-translational regulation of IGFBP-4 levels by enhancing the proteolytic degradation of IGFBP-4 in the conditioned media of cells that are secreting specific proteolytic enzymes (39, 40, 41, 42). In vascular smooth muscle cells, a significant increase in the level of IGFBP-4 mRNA was reported in a cell density-dependent manner, which was unaffected by IGF-I treatment (42). It thus appears unlikely that IGF-II functions as the endogenous regulator of the transcriptional activity of IGFBP-4 promoter in CaCo2 cells. Endogenous factors other than IGFs are perhaps responsible for the transcriptional activation of the IGFBP-4 promoter in a cell density (proliferative vs. differentiation?)-dependent manner.

1,25-dihydroxyvitamin D₃ (43), retinoic acid (RA), and estrogens (44) are a few other agents that have been examined for their effect on the IGFBP-4 expression levels. All three steroidal agents were reported to elevate the levels of IGFBP-4 mRNA in either human osteosarcoma cells (43) or estradiol receptor positive human breast cancer cells (44). Steroid response elements that can bind receptors for vitamin D₃, RA, or estrogens, however, were not identified in the approximately 1.4 kb 5' flanking promoter sequences of either the human IGFBP-4 gene (present study) or the rat IGFBP-4 gene (26). It remains possible that enhancer elements 5' to the 1.4 kb promoter sequence are present in the human and the rat IGFBP-4 genes. A sequence TGTTCACT, identical to the progesterone receptor binding site in the uteroglobin gene (45), was identified in the rat IGFBP-4 promoter region (26). The 1,254-bp promoter region (5' of the cap site of the human IGFBP-4 gene), however, was devoid of a progesterone receptor binding element (present study). It is possible that a progesterone receptor binding site is present further upstream in the human IGFBP-4 gene promoter, but its role in transcriptional regulation of IGFBP-4 gene in human colon cancers is questionable since human colon cancers are not known to express the progesterone receptor (46, 47).

Interestingly, at least three sequences closely matching the early growth response factor-I binding site were found in the human IGFBP-4 5' flanking promoter region; similar sequences are also present in the rat IGFBP-4 gene (as per computer analysis of the rat IGFBP-4 promoter sequence published by Gao et al., 26). Egr-I belongs to a family of transcription factors, such as c-fos and c-jun, that are rapidly induced as a first step in response to several mitogens including growth factors and the tumor promoter, TPA (reviewed in Ref.48). Extracellular stimuli that induce Egr-I also include developmental or differentiation cues in some cell types. In several cell types, a rise in Egr-I expression is correlated with differentiative processes (reviewed in Ref.48). For example, RA induces differentiation of osteoblasts in relation to a rapid induction of Egr-I, suggesting a role for Egr-I in differentiation of the osteoblastic cells (reviewed in Ref.48). Egr-I expression has been demonstrated to be necessary for differentiation of the myeloid cells along the macrophage lineage (48). A role of Egr-I expression in the differentiation of colonic epithelial cells is unknown. In the present study at least one Egr-I binding site (-562 to -554) was included in the promoter segment used in the transient transfection studies with the IGFBP-4 promoter-LUC expression vector. It remains to be determined if the Egr-I binding site played a role in either transcriptional activation (at day 5 of cell culture) or deactivation (at days 7–9 of culture) of the IGFBP-4 promoter in CaCo2 cells. Because Egr-I can be potentially induced both in response to growth factors and in relation to differentiation, it is possible that the Egr-I binding sites in the IGFBP-4 gene may play a role in the transcriptional regulation of the gene both during the proliferative and the differentiation phases of the CaCo2 cell growth in culture.

Thus, the cloning and sequencing of the human IGFBP-4 promoter that apparently contains the cis elements required for transactivation and deactivation, in a manner similar to the expression profile of the endogenous gene, provides a valuable tool for investigating the specific endogenous (cell density-dependent?) factors that may be required for regulating the transcriptional activity of the hIGFBP-4 gene in colonocytes.

	Acknowledgments

 
We would like to acknowledge the technical help of Ms. Azar Owlia and Ms. Uma Yallampalli and the secretarial help of Ms. Kay Smith.

	Footnotes

 
¹ These studies were supported by National Cancer Institute Grant CA-60087 (to P.S.). Parts of this study were published in its preliminary form as an abstract. In: Program and Abstracts of The Endocrine Society 76th Annual Meeting, P2-108, 1996.

Received August 2, 1996.

	References

Top Abstract Introduction Material and Methods Results Discussion References

 

1. Shimasaki S, Ling N 1991 Identification and molecular characterization of insulin-like growth factor binding proteins (IGFBP-1, -2, -3, -4, -5 and -6). Prog Growth Factor Res 3:243–266[CrossRef][Medline]
2. Singh P, Dai B, Yallampalli C, Xu Z 1994 Expression of IGF-II and IGF-binding proteins by colon cancer cells in relation to their growth response to IGFs. Am J Physiol 267:G608–G617
3. Singh P, Rubin N 1993 Insulin-like growth factors and insulin-like binding proteins in colon cancer. Gastroenterology 105:1218–1237[Medline]
4. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[CrossRef][Medline]
5. Cohn P, Lamson G, Okajima T, Rosenfeld RG 1993 Transfection of the human insulin-like growth factor binding protein-3 gene into Balb/c fibroblasts inhibits cellular growth. Mol Endocrinol 7:380–386[Abstract]
6. Jones JI, Gockerman A, Busby Jr WH, Camacho-Hubner C, Clemmons DR 1993 Extracellular matrix contains insulin-like growth factor binding protein-5: potentiation of the effects of IGF-I. J Cell Biol 121:679–697[Abstract/Free Full Text]
7. Oh Y, Muller HL, Pham H, Lamson G, Rosenfeld RG 1992 Non-receptor mediated, post-transcriptional regulation of insulin-like growth factor binding protein (IGFBP)-3 in Hs578T human breast cancer cells. Endocrinology 131:3132–3135
8. Amarnani S, Merriman HL, Linkhart TA, Baylink DJ, Mohan S 1993 Autocrine regulators of MC3T3–E1 cell proliferation. J Bone Miner Res 8:157–165[Medline]
9. Adashi EY, Resnick CE, Ricciarelli E, Hurwitz A, Kokia E, Tedeschi C, Botero L, Hernandez ER, Rosenfeld RG, Carlsson-Skwirut C, Francis GL 1992 Granulosa cell-derived insulin-like growth factor (IGF) binding proteins are inhibitory to IGF-I hormonal action. J Clin Invest 90:1593–1599
10. Culouscou J-M, Shoyab M 1991 Purification of a colon cancer cell growth inhibitor and its identification as an insulin-like growth factor binding protein. Cancer Res 51:2813–2819[Abstract/Free Full Text]
11. Singh P, Dai B, Dhruva B, Widen S 1994 Episomal expression of sense and anti-sense IGF-binding protein-4 cDNA, alters the mitogenic response of a human colon cancer cell line (HT-29) to IGF-I. Cancer Res 54:6563–6570[Abstract/Free Full Text]
12. Mohan S, Nakao Y, Honda Y, Landale E, Leser U, Dony C, Lang K, Baylink DJ 1995 Studies on the mechanisms by which insulin-like growth factor (IGF) binding protein-4 (IGFBP-4) and IGFBP-5 modulate IGF actions in bone cells. J Biol Chem 270:20424–20431[Abstract/Free Full Text]
13. Singh P, Yallampalli U, Rajaraman S, Owlia A IGF-binding protein 3 (BP3) potentiates the mitogenic effects of IGF-I on colon cancer cells that are positive for cell-surface associated BP3. Program of the 76th Annual Meeting of the Endocrine Society, Anaheim, CA, 1994, p 551 (Abstract)
14. Elgin RG, Busby WH, Clemmons DR 1987 An insulin-like growth factor (IGF) binding protein enhances the biologic response to IGF-I. Proc Natl Acad Sci USA 84:3254–3258[Abstract/Free Full Text]
15. Oh Y, Müller HL, Pham H, Rosenfeld RG 1993 Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578T human breast cancer cells. J Biol Chem 268:26045–26048[Abstract/Free Full Text]
16. Andress DL 1995 Heparin modulates the binding of insulin-like growth factor (IGF) binding protein-5 to a membrane protein in osteoblastic cells. J Biol Chem 270:28289–28296[Abstract/Free Full Text]
17. Singh P, Dai B, Yallampalli U, Lu X, Schroy PC 1996 Proliferation and differentiation of a human colon cancer cell line (CaCo-2) is associated with significant changes in the expression and secretion of IGF-II and IGF binding protein-4: role of IGF-II. Endocrinology 137:1764–1774[Abstract]
18. Holthuizen P, Van Dijk MA, Rodenburg RJ, Koonen-Reemst AM, Sussenbach JS 1993 Transcriptional regulation of the major promoters of the human IGF-II gene. Mol Reprod Dev 35:391–393[CrossRef][Medline]
19. Rodenburg RJ, Teertstra W, Holthuizen PE, Sussenbach JS 1995 Postnatal liver-specific expression of human insulin-like growth factor-II is highly stimulated by the transcriptional activators liver-enriched activating protein and CCAAT/enhancer binding protein-alpha. Mol Endocrinol 9:424–434[Abstract]
20. Pierce JC, Sternberg N, Sauer B 1992 A mouse genomic library in the bacteriophage P1 cloning system: organization and characterization. Mamm Genome 3:550–558[CrossRef][Medline]
21. Shimasaki S, Uchiyama F, Shimonaka M, Ling N 1990 Molecular cloning of the cDNAs encoding a novel insulin-like growth factor-binding protein from rat and human. Mol Endocrinol 4:1451–1458[Abstract]
22. Sanger F, Coulson AR 1975 A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J Mol Biol 94:441–448[CrossRef][Medline]
23. Singh P, Xu Z, Dai B, Rajaraman S, Rubin N, Dhruva B 1994 Incomplete processing of progastrin expressed by human colon cancer cells: role of non-carboxyamidated gastrin in proliferation. Am J Physiol 266:G459–G468
24. Peterson MD, Mooseker MS 1992 Characterization of the enterocyte-like brush border cytoskeleton of the C2BBe clones of the human intestinal cell line, Caco-2. J Cell Sci 102:581–600[Abstract/Free Full Text]
25. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
26. Gao K, Ling N, Shimasaki S 1993 Structure of the rat insulin-like growth factor binding protein-4 gene. Biochem Biophys Res Commun 190:1053–1059[CrossRef][Medline]
27. Oguchi S, Walker WA, Sanderson IR 1994 Profile of IGF-binding proteins secreted by intestinal epithelial cell changes with differentiation. Am J Physiol 267:G843–G850
28. Park JH, Corkins Mr, Vanderhoof JA, Caruso NM, Hrbek MJ, Schaffer BS, Slentz DH, McCusker RH, MacDonald RG 1996 Expression of insulin-like growth factor-II and insulin-like growth factor binding proteins during Caco-2 cell proliferation and differentiation. J Cell Physiol 166:396–406[CrossRef][Medline]
29. Monget P, Monniaux D 1995 Growth factors and the control of folliculogenesis. J Reprod Fertil 49:321–333
30. Besnard N, Pisselet C, Zapf J, Hornebeck W, Monniaux D, Monget P 1996 Proteolytic activity is involved in changes in intrafollicular insulin-like growth factor-binding protein levels during growth and atresia of ovine ovarian follicles. Endocrinology 137:1599–1607[Abstract]
31. Chandrasekher YA, Van Dessel HJ, Fauser BC, Giudice LC 1995 Estrogen- but not androgen-dominant human ovarian follicular fluid contains an insulin-like growth factor binding protein-4 protease. J Clin Endocrinol Metab 80:2734–2739[Abstract]
32. LaTour D, Mohan S, Linkhart TA, Baylink DJ, Strong DD 1990 Inhibitory insulin-like growth factor-binding protein: cloning, complete sequence, and physiological regulation. Mol Endocrinol 4:1806–1814[Abstract]
33. Mohan S, Bautista CM, Wergedal J, Baylink DJ 1989 Isolation of an inhibitory insulin-like growth factor (IGF) binding protein from bone cell-conditioned medium: a potential local regulator of IGF action. Proc Natl Acad Sci USA 86:8338–8342[Abstract/Free Full Text]
34. Torring O, Firek AF, Heath III H, Conover CA 1991 Parathyroid hormone and parathyroid hormone-related peptide stimulate insulin-like growth factor-binding protein secretion by rat osteoblast-like cells through a adenosine 3',5'-monophosphate-dependent mechanism. Endocrinology 128:1006–1014[Abstract]
35. Kudo Y, Itatsu S, Iwashita M, Iguchi T, Takeda T 1995 Effects of estrogen and parathyroid hormone on osteoblastic activity via regulating the binding activity of insulin-like growth factor binding protein-4 in SaoS-2 cell: implications for the pathogenesis of postmenopausal osteoporosis. Biochim Biophys Acta 1245:402–406[Medline]
36. Grellier P, Yee D, Gonzalez M, Abboud SL 1995 Characterization of insulin-like growth factor binding proteins (IGFBP) and regulation of IGFBP-4 in bone marrow stromal cells. Br J Haematol 90:249–257[Medline]
37. Hoeffler JP, Deutsh PJ, Lin J, Habener JF 1989 Distinct adenosine 3',5-monophosphate and phorbol ester-responsive signal transduction pathways converge at the level of transcriptional activation by the interactions of DNA-binding proteins. Mol Endocrinol 3:868–880[Abstract]
38. Curran T, Franza Jr BR 1988 Fos and Jun: the AP-1 connection. Cell 55:395–397[CrossRef][Medline]
39. Price WA, Moats-Staats BM, Stiles AD 1995 Insulin-like growth factor-I (IGF-I) regulates IGFBP-3 and IGFBP-4 by multiple mechanisms in A549 human adenocarcinoma cells. Am J Respir Cell Mol Biol 13:466–476[Abstract]
40. Irwin JC, Dsupin BA, Giudice LC 1995 Regulation of insulin-like growth factor-binding protein-4 in human endometrial stromal cell cultures: evidence for the ligand-induced proteolysis. J Clin Endocrinol Metab 80:619–626[Abstract]
41. Conover CA, Durham SL, Zapf J, Masiarz FR, Kiefer MC 1995 Cleavage analysis of insulin-like growth factor (IGF)-dependent IGF-binding protein-4 proteolysis and expression of protease-resistant IGF-binding protein-4 mutants. J Biol Chem 270:4395–4400[Abstract/Free Full Text]
42. Kamyar A, Pirola CJ, Wang H-M, Sharifi B, Mohan S, Forrester JS, Fagin JA 1994 Expression and insulin-like growth factor-dependent proteolysis of insulin-like growth factor-binding protein-4 are regulated by cell confluence in vascular smooth muscle cells. Circ Res 74:576–585[Abstract/Free Full Text]
43. Scharla SH, Strong DD, Rosen C, Mohan S, Holick M, Baylink DJ, Linhart TA 1993 1,25-dihydroxyvitamin D3 increases secretion of insulin-like growth factor binding proteins-4 (IGFBP-4) by human osteoblast-like cells in vitro and elevates IGFBP-4 serum levels in vivo. J Clin Endocrinol Metab 77:1190–1197[Abstract]
44. Shiekh SM, Shao Z-M, Hussain A, Chen J-C, Roberts Jr CT, LeRoith D, Fontanna JA 1993 Retinoic acid and estrogen modulation of insulin-like growth factor binding protein-4 gene expression and the estrogen receptor status of human breast carcinoma cells. Biochem Biophys Res Commun 193:1232–1238[CrossRef][Medline]
45. Bailly A, Le Page C, Rauch M, Milgrom E 1986 Sequence-specific DNA binding of the progesterone receptor to the uteroglobin gene: effects of hormone, antihormone and receptor phosphorylation. EMBO J 5:3235–3241[Medline]
46. Singh P, Townsend Jr CM, Thompson JC, Narayan S, Guo Y-S 1990 Hor- mones in colon cancer: past and prospective studies. Cancer J 3:28–33
47. Singh P, Reubi JC, Rajakumar G, Guo Y-S, Prioux H, Chicone L 1993 In vivo mitogenic effects of estradiol on colon cancer: role of gastrin and gastrin receptors. J Steroid Biochem Mol Biol 46:49–60[CrossRef][Medline]
48. Gashler A, Sukhatme VP 1995 Early growth response protein-I (Egr-I): prototype of a zinc-finger family of transcription factors. Prog Nucleic Acid Res Mol Biol 50:191–224[Medline]
49. Needleman SB, Wunsch CD 1970 A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48:443–53[CrossRef][Medline]
50. Smith TF, Waterman MS 1981 Comparative biosequence. Adv Appl Math 2:482–489[CrossRef]

This article has been cited by other articles:

				H. Sato, T. Yazawa, T. Suzuki, H. Shimoyamada, K. Okudela, M. Ikeda, K. Hamada, H. Yamada-Okabe, M. Yao, Y. Kubota, et al. Growth Regulation via Insulin-Like Growth Factor Binding Protein-4 and -2 in Association with Mutant K-ras in Lung Epithelia Am. J. Pathol., November 1, 2006; 169(5): 1550 - 1566. [Abstract] [Full Text] [PDF]

				H. Wu, A. Owlia, and P. Singh Precursor peptide progastrin1-80 reduces apoptosis of intestinal epithelial cells and upregulates cytochrome c oxidase Vb levels and synthesis of ATP Am J Physiol Gastrointest Liver Physiol, December 1, 2003; 285(6): G1097 - G1110. [Abstract] [Full Text] [PDF]

				M. Fan, M. E. Goodwin, M. J. Birrer, and T. C. Chambers The c-Jun NH2-terminal Protein Kinase/AP-1 Pathway Is Required for Efficient Apoptosis Induced by Vinblastine Cancer Res., June 1, 2001; 61(11): 4450 - 4458. [Abstract] [Full Text] [PDF]

C. Qin, P. Singh, and S. Safe Transcriptional Activation of Insulin-Like Growth Factor-Binding Protein-4 by 17{beta}-Estradiol in MCF-7 Cells: Role of Estrogen Receptor-Sp1 Complexes Endocrinology, June 1, 1999; 140(6): 2501 - 2508. [Abstract] [Full Text]</