help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Revskoy, S.
Right arrow Articles by Redei, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Revskoy, S.
Right arrow Articles by Redei, E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ETHANOL
*TESTOSTERONE
Endocrinology Vol. 138, No. 1 389-396
Copyright © 1997 by The Endocrine Society


ARTICLES

Corticotropin-Releasing Hormone and Proopiomelanocortin Gene Expression Is Altered Selectively in the Male Rat Fetal Thymus by Maternal Alcohol Consumption1

Sergei Revskoy, Ildiko Halasz and Eva Redei

Neuroendocrine Research Laboratory, Departments of Psychiatry (S.R., I.H., E.R.) and Pharmacology (E.R.), University of Pennsylvania, Philadelphia, Pennsylvania 19104

Address all correspondence and requests for reprints to: Sergei Revskoy, M.D., Ph.D., The Asher Center, Department of Psychiatry, Northwestern University Medical School, Ward Building 9–233, 303 East Chicago Avenue, Chicago, Illinois 60611-3008. E-mail: s-revskoy{at}nwu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study was carried out to investigate how hormonal changes caused by chronic alcohol exposure of rats during the late period of gestation are coordinated with neuroendocrine functions of the fetal thymus, namely thymic expression of CRH and POMC genes. Alcohol consumption by pregnant dams led to a 5-fold elevation of plasma corticosterone (CORT) levels and significantly decreased fetal CORT levels. This generally inverse correlation between maternal and fetal CORT was absent in alcohol-consuming dams and their male fetuses on day 19 of gestation. These day 19 fetuses also had an attenuated plasma testosterone surge that occurred in the male control (pair-fed) fetus on day 19 of embryonic life. Furthermore, fetal alcohol exposure (FAE) resulted in a significant increase in thymic CRH and a decrease in thymic POMC expression in the male fetuses only, specifically on embryonic day 19. Thus, the strong positive correlation between CRH and POMC gene expression in the thymus of pair-fed male and female FAE fetuses was abolished in the FAE males. However, regardless of embryonic age or treatment, a strong positive correlation between thymic POMC gene expression and plasma testosterone levels in the male fetuses was detected. These data suggest that the sexually dimorphic effect of FAE on the fetal thymic POMC and CRH expression in males is driven by testosterone and may be related, therefore, to the presence of alcohol at the time of the prenatal testosterone surge in the male fetuses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PRENATAL ALCOHOL exposure results in multiple disturbances of the endocrine system of offspring, ranging from altered neuroendocrine response to stress to male hypogonadism in laboratory animals (1, 2). These hormonal changes are usually considered as having a significant impact on immune system development and function (3, 4). Indeed, exposure to alcohol during early fetal development is also associated with immune deficits in the offspring that may lead to increased vulnerability to infectious diseases or cancer. In particular, Johnson et al. (5) reported severe immunodeficiencies in both T and B cells in children with fetal alcohol syndrome compared to age-matched controls. Amman et al. (6) described four patients with DiGeorge syndrome, which is accompanied by a congenital absence of the thymus, whose mothers had a history of alcoholism. Experimental data reveal a link between in utero alcohol exposure and significant reduction of thymic size together with impaired immune surveillance (7, 8). These observations suggest an altered process of thymic development in fetuses exposed to alcohol in utero, leading to immune suppression in the offspring. However, whether these alterations in immune development are mediated through changes in the neuroendocrine system in response to alcohol exposure in utero remains unclear.

Fetal alcohol exposure (FAE) leads to marked, long term suppression of T cell-dependent functions, such as splenocyte proliferation in response to mitogens (9, 10). These latter effects are observed primarily in the male offspring and are abolished by maternal adrenalectomy (9, 10). This suggests that during fetal development, alcohol-induced changes in the mother’s adrenal function produce a permanent effect on the developing immune system of the male fetuses. The change(s) in the maternal adrenal function responsible for the immunosuppressive effect of alcohol on the male offspring is not known. A role for maternal corticosterone (CORT) in altering the thymic development of the FAE fetus is suggested by the finding that maternal administration of ACTH and glucocorticoids results in decreased fetal thymic weight (11), similar to that which occurs in FAE (6, 7, 9, 12). Indeed, basal plasma CORT levels were shown to be increased in ethanol-consuming pregnant rats throughout gestation (13). As unbound CORT can cross the placenta, elevated maternal CORT levels may affect fetal immune development directly through altering thymocyte differentiation and proliferation. Alternatively, maternal CORT may influence the development of neuroendocrine functions of the fetal hypothalamic-pituitary-adrenal axis or the fetal thymus, leading to altered thymic development.

The presence of both thymic CRH (14, 15) and POMC transcripts (16) has been recently identified in rats. The CRH-POMC system in the thymus seems to be a functional part of the thymic microenvironment, as CRH and POMC-derived peptides, namely ACTH, ß-endorphin, and {alpha}MSH, have been shown to be potent immunomodulators (4). Thus, changes in their local thymic levels in response to prenatal alcohol exposure, controlled by expression of the corresponding genes, might contribute to shifts in the development of the fetal immune system. Previous studies have also demonstrated that the expression of CRH in the mature thymus is under negative glucocorticoid regulation, similar to hypothalamic CRH (17), whereas the suppressive effect of glucocorticoids on POMC expression in thymus is much less evident (18, 19). Thus, analysis of the FAE-induced changes in fetal thymic CRH and POMC expression may provide specific information on the response of the developing thymus to FAE and help to elucidate a mechanism mediating the effect of FAE on T cell function.

The period before parturition is considered to be critical in lymphocyte maturation in rodents, because adult-like precursor cells (20, 21) as well as mature accessory cells (22) populate the thymus by embryonic days 19–20 (E19-20). This same developmental period is also critical for sexual differentiation, as the prenatal testosterone surge occurs on E18-19 in the male fetus (23). Therefore, neuroendocrine disturbances in the thymic microenvironment during this critical period may alter the development of thymocytes, resulting in T cell dysfunction in the adult organism.

In the present study we have investigated the changes in expression of the steroid-regulated genes CRH and POMC in the male and female fetal thymus caused by maternal alcohol consumption. We have also investigated whether these changes correlate with the alcohol-induced changes in maternal and fetal plasma CORT and fetal plasma testosterone (T) levels. The determination of the relationship between these hormonal and thymic neuroendocrine parameters is the focus of the present study.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and diet
Female Sprague-Dawley rats (Charles River Breeding Laboratories, Wilmington, MA), 200–250 g, were maintained on standard laboratory chow and water ad libitum, with a 12-h light, 12-h dark cycle. After overnight mating, the presence of sperm in the vaginal smear was used to designate the first day of gestation (or E1). On day 7, pregnant rats were placed on a liquid alcohol diet (Bioserv, Inc., Frenchtown, NJ) or on an isocaloric diet without alcohol, equal in volume to that consumed by the alcohol group. The ethanol diet contained 5% (wt/vol) ethanol and provided 35% ethanol-derived calories; maltose-dextrin was isocalorically substituted for ethanol in the liquid control diet. Dams were maintained on alcohol or the pair-fed (PF) diet throughout the experiment. Dams were killed by decapitation between 1000–1200 h, the fetuses were removed from the uterine horn, and the fetal sex was determined using measurement of anogenital distance. Maternal and fetal blood samples were collected into heparinized tubes and capillaries, respectively. All tissues were immediately frozen on dry ice and stored at -80 C until extraction. Thymus specimens were obtained from rat fetuses on E19 and E21 and individually analyzed.

RIAs
CORT concentrations were measured as described previously in unextracted plasma, using an [125I]CORT RIA (24). Assay sensitivity was 0.01 ng/ml; the intraassay coefficient of variation was 8.5%.

T was determined in 25 µl unextracted plasma using the Coated-Tube 125I RIA Kit (ICN, Costa Mesa, CA). The assay sensitivity was 0.06 ng/ml; the intraassay coefficient of variation was 8.2%.

Plasma ACTH levels were measured as described previously (24). Briefly, ACTH levels were measured in 10–50 µl unextracted plasma with antiserum (Incstar, Stillwater, MN), which binds 30–35% of [125I]ACTH-(1–39) at equilibrium. The assay sensitivity was 6 pg/ml (0.5 pg/tube), with an intraassay coefficient of variation of 6.25%. Plasma hormone concentrations were measured in a single assay.

RNA extraction and Northern analysis
Extraction of total RNA was performed using Trizol reagent, according to the manufacturer’s protocol (Life Technologies, Grand Island, NY). Total RNA concentrations were measured on Beckman spectrophotometer at 260 nm (Palo Alto, CA), and each sample was adjusted to the final concentration of 1 µg/µl. The quantity and quality of RNA were confirmed by gel electrophoresis.

Ten to 20 µg RNA from individual samples in each group were run on 1% agarose-formaldehyde gels. The RNA was blotted onto nitrocellulose filters in 20 x SSC (saline sodium citrate) for approximately 18 h and fixed to the filter by UV cross-linking. Labeling and hybridization were performed as described previously (10). Filters were hybridized with 32P complementary DNA (cDNA) probes for ß-actin and c-fos. The ß-actin probe was a 700-bp insert from a plasmid containing a mouse ß-actin cDNA (25). The c-fos probe was the human c-fos gene (26). Densitometry was carried out using an Image Analyzer and Macintosh-based Brain 2.1 system (Drexel University, Philadelphia, PA) with gray scale calibration.

Molecular probes and synthetic oligonucleotides
Primers for rat POMC (16), CRH (27), glucocorticoid receptor (GR) (28), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH); Clontech, Palo Alto, CA) messenger RNAs (mRNAs) were designed as described previously. The sequences of the synthesized oligomers and their relationship to the organization of POMC, CRH, GR, and GAPDH genes are: POMC55, (5') EX2 GGACCTCACCACGGAAAGCAACCTG (bp 1143–1167); POMC50, (5') EX3 TGCTCCGGTTGCAAGAAATTC (bp 1322–1342); POMC37, (3') EX3 AGCGGAAGTGCTCCATGGAGTGAGTAGGA (bp 1461–1485); CRH51, (5') EX1 CTCAGAGCCCAAGTACGTTGA (bp 342–362); CRH50, (5') EX2 GAGGTACCTCGCAGAACAAC (bp 446–465); CRH31, (3') EX2 TGCTCCGGTTGCAAGAAATTC (bp 1341–1321); GAPDH, (5') EX1 TGAAGGTCGGTGCAACGGATTTGGC (bp 35–60); GAPDH, (3') EX9 CATGTAGGCCATGAGGTCCACCAC (bp 994-1017); GR, (5') GGGAATTCAATACTCATGGTC (bp 1838–1857); and GR, (3') GGGAATTCAATACTCATGGTC (bp 2351–2371).

Oligo(dt)15 was used for the synthesis of cDNAs by reverse transcription (RT) using a modification of the technique described by Rappolee et al. (29). Briefly, 1 µg total cellular RNA was reverse transcribed, using 400 U Moloney leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) in 20 µl of a mixture containing 50 mM Tris-HCl, pH 8.2; 10 mM, dithiothreitol; 75 mM KCl; 10 U ribonuclease inhibitor (Promega, Madison, WI); and 0.2 mM each of ATP, GTP, CTP, and TTP (Pharmacia, Piscataway, NJ). RT was performed at 42 C for 1 h, followed by 5 min at 95 C. PCR was performed on the one tenth of the total cDNA in 50 µl 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 2.2 mM MgCl; 0.01% (wt/vol) gelatin; 20 pmol of 5'- and 3'-primers of both target (POMC, CRH, or GR) and reference (GAPDH) genes; and 2 U Taq DNA polymerase (Promega). The temperature profile of each cycle consisted of 30 sec at 95 C for denaturation, 1 min at 56–66 C for annealing, and 2 min at 72 C for elongation. Thirty-three cycles were used for amplification, with the 33rd cycle elongation time prolonged to 7 min to allow extension of incomplete DNA fragments. Control samples without RNA and without reverse transcriptase were included in each set of studied samples. One tenth of the PCR reaction mixture was loaded onto a 2% agarose LE (Fisher, Fairlawn, NJ) gel, run in Tris-acetate-EDTA buffer, and stained with ethidium bromide.

RT-PCR products obtained by amplification of either RNA isolated from the rat pituitary (using POMC37 and POMC50 primers, resulting in a 178-bp fragment) or RNA isolated from the rat hypothalamus (using CRH31 and CRH50 primers, resulting in a 192-bp fragment) were used as POMC or CRH probes, respectively. GAPDH cDNA was used as a specific GAPDH probe. After alkaline capillary transfer of the Southern gels to a membrane Hybond-N (Amersham Corp., Arlington Heights, IL), the PCR products were hybridized using POMC, CRH, or GR probes labeled with [32P]CTP (Boehringer Mannheim, Indianapolis, IN). The blots were developed after 5–15 min at room temperature for GAPDH, 15–60 min at -80 C for POMC, 4 h at -80 C for GR, and 12–24 h at -80 C for CRH probes. The relative abundance of the POMC/CRH/GR fragments compared to GAPDH-derived ones was determined by densitometric scanning of the Kodak XAR-5 film (Eastman Kodak, Rochester, NY) for the corresponding PCR-derived fragments using an Image Analyzer and Macintosh-based Brain 2.1 system with gray scale calibration. The level of POMC/CRH/GR gene expression was represented as a ratio of the absorbance of POMC/CRH/GR-derived bands to the absorbance of GAPDH.

Statistical analysis
Data were analyzed using a three-way (treatment, time, and sex) ANOVA. Post-hoc comparisons were made using t tests. For all statistical tests, P < 0.05 (corrected for multiple comparisons) was considered statistically significant. Data were also analyzed using the Pearce coefficient of correlation. The software package was Systat for Windows (SYSTAT Inc., Evanston, IL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasma CORT and T levels
In FAE dams, plasma CORT levels increased almost 5-fold on day 19 of gestation (G19) compared to PF controls and remained equally high on G21 [F(1, 13) = 14.77; P = 0.002; Fig. 1aGo]. However, no significant differences in plasma ACTH levels in pregnant rats were detected at any time (data not shown). In contrast to maternal CORT, fetal CORT levels were significantly lower on E21 than on E19 in both male and female fetuses (F = 22.73; P < 0.001; Fig. 1bGo). Furthermore, fetal CORT levels were significantly lower in alcohol-exposed fetuses regardless of gender and embryonic age (F = 37.77; P < 0.001; Fig. 1bGo). Interestingly, the correlation between maternal and fetal plasma CORT was negative and highly significant (r = -0.5; P = 0.003; Fig. 1cGo). When this correlation was further analyzed according to time of gestation and gender, it became clear that the correlation between maternal and fetal CORT was inverse and highly significant in each case, with the exception of male FAE fetuses on E19, in which the correlation was actually positive, although not significant (r = 0.26; P = NS).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. a, The influence of chronic alcohol consumption on plasma CORT concentrations in pregnant rats during the late period of gestation (PF, pair-fed dams; FAE, alcohol-consuming dams). Blood was collected at 1000 h. Values are the mean ± SEM of four to five animals per group. *, P < 0.05 PF vs. FAE. b, The influence of FAE on plasma CORT concentrations in male and female fetuses (PF, fetuses of pair-fed dams; FAE, fetuses of alcohol-consuming dams). Plasma CORT was measured in individual fetuses. CORT levels were then averaged within the litter by sex and analyzed statistically by litter (n = 4–5/group). *, P < 0.05 PF vs. FAE. c, Inverse correlation between maternal and fetal plasma CORT levels. Mean CORT values of littermates, separated by sex, were correlated with CORT values of the corresponding dams. {blacktriangleup}, CORT levels of FAE male litters obtained on E19. {triangleup}, CORT levels of all other groups. The correlation coefficient includes all groups of animals.

 
In agreement with previous findings (23), a surge of plasma T was observed in PF male fetuses on E19 (Fig. 2Go). This T surge was dramatically and significantly attenuated in FAE male fetuses (F = 8.4; P = 0.005). T levels decreased by E21 in both treatment groups and were no longer altered by FAE.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. The influence of FAE on plasma T concentration in male and female fetuses. Fetal plasma was pooled within the litter by sex and analyzed statistically by litter. *, P = 0.005, PF males on E19 vs. FAE males on E19.

 
Thymic POMC, CRH, c-fos, and GR expression
Both POMC and CRH gene transcripts could be detected by RT-PCR in the fetal thymus. In general, POMC expression was more than 2 orders of magnitude higher than CRH gene expression in the fetal thymus, which was reflected in the much shorter exposure time for the POMC Southern blots compared to the CRH blots. The oligonucleotide primers for POMC were designed so that the upstream primer was located in the 5'-end of the second exon, and the downstream primer was located in the third exon. Therefore, the RT-PCR assay could detect the expression of both translated exons of the POMC gene, including the portion of the second exon coding for the signal and N-terminal peptides. CRH primers were located within the first and second exons and detected both the untranslated and translated regions of CRH mRNA. The sizes of these POMC and CRH PCR products (290 and 311 bp, respectively) were the same as that of the products found in the anterior pituitary and hypothalamus, respectively.

Figure 3aGo shows a representative Southern blot indicating the 290-bp POMC PCR product in the fetal thymus. POMC expression decreased from E19 to E21, especially in the PF group (Fig. 3bGo). There was a sex difference in the expression of POMC on E19, when POMC mRNA levels were significantly higher in the male PF thymi compared to those in females. This elevation in POMC on E19 in the male thymi was abolished by alcohol exposure in utero just as the prenatal surge of T was attenuated in FAE males. Accordingly, thymic POMC expression and plasma T levels were correlated highly, positively, and significantly (r = 0.972; P = 0.002) in male fetuses (Fig. 3cGo). However, there was no significant correlation between thymic POMC expression and either maternal or fetal plasma CORT levels (r = -0.18; P = NS and r = 0.24; P = NS, respectively).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. a, Representative Southern blot analysis of POMC-specific RT-PCR products derived from 1 µg thymic total RNA. The POMC-specific PCR 290-bp product and the GAPDH-specific RT-PCR 980-bp fragment are marked. The filter was probed first with 157-bp internal POMC RT-PCR fragment of the intact rat pituitary gland and then with the mouse GAPDH cDNA. b, The effect of alcohol exposure in utero on fetal thymic POMC mRNA detected by RT-PCR. One or two individual male and female fetal thymi were extracted for total RNA from each litter. Values represent the mean ± SEM (n = 5–6/group) ratio of optical density of the POMC signal normalized to GAPDH signal obtained from the same reaction tube. **, P < 0.001. c, Correlation between relative levels of thymic POMC mRNA measured by RT-PCR in individual male fetuses and their plasma T concentrations.

 
Thymic CRH was also measured by RT-PCR, and a representative Southern blot indicating the 311-bp CRH PCR product is shown in Fig. 4aGo. The developmental profile of CRH expression was similar to that of POMC, decreasing from E19 to E21 in both males and females (Fig. 4bGo). However, in contrast to POMC, thymic CRH expression was significantly (P = 0.009) increased in male FAE fetuses only, specifically at the time of the T surge (E19). There was no effect of FAE on female fetal thymic CRH expression at these time points during embryonic development. Unexpectedly, the linear correlation between CRH and POMC only tended to be significant (r = 0.3166; P = 0.057). However, when the data were further scrutinized, the correlation between CRH and POMC became highly significant (r = 0.592; P = 0.002) after removing the male FAE fetuses on E19 (Fig. 4cGo), further emphasizing the alcohol-induced changes that occur on E19 in the male FAE fetus. There was no significant correlation between CRH expression and any of the hormonal parameters measured (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. a, Representative Southern blot analysis of CRH-specific RT-PCR product derived from 1 µg fetal thymic total RNA. The CRH-specific RT-PCR fragment (311 bp) and the GAPDH-specific RT-PCR fragment (980 bp) are noted. The filter was probed first with a 190-bp internal CRH RT-PCR product derived from the intact rat hypothal amus and then with the mouse GAPDH cDNA. b, Effect of alcohol exposure in utero on fetal thymic levels of CRH mRNA detected by RT-PCR. The fetal thymic RNA samples were the same as those in Fig. 3bGo. Values represent the mean ± SEM (n = 5–6/group) ratio of optical density of the CRH signal normalized to GAPDH signal obtained from the same reaction tube. **, P < 0.001. c, Correlation between fetal CRH and POMC-specific RT-PCR products within the same thymus. Individual CRH and POMC values were correlated. {blacktriangleup}, FAE male fetal thymi obtained on E19. {triangleup}, All other groups. Data obtained from FAE male fetuses on E19 were excluded from the correlation coefficient.

 
The expression of c-fos gene in fetal thymi was determined by Northern blotting. Levels of c-fos mRNA decreased significantly from E19 to E21 [F(1, 32) = 12.28; P = 0.001; Fig. 5Go). FAE induced marked increases in c-fos mRNA levels on E19 only (time and treatment interaction: F = 4.96; P = 0.03). A significant positive correlation was found between c-fos and CRH gene expression in fetal thymi (r = 0.4317; P = 0.022).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Effect of alcohol exposure in utero on fetal thymic c-fos mRNA levels determined by Northern blot analysis in individual thymi. One or two male and female thymi were extracted for total RNA from each litter. Values represent the mean ± SEM (5–6/group) ratio of optical densities of the c-fos signal normalized to the ß-actin signal.

 
The relative expression of GR in fetal thymus was also measured by RT-PCR. GR expression was the highest in the thymus of PF male fetuses, specifically on E19, whereas GR expression was much lower in FAE male fetuses on the same day (Fig. 6Go). However, because of the low number of observations, these differences were not significant.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Effect of FAE on thymic GR mRNA. Total RNA from litter-representative male and female thymi were analyzed by RT-PCR followed by Southern blotting. The optical density of GR-specific PCR product was normalized to that of GAPDH-specific PCR product.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously reported (10) that FAE leads to suppressed T cell function in the male rat offspring, and that maternal adrenalectomy abolishes this suppression. Thus, maternal adrenal function may mediate, directly or indirectly, the effect of FAE on T cell development in the thymus. The direct effects would involve maternal adrenal steroids that cross the placenta and act on the developing thymus either directly or by altering fetal pituitary-adrenal function. Alternatively, as the thymus also expresses neuroendocrine-like hormones such as CRH and POMC, which are known to be regulated by these steroid hormones, indirect regulation of thymic development could occur through altering the expression of these neuropeptides.

In the present study, we characterized the changes in maternal and fetal CORT and fetal T levels in response to alcohol exposure in utero. We also investigated whether these hormonal changes correlate with the FAE-induced alterations in expression of the steroid-regulated genes CRH and POMC in the fetal thymus.

Elevated maternal plasma CORT levels were observed in alcohol-consuming dams, a finding similar to that reported previously (13). We also confirm and extend our previous finding that FAE suppresses the prenatal T surge observed in male fetuses on E19 (30). However, this study is the first to show that maternal CORT levels are inversely correlated with fetal plasma CORT levels, and that this correlation is disturbed in male FAE fetuses on E19. Our results suggest that this disturbance involves the concomitant presence of alcohol and decreased fetal T levels.

It has been previously suggested that CORT levels in fetal and maternal plasma undergo parallel changes throughout gestation (31) and respond to acute stress in a similar fashion (32, 33). In addition, fetal CORT is able to substitute for the lack of maternal CORT in adrenalectomized dams (34). Therefore, fetal CORT can be shared by the maternal circulation, and conversely, maternal CORT can regulate fetal pituitary-adrenal function if the placenta is relatively permeable to CORT in both directions. However, maternal as well as fetal CORT are substantially metabolized in the placenta by 11ß-hydroxysteroid dehydrogenase. The expression of this enzyme and the resulting inactivation of CORT increases with progressing pregnancy (35), limiting the mutual CORT exchange between maternal and fetal plasma, particularly toward the end of gestation. In addition, corticosteroid-binding globulin (CBG) production, which is also found in the placenta (36), is maintained at relatively high levels in the pregnant rat throughout gestation (37). Hence, the CBG-bound maternal CORT cannot cross the placenta and cannot be responsible for the increase in fetal plasma CORT on E19 observed in a number of studies (32, 38). However, acutely increased maternal glucocorticoids could remain partially unbound and cross the placenta; thus, increased maternal CORT after alcohol exposure may affect fetal pituitary-adrenal function before E19. In addition, as alcohol decreases glucocorticoid binding to CBG and GR (39), CORT may cross the placenta more easily in FAE animals.

Interestingly, the capacity to increase CBG production in response to environmental challenge is sexually dimorphic, as it is only observed in female fetuses (40). Therefore, female fetuses may be more protected by CBG from the increased maternal CORT that occurs after alcohol consumption in the dams. Whatever mechanism maintains the inverse relationship between fetal and maternal CORT levels in late gestation, the lack of such a correlation in FAE male fetuses suggests that this mechanism is probably disrupted by maternal alcohol consumption.

If alcohol-induced changes in maternal and, subsequently, fetal CORT levels are the direct cause of the long term suppression of T cell function in the FAE offspring, this suppression would occur in both male and female offspring, because fetal CORT levels are similar in male and female FAE fetuses. As only the male FAE offspring seem to be affected, then changes in CORT alone may not be sufficient to alter thymic development. By E19 the rat fetal thymus has already acquired glucocorticoid and sex hormone receptors (41, 42); therefore, hormonal changes can alter the expression of steroid-responsive genes. Indeed, a major finding of this study is the sexually dimorphic effect of FAE on the expression of thymic CRH and POMC genes. Maternal alcohol consumption had opposing effects on POMC and CRH gene expression in the male fetal thymus on E19; POMC expression decreased, whereas CRH expression increased. By contrast, FAE did not significantly affect POMC or CRH gene expression in female fetal thymus or on E21 in male fetal thymus (i.e. in the absence of elevated plasma T).

CORT and sex hormones act as major regulators of hypothalamic CRH and anterior pituitary POMC gene expression (43, 44). Glucocorticoids also suppress the expression of thymic CRH in the adult rat (17) and of POMC in normal human lymphocytes (45). Therefore, fetal thymic expression of CRH and POMC may also be regulated by these steroids. The regulation of CRH and POMC in the fetal thymus and its relevance in FAE-induced thymic changes remain unknown. POMC gene expression in transformed lymphocytes, which resemble immature thymocytes, was resistant to dexamethasone treatment (46). Furthermore, in contrast to FAE, other manipulations of the maternal-fetal corticosteroid milieu, such as maternal adrenalectomy or mild stress, do not change fetal thymus size (47). These findings suggest that the fetal thymus is relatively resistant to moderate fluctuations of fetal plasma corticosteroids, and therefore, glucocorticoids alone may not be sufficient to cause the effects of FAE on the fetal thymus. In fact, the present study suggests that the impact of both maternal and fetal CORT on the modulation of CRH and POMC gene expression in the fetal thymus appears insignificant. However, exposure to much higher doses of glucocorticoids during the prenatal period of development have been shown to cause substantial changes in T cell populations in rat thymus (48, 49). The lack of correlation between fetal thymic CRH or POMC gene expression and maternal or fetal plasma CORT levels suggests that CORT does not directly affect CRH and POMC gene expression in the fetal thymus, and therefore, the regulation of CRH and POMC expression in the fetal thymus is not identical to that in neuroendocrine tissues or even to that in the adult thymus.

In contrast to the lack of correlation between thymic CRH or POMC and maternal or fetal CORT, a close positive correlation between plasma levels of T and thymic POMC expression was observed in the male fetus. The physiological significance of this correlation may be related to the antiglucocorticoid activity of T on thymocytes (50). Androgen receptors have been found in adult rat thymus (51), and it is well established that T binds in various cellular compartments of the fetal thymus (42). In the mature thymus, the administration of dexamethasone results in an increase in the proportion of androgen receptor despite thymolysis, suggesting that androgen receptors are confined to the subpopulation of thymocytes resistant to glucocorticoids (51). Furthermore, it has been shown that the proportion of thymocytes in rodents treated with T shifts toward a greater proportion of mature CD4+ cells and a lower proportion of immature (CD8+CD4+) thymocytes (52). Therefore, in contrast to the commonly found thymolytic effect of T in the adults, it seems that a protective or even facilitating effect of T on thymocyte development may occur during certain periods of development.

The effect of CRH as well as POMC-derived peptides on the function of lymphoid cells has been demonstrated by a number of studies (4, 43). Although the presence of CRH peptide in rat lymphoid tissues seem to be well established (14), the production of POMC-derived peptides by the immune organs is widely disputed (53, 54). Moreover, the major form of POMC mRNA in the mature thymus was truncated, lacking the sequence encoding the signal peptide (55). In the present study, however, the presence of a full-length POMC transcript in the fetal thymus suggests that pituitary-like processing and secretion of POMC-derived peptides may occur there, as we have previously suggested (56). Moreover, our observation of a significant positive correlation between c-fos and CRH, and CRH and POMC gene expression in the thymus of control animals suggests that the mechanisms regulating transcription of these genes in the thymus retain some similarity to the neuroendocrine system.

Maternal alcohol consumption disrupts the physiological relationships between CRH and POMC expression in the thymus, as demonstrated by the loss of correlation between CRH and POMC gene expression in the male FAE thymus on E19. This phenomenon shows that alcohol at the time of the prenatal T surge causes a differential response of CRH or POMC gene expression. Recently, a similar dissociation between CRH and POMC-derived peptide levels in immune tissues was described in rats during chronic inflammatory stress (57).

In summary, the current findings of profound changes in many thymic neuroendocrine indexes in the male FAE fetus at the time of the T surge together with the previous findings of long term effects of alcohol exposure in utero on the T cell function of male offspring (10) support the hypothesis that alcohol interferes with certain critical androgen-dependent steps in lymphoid development. During the late period of gestation, the main developmental events in the thymus involve populations of T cell precursors, T cell receptor rearrangement, and formation of the T cell repertoire. Should maternal adrenalectomy, which reverses some T cell dysfunctions of FAE male offspring, reverse the effect of FAE on the fetal thymic parameters analyzed in this study, it would provide an important step in further understanding the role and significance of neuroendocrine factors in thymic development.


    Acknowledgments
 
The authors are grateful to Drs. P. A. Rittenhause and F. Aird for critically reviewing the manuscript.


    Footnotes
 
1 Presented at the Annual Meeting of the Society for Neuroscience, San Diego, CA, November 11–16, 1995. This work was supported by NIH Grant AA-07389. Back

Received May 29, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Weinberg J 1993 Neuroendocrine effects of prenatal alcohol exposure. Ann NY Acad Sci 697:86–96[Medline]
  2. Udani M, Parker S, Gavaler J, Van Tie DH 1985 Effect of the in utero exposure to alcohol upon male rats. Alcohol Clin Exp Res 9:355–359[Medline]
  3. Kincade PW, Medina KL, Smithson G 1994 Sex hormones as negative regulators of lymphopoiesis. Immunol Rev 137:119–134[CrossRef][Medline]
  4. Bateman A, Singh A, Kral T, Solomon S 1989 The immune-hypothalamic-pituitary-adrenal axis. Endocr Rev 10:92–112[Abstract/Free Full Text]
  5. Johnson S, Knight R, Marmier DJ, Steele RW 1981 Immune deficiency in fetal alcohol syndrome. Pediatr Res 15:908–911[Medline]
  6. Amman AJ, Wara EW, Conan MJ, Barrett DJ, Stiehm ER 1982 The DiGeorge syndrome and the fetal alcohol syndrome. Am J Dis Child 136:906–908[Abstract/Free Full Text]
  7. Gottesfeld Z, Abel EL 1991 Maternal and paternal alcohol use: effects on the immune system of the offspring. Life Sci 48:1–8[CrossRef][Medline]
  8. Gottesfeld Z, Trippe K, Wargovich MJ, Berkowitz AS 1992 Fetal alcohol exposure and adult tumorigenesis. Alcohol 9:465–471[CrossRef][Medline]
  9. Weinberg J, Jerrels TR 1991 Suppression of immune responsiveness: sex differences in prenatal ethanol effects. Alcohol Clin Exp Res 15:525–531[CrossRef][Medline]
  10. Redei E, Halasz I, Li L-F, Prystowsky M, Aird F 1993 Maternal adrenalectomy alters the immune and endocrine functions of fetal alcohol-exposed male offspring. Endocrinology 133:452–460[Abstract/Free Full Text]
  11. Angervall L, Lundin PM 1964 Corticosteroid action on the fetal thymus and spleen. Endocrinology 74:986–989
  12. Redei E, Clark WR, McGivern RF 1989 Alcohol exposure in utero results in diminished T-cell function and alterations in brain corticotropin-releasing factor and ACTH content. Alcohol Clin Exp Res 13:439–443[CrossRef][Medline]
  13. Weinberg J, Bezio S 1987 Alcohol-induced changes in pituitary-adrenal activity during pregnancy. Alcohol Clin Exp Res 11:274–280[CrossRef][Medline]
  14. Redei E 1992 Immuno-reactive and bioactive corticotropin-releasing factor in rat thymus. Neuroendocrinology 55:115–118[CrossRef][Medline]
  15. Aird F, Clevenger CV, Prystowsky MB, Redei E 1993 Corticotropin-releasing factor mRNA in rat thymus and spleen. Proc Natl Acad Sci USA 90:7104–7106[Abstract/Free Full Text]
  16. Revskoy S, Gupta D 1992 Ontogenetic studies of POMC gene expression in the immune organs in rats. Neuroendocrinol Lett 14:67–74
  17. Aird F, Halasz I, Redei E Glucocorticoids inhibit CRH expression in the rat thymus. 23rd Annual Meeting of the Society for Neuroscience, Washington DC, 1993, p 507 (Abstract)
  18. Batoeva GT, Chesnokov VN, Kozlov VA, Mertvetsov NP 1992 Absence of glucocorticoid inhibitory action on proopiomelanocortin gene expression in the immune system organs. Immunologia 3:13–15[CrossRef]
  19. Jessop DS, Lightman SL, Chowdrey HS 1994 Effects of chronic inflammatory stress on levels of pro-opiomelanocortin-derived peptides in the rat spleen and thymus. J Neuroendocrinol 49:197–203
  20. Itoh T, Kasahara S 1987 Development of Thy 1 positive rat thymocytes: analysis of fetal and neonatal thymocytes by flow microfluorometry. Thymus 9:13–23[Medline]
  21. Adkins B 1991 Developmental regulation of the intrathymic T cell precursor population. J Immunol 5:1387–1393
  22. Hsiao L, Takahashi K, Takeya M, Arao T 1991 Differentiation and maturation of macrophages into interdigitating cells and their multicellular complex formation in the fetal and postnatal rat thymus. Thymus 17:219–235[Medline]
  23. Ward IL, Weisz J 1984 Differential effects of maternal stress on circulating levels of corticosterone, progesterone, and testosterone in male and female rat fetuses and their mothers. Endocrinology 114:1635–1644[Abstract/Free Full Text]
  24. Redei E, Li L, Halasz I, McGivern RF, Aird F 1994 Fast glucocorticoid feedback inhibition of ACTH secretion in the ovariectomized rat: effect of chronic estrogen and progesterone. Neuroendocrinology 60:113–123[CrossRef][Medline]
  25. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama S 1986 Nucleotide sequence of a full-length cDNA for mouse cytoskeletal beta-actin mRNA. Nucleic Acids Res 14:2829[Free Full Text]
  26. Curran T, MacConnell WP, van Straaten F, Verma IM 1983 Structure of the FBJ murine osteosarcoma virus genome: molecular cloning of its associated helper virus and the cellular homologue of the v-fos gene from mouse and human cells. Mol Cell Biol 3:914–921[Abstract/Free Full Text]
  27. Crofford LJ, Sano H, Karalis K, Webster EL, Goldmuntz EA, Chrousos GP, Wilder RL 1992 Local secretion of corticotropin-releasing hormone in the joints of Lewis rats with inflammatory arthritis. J Clin Invest 90:2555–2564
  28. Todd-Turla KM, Schnermann J, Fejes-Toth G, Naray-Fejes-Toth A, Smart A, Killen PD, Briggs JP 1993 Distribution of mineralcorticoid and glucocorticoid receptor mRNA along the nephron. Am J Physiol 264:F781–F791
  29. Rappolee DA 1990 Optimizing the sensitivity of RT-PCR. Amplification 4:5–7
  30. McGivern RF, Raum WJ, Salido E, Redei E 1988 Lack of prenatal testosterone surge in fetal rats exposed to alcohol: alterations in testicular morphology and physiology. Alcohol Clin Exp Res 12:243–247[CrossRef][Medline]
  31. Dupouy JP, Coffigny H, Magre S 1975 Maternal and foetal corticosterone levels during late pregnancy in rats. J Endocrinol 65:347–352[Abstract/Free Full Text]
  32. Ohkawa T, Takeshita S, Murase T, Kambegawa A, Okinaga S, Arai K 1991 Ontogeny of the response of the hypothalamo-pituitary-adrenal axis to maternal immobilization stress in rats. Endocrinol Jap 38:187–194[Medline]
  33. Montano MM, Wang M-H, vom Saal FS 1993 Sex differences in plasma corticosterone in mouse fetuses are mediated by differential placental transport from the mother and eliminated by maternal adrenalectomy or stress. J Reprod Fertil 93:283–290
  34. Chatelain A, Dupouy JP, Allaume P 1980 Fetal-maternal adrenocorticotropin and corticosterone relationships in the rat: effect of maternal adrenalectomy. Endocrinology 106:1297–1303[Medline]
  35. Burton J, Waddell BJ 1994 ß-Hydroxysteroid dehydrogenase in the rat placenta: developmental changes and the effects of altered glucocorticoid exposure. J Endocrinol 143:505–513[Abstract/Free Full Text]
  36. Krupenko SA, Kolesnik OI, Krupenko NI, Strelchyonok OA 1995 Organization of the transcortin-binding domain on placental plasma membranes. Biochim Biophys Acta 123:387–394
  37. Smith CL, Hammond GL 1991 Ontogeny of corticosteroid-binding globulin biosynthesis in the rat. Endocrinology 128:983–988[Abstract/Free Full Text]
  38. Boudouresque F, Guillaume V, Grino M, Strbak V, Chautard T, Conte-Devolx B, Oliver C 1988 Maturation of the pituitary-adrenal function in rat fetuses. Neuroendocrinology 48:417–422[Medline]
  39. Hiramatsu R and Nisula BC 1989 Effect of alcohol on the interaction of cortisol with plasma proteins, glucocorticoid receptors and erythrocytes. J Steroid Biochem 33:65–70[CrossRef][Medline]
  40. McCormick CM, Smythe JW, Sharma S, Meaney MJ 1995 Sex-specific effects of prenatal stress on hypothalamic-pituitary-adrenal responses to stress and brain glucocorticoid receptor density in adult rats. Dev Brain Res 84:55–61[Medline]
  41. Duval D, Dardenne M, Homo F 1979 Glucocorticoid receptors in thymocytes of fetus, newborn, and adult CBA mice. Endocrinology 104:1152–1157[Abstract/Free Full Text]
  42. Leposavic G, Micic M 1992 Testosterone binding sites in the rat thymus during late embryonal and postnatal period. Thymus 20:77–88[Medline]
  43. Vamvakopoulos NC, Chrousos GP 1994 Hormonal regulation of human corticotropin-releasing hormone gene expression: implications for the stress response and immune/inflammatory reaction. Endocr Rev 15:409–420[Abstract/Free Full Text]
  44. Lundblad JR, Roberts JL 1988 Regulation of proopiomelanocortin gene expression in pituitary. Endocr Rev 9:135–58[Abstract/Free Full Text]
  45. Smith EM, Morrill AC, Meyer WJ, Blalock JE 1986 Corticotropin releasing factor induction of leukocyte-derived immunoreactive ACTH and endorphins. Nature 321:881–882[CrossRef][Medline]
  46. Oates EL, Allaway GP, Prabhakar BS 1990 A potential for mutual regulation of proopiomelanocortin gene and Epstein-Barr virus expression in human lymphocytes. Ann NY Acad Sci 594:60–65[CrossRef][Medline]
  47. Inomata T, Iwaki T, Murakata S, Ninomiya H, Nakamura T 1985 Evidence for no influence of fetal and maternal adrenalectomy on the development of the fetal thymus in the rat. Jpn J Vet Sci 47:665–668
  48. Eishi Y, Hirikawa K, Hatakeyama S 1983 Long-lasting impairment of immune and endocrine systems of offspring induced by injection of dexamethasone. Clin Immunol Immunopathol 26:335–349[CrossRef][Medline]
  49. Bakker JM, Schmidt ED, Kroes H, Kavelaar A, Heijen CJ, Tilders FJH, van Rees P 1995 Effect of short-term dexamethasone treatment during pregnancy on the development of the immune system and hypothalamo-pituitary-adrenal axis in the rat. J Neuroimmunol 63:183–191[CrossRef][Medline]
  50. Sasson S, Mayer M 1981 Antiglucocorticoid activity of androgens in rat thymus lymphocytes. Endocrinology 108:760–766[Abstract/Free Full Text]
  51. Kumar N, Shan L-X, Hardy MP, Bardin CW 1995 Mechanism of androgen-induced thymolysis in rats. Endocrinology 136:4887–4893[Abstract]
  52. Olsen NJ, Watson MB, Hendreson GS, Kovacs WJ 1991 Androgen deprivation induces phenotypic and functional changes in the thymus of adult male mice. Endocrinology 129:2471–2476[Abstract/Free Full Text]
  53. Kavelaars A, Berkenbosch F, Croiset G, Ballieux RE, Heijnen CJ 1990 Induction of beta-endorphin secretion by lymphocytes after subcutaneous administration of corticortropin-releasing factor. Endocrinology 126:759–764[Abstract/Free Full Text]
  54. Olsen NJ, Nicholson WE, DeBold CR, Orth D 1992 Lymphocyte-derived adrenocorticotropin is insufficient to stimulate adrenal steroidogenesis in hypophysectomized rats. Endocrinology 130:2113–2119[Abstract/Free Full Text]
  55. Galin FS, LeBoeuf RD, Blalock JE 1991 Corticotropin-releasing factor upregulates expression of two truncated pro-opiomelanocortin transcripts in murine lymphocytes. J Neuroimmunol 31:51–58[CrossRef][Medline]
  56. Revskoy S, Frey C, Gupta D 1992 Exons of proopiomelanocortin gene in the rat lymphoid tissues are differentially expressed during early ontogenesis. 8th International Congress of Immunology, Budapest, p 24 (Abstract)
  57. Jessop DS, Renshow D, Lightman SL, Harbuz MS 1995 Changes in ACTH and ß-endorphin immunoreactivity in immune tissues during a chronic inflammatory stress are not correlated with changes in corticotropin-releasing hormone and arginine vasopressin. J Neuroimmnol 60:29–35[CrossRef][Medline]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
X. Zhang, J. H. Sliwowska, and J. Weinberg
Prenatal Alcohol Exposure and Fetal Programming: Effects on Neuroendocrine and Immune Function
Experimental Biology and Medicine, June 1, 2005; 230(6): 376 - 388.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. S. Wilcoxon, J. Schwartz, F. Aird, and E. E. Redei
Sexually dimorphic effects of maternal alcohol intake and adrenalectomy on left ventricular hypertrophy in rat offspring
Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E31 - E39.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Sinha, I. Halasz, J. F. Choi, R. F. McGivern, and E. Redei
Maternal Adrenalectomy Eliminates a Surge of Plasma Dehydroepiandrosterone in the Mother and Attenuates the Prenatal Testosterone Surge in the Male Fetus
Endocrinology, November 1, 1997; 138(11): 4792 - 4797.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Revskoy, S.
Right arrow Articles by Redei, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Revskoy, S.
Right arrow Articles by Redei, E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ETHANOL
*TESTOSTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals