Endocrinology Vol. 138, No. 1 389-396
Copyright © 1997 by The Endocrine Society
Corticotropin-Releasing Hormone and Proopiomelanocortin Gene Expression Is Altered Selectively in the Male Rat Fetal Thymus by Maternal Alcohol Consumption1
Sergei Revskoy,
Ildiko Halasz and
Eva Redei
Neuroendocrine Research Laboratory, Departments of Psychiatry
(S.R., I.H., E.R.) and Pharmacology (E.R.), University of Pennsylvania,
Philadelphia, Pennsylvania 19104
Address all correspondence and requests for reprints to: Sergei Revskoy, M.D., Ph.D., The Asher Center, Department of Psychiatry, Northwestern University Medical School, Ward Building 9233, 303 East Chicago Avenue, Chicago, Illinois 60611-3008. E-mail:
s-revskoy{at}nwu.edu
 |
Abstract
|
|---|
The present study was carried out to investigate how hormonal changes
caused by chronic alcohol exposure of rats during the late period of
gestation are coordinated with neuroendocrine functions of the fetal
thymus, namely thymic expression of CRH and POMC genes. Alcohol
consumption by pregnant dams led to a 5-fold elevation of plasma
corticosterone (CORT) levels and significantly decreased fetal CORT
levels. This generally inverse correlation between maternal and fetal
CORT was absent in alcohol-consuming dams and their male fetuses on day
19 of gestation. These day 19 fetuses also had an attenuated plasma
testosterone surge that occurred in the male control (pair-fed) fetus
on day 19 of embryonic life. Furthermore, fetal alcohol exposure (FAE)
resulted in a significant increase in thymic CRH and a decrease in
thymic POMC expression in the male fetuses only, specifically on
embryonic day 19. Thus, the strong positive correlation between CRH and
POMC gene expression in the thymus of pair-fed male and female FAE
fetuses was abolished in the FAE males. However, regardless of
embryonic age or treatment, a strong positive correlation between
thymic POMC gene expression and plasma testosterone levels in the male
fetuses was detected. These data suggest that the sexually dimorphic
effect of FAE on the fetal thymic POMC and CRH expression in males is
driven by testosterone and may be related, therefore, to the presence
of alcohol at the time of the prenatal testosterone surge in the male
fetuses.
 |
Introduction
|
|---|
PRENATAL ALCOHOL exposure results in
multiple disturbances of the endocrine system of offspring, ranging
from altered neuroendocrine response to stress to male hypogonadism in
laboratory animals (1, 2). These hormonal changes are usually
considered as having a significant impact on immune system development
and function (3, 4). Indeed, exposure to alcohol during early fetal
development is also associated with immune deficits in the offspring
that may lead to increased vulnerability to infectious diseases or
cancer. In particular, Johnson et al. (5) reported severe
immunodeficiencies in both T and B cells in children with fetal alcohol
syndrome compared to age-matched controls. Amman et al. (6)
described four patients with DiGeorge syndrome, which is accompanied by
a congenital absence of the thymus, whose mothers had a history of
alcoholism. Experimental data reveal a link between in utero
alcohol exposure and significant reduction of thymic size together with
impaired immune surveillance (7, 8). These observations suggest an
altered process of thymic development in fetuses exposed to alcohol
in utero, leading to immune suppression in the offspring.
However, whether these alterations in immune development are mediated
through changes in the neuroendocrine system in response to alcohol
exposure in utero remains unclear.
Fetal alcohol exposure (FAE) leads to marked, long term suppression of
T cell-dependent functions, such as splenocyte proliferation in
response to mitogens (9, 10). These latter effects are observed
primarily in the male offspring and are abolished by maternal
adrenalectomy (9, 10). This suggests that during fetal development,
alcohol-induced changes in the mothers adrenal function produce a
permanent effect on the developing immune system of the male fetuses.
The change(s) in the maternal adrenal function responsible for the
immunosuppressive effect of alcohol on the male offspring is not known.
A role for maternal corticosterone (CORT) in altering the thymic
development of the FAE fetus is suggested by the finding that maternal
administration of ACTH and glucocorticoids results in decreased fetal
thymic weight (11), similar to that which occurs in FAE (6, 7, 9, 12).
Indeed, basal plasma CORT levels were shown to be increased in
ethanol-consuming pregnant rats throughout gestation (13). As unbound
CORT can cross the placenta, elevated maternal CORT levels may affect
fetal immune development directly through altering thymocyte
differentiation and proliferation. Alternatively, maternal CORT may
influence the development of neuroendocrine functions of the fetal
hypothalamic-pituitary-adrenal axis or the fetal thymus, leading to
altered thymic development.
The presence of both thymic CRH (14, 15) and POMC transcripts (16) has
been recently identified in rats. The CRH-POMC system in the thymus
seems to be a functional part of the thymic microenvironment, as CRH
and POMC-derived peptides, namely ACTH, ß-endorphin, and
MSH, have
been shown to be potent immunomodulators (4). Thus, changes in their
local thymic levels in response to prenatal alcohol exposure,
controlled by expression of the corresponding genes, might contribute
to shifts in the development of the fetal immune system. Previous
studies have also demonstrated that the expression of CRH in the mature
thymus is under negative glucocorticoid regulation, similar to
hypothalamic CRH (17), whereas the suppressive effect of
glucocorticoids on POMC expression in thymus is much less evident (18, 19). Thus, analysis of the FAE-induced changes in fetal thymic CRH and
POMC expression may provide specific information on the response of the
developing thymus to FAE and help to elucidate a mechanism mediating
the effect of FAE on T cell function.
The period before parturition is considered to be critical in
lymphocyte maturation in rodents, because adult-like precursor cells
(20, 21) as well as mature accessory cells (22) populate the thymus by
embryonic days 1920 (E19-20). This same developmental period is also
critical for sexual differentiation, as the prenatal testosterone surge
occurs on E18-19 in the male fetus (23). Therefore, neuroendocrine
disturbances in the thymic microenvironment during this critical period
may alter the development of thymocytes, resulting in T cell
dysfunction in the adult organism.
In the present study we have investigated the changes in expression of
the steroid-regulated genes CRH and POMC in the male and female fetal
thymus caused by maternal alcohol consumption. We have also
investigated whether these changes correlate with the alcohol-induced
changes in maternal and fetal plasma CORT and fetal plasma testosterone
(T) levels. The determination of the relationship between these
hormonal and thymic neuroendocrine parameters is the focus of the
present study.
 |
Materials and Methods
|
|---|
Animals and diet
Female Sprague-Dawley rats (Charles River Breeding Laboratories,
Wilmington, MA), 200250 g, were maintained on standard laboratory
chow and water ad libitum, with a 12-h light, 12-h dark
cycle. After overnight mating, the presence of sperm in the vaginal
smear was used to designate the first day of gestation (or E1). On day
7, pregnant rats were placed on a liquid alcohol diet (Bioserv, Inc.,
Frenchtown, NJ) or on an isocaloric diet without alcohol, equal in
volume to that consumed by the alcohol group. The ethanol diet
contained 5% (wt/vol) ethanol and provided 35% ethanol-derived
calories; maltose-dextrin was isocalorically substituted for ethanol in
the liquid control diet. Dams were maintained on alcohol or the
pair-fed (PF) diet throughout the experiment. Dams were killed by
decapitation between 10001200 h, the fetuses were removed from the
uterine horn, and the fetal sex was determined using measurement of
anogenital distance. Maternal and fetal blood samples were collected
into heparinized tubes and capillaries, respectively. All tissues were
immediately frozen on dry ice and stored at -80 C until extraction.
Thymus specimens were obtained from rat fetuses on E19 and E21 and
individually analyzed.
RIAs
CORT concentrations were measured as described previously in
unextracted plasma, using an [125I]CORT RIA (24). Assay
sensitivity was 0.01 ng/ml; the intraassay coefficient of variation was
8.5%.
T was determined in 25 µl unextracted plasma using the Coated-Tube
125I RIA Kit (ICN, Costa Mesa, CA). The assay sensitivity
was 0.06 ng/ml; the intraassay coefficient of variation was 8.2%.
Plasma ACTH levels were measured as described previously (24). Briefly,
ACTH levels were measured in 1050 µl unextracted plasma with
antiserum (Incstar, Stillwater, MN), which binds 3035% of
[125I]ACTH-(139) at equilibrium. The assay sensitivity
was 6 pg/ml (0.5 pg/tube), with an intraassay coefficient of variation
of 6.25%. Plasma hormone concentrations were measured in a single
assay.
RNA extraction and Northern analysis
Extraction of total RNA was performed using Trizol reagent,
according to the manufacturers protocol (Life Technologies, Grand
Island, NY). Total RNA concentrations were measured on Beckman
spectrophotometer at 260 nm (Palo Alto, CA), and each sample was
adjusted to the final concentration of 1 µg/µl. The quantity and
quality of RNA were confirmed by gel electrophoresis.
Ten to 20 µg RNA from individual samples in each group were run on
1% agarose-formaldehyde gels. The RNA was blotted onto nitrocellulose
filters in 20 x SSC (saline sodium citrate) for approximately
18 h and fixed to the filter by UV cross-linking. Labeling and
hybridization were performed as described previously (10). Filters were
hybridized with 32P complementary DNA (cDNA) probes for
ß-actin and c-fos. The ß-actin probe was a 700-bp insert
from a plasmid containing a mouse ß-actin cDNA (25). The
c-fos probe was the human c-fos gene (26).
Densitometry was carried out using an Image Analyzer and
Macintosh-based Brain 2.1 system (Drexel University, Philadelphia, PA)
with gray scale calibration.
Molecular probes and synthetic oligonucleotides
Primers for rat POMC (16), CRH (27), glucocorticoid receptor
(GR) (28), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH);
Clontech, Palo Alto, CA) messenger RNAs (mRNAs) were designed as
described previously. The sequences of the synthesized oligomers and
their relationship to the organization of POMC, CRH, GR, and GAPDH
genes are: POMC55, (5') EX2 GGACCTCACCACGGAAAGCAACCTG (bp
11431167); POMC50, (5') EX3 TGCTCCGGTTGCAAGAAATTC (bp
13221342); POMC37, (3') EX3 AGCGGAAGTGCTCCATGGAGTGAGTAGGA
(bp 14611485); CRH51, (5') EX1 CTCAGAGCCCAAGTACGTTGA (bp
342362); CRH50, (5') EX2 GAGGTACCTCGCAGAACAAC (bp
446465); CRH31, (3') EX2 TGCTCCGGTTGCAAGAAATTC (bp
13411321); GAPDH, (5') EX1 TGAAGGTCGGTGCAACGGATTTGGC (bp 3560);
GAPDH, (3') EX9 CATGTAGGCCATGAGGTCCACCAC (bp 994-1017); GR, (5')
GGGAATTCAATACTCATGGTC (bp 18381857); and GR, (3')
GGGAATTCAATACTCATGGTC (bp 23512371).
Oligo(dt)15 was used for the synthesis of cDNAs by reverse
transcription (RT) using a modification of the technique described by
Rappolee et al. (29). Briefly, 1 µg total cellular RNA was
reverse transcribed, using 400 U Moloney leukemia virus reverse
transcriptase (Life Technologies, Gaithersburg, MD) in 20 µl of a
mixture containing 50 mM Tris-HCl, pH 8.2; 10
mM, dithiothreitol; 75 mM KCl; 10 U
ribonuclease inhibitor (Promega, Madison, WI); and 0.2 mM
each of ATP, GTP, CTP, and TTP (Pharmacia, Piscataway, NJ). RT was
performed at 42 C for 1 h, followed by 5 min at 95 C. PCR was
performed on the one tenth of the total cDNA in 50 µl 10
mM Tris-HCl, pH 8.3; 50 mM KCl; 2.2
mM MgCl; 0.01% (wt/vol) gelatin; 20 pmol of 5'- and
3'-primers of both target (POMC, CRH, or GR) and reference (GAPDH)
genes; and 2 U Taq DNA polymerase (Promega). The temperature
profile of each cycle consisted of 30 sec at 95 C for denaturation, 1
min at 5666 C for annealing, and 2 min at 72 C for elongation.
Thirty-three cycles were used for amplification, with the 33rd cycle
elongation time prolonged to 7 min to allow extension of incomplete DNA
fragments. Control samples without RNA and without reverse
transcriptase were included in each set of studied samples. One tenth
of the PCR reaction mixture was loaded onto a 2% agarose LE (Fisher,
Fairlawn, NJ) gel, run in Tris-acetate-EDTA buffer, and stained with
ethidium bromide.
RT-PCR products obtained by amplification of either RNA isolated from
the rat pituitary (using POMC37 and POMC50
primers, resulting in a 178-bp fragment) or RNA isolated from the rat
hypothalamus (using CRH31 and CRH50 primers,
resulting in a 192-bp fragment) were used as POMC or CRH probes,
respectively. GAPDH cDNA was used as a specific GAPDH
probe. After alkaline capillary transfer of the Southern gels to a
membrane Hybond-N (Amersham Corp., Arlington Heights, IL), the PCR
products were hybridized using POMC, CRH, or GR probes labeled with
[32P]CTP (Boehringer Mannheim, Indianapolis, IN). The
blots were developed after 515 min at room temperature for GAPDH,
1560 min at -80 C for POMC, 4 h at -80 C for GR, and 1224 h
at -80 C for CRH probes. The relative abundance of the POMC/CRH/GR
fragments compared to GAPDH-derived ones was determined by
densitometric scanning of the Kodak XAR-5 film (Eastman Kodak,
Rochester, NY) for the corresponding PCR-derived fragments using an
Image Analyzer and Macintosh-based Brain 2.1 system with gray scale
calibration. The level of POMC/CRH/GR gene expression was represented
as a ratio of the absorbance of POMC/CRH/GR-derived bands to the
absorbance of GAPDH.
Statistical analysis
Data were analyzed using a three-way (treatment, time, and sex)
ANOVA. Post-hoc comparisons were made using t
tests. For all statistical tests, P < 0.05 (corrected
for multiple comparisons) was considered statistically significant.
Data were also analyzed using the Pearce coefficient of correlation.
The software package was Systat for Windows (SYSTAT Inc., Evanston,
IL).
 |
Results
|
|---|
Plasma CORT and T levels
In FAE dams, plasma CORT levels increased almost 5-fold on day 19
of gestation (G19) compared to PF controls and remained equally high on
G21 [F(1, 13) = 14.77; P = 0.002; Fig. 1a
]. However, no significant differences in plasma ACTH
levels in pregnant rats were detected at any time (data not shown). In
contrast to maternal CORT, fetal CORT levels were significantly lower
on E21 than on E19 in both male and female fetuses (F = 22.73;
P < 0.001; Fig. 1b
). Furthermore, fetal CORT levels
were significantly lower in alcohol-exposed fetuses regardless of
gender and embryonic age (F = 37.77; P < 0.001;
Fig. 1b
). Interestingly, the correlation between maternal and fetal
plasma CORT was negative and highly significant (r = -0.5;
P = 0.003; Fig. 1c
). When this correlation was further
analyzed according to time of gestation and gender, it became clear
that the correlation between maternal and fetal CORT was inverse and
highly significant in each case, with the exception of male FAE fetuses
on E19, in which the correlation was actually positive, although not
significant (r = 0.26; P = NS).

View larger version (13K):
[in this window]
[in a new window]
|
Figure 1. a, The influence of chronic alcohol consumption on
plasma CORT concentrations in pregnant rats during the late period of
gestation (PF, pair-fed dams; FAE, alcohol-consuming dams). Blood was
collected at 1000 h. Values are the mean ± SEM
of four to five animals per group. *, P < 0.05 PF
vs. FAE. b, The influence of FAE on plasma CORT
concentrations in male and female fetuses (PF, fetuses of pair-fed
dams; FAE, fetuses of alcohol-consuming dams). Plasma CORT
was measured in individual fetuses. CORT levels were then
averaged within the litter by sex and analyzed statistically by litter
(n = 45/group). *, P < 0.05 PF
vs. FAE. c, Inverse correlation between maternal and
fetal plasma CORT levels. Mean CORT values of littermates, separated by
sex, were correlated with CORT values of the corresponding dams. ,
CORT levels of FAE male litters obtained on E19. , CORT levels of
all other groups. The correlation coefficient includes all groups of
animals.
|
|
In agreement with previous findings (23), a surge of plasma T was
observed in PF male fetuses on E19 (Fig. 2
). This T
surge was dramatically and significantly attenuated in FAE male fetuses
(F = 8.4; P = 0.005). T levels decreased by E21 in
both treatment groups and were no longer altered by FAE.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 2. The influence of FAE on plasma T concentration in
male and female fetuses. Fetal plasma was pooled within the litter by
sex and analyzed statistically by litter. *, P =
0.005, PF males on E19 vs. FAE males on E19.
|
|
Thymic POMC, CRH, c-fos, and GR expression
Both POMC and CRH gene transcripts could be detected by RT-PCR in
the fetal thymus. In general, POMC expression was more than 2 orders of
magnitude higher than CRH gene expression in the fetal thymus, which
was reflected in the much shorter exposure time for the POMC Southern
blots compared to the CRH blots. The oligonucleotide primers for POMC
were designed so that the upstream primer was located in the 5'-end of
the second exon, and the downstream primer was located in the third
exon. Therefore, the RT-PCR assay could detect the expression of both
translated exons of the POMC gene, including the portion of the second
exon coding for the signal and N-terminal peptides. CRH primers were
located within the first and second exons and detected both the
untranslated and translated regions of CRH mRNA. The sizes of these
POMC and CRH PCR products (290 and 311 bp, respectively) were the
same as that of the products found in the anterior pituitary and
hypothalamus, respectively.
Figure 3a
shows a representative Southern blot
indicating the 290-bp POMC PCR product in the fetal thymus. POMC
expression decreased from E19 to E21, especially in the PF group (Fig. 3b
). There was a sex difference in the expression of POMC on E19, when
POMC mRNA levels were significantly higher in the male PF thymi
compared to those in females. This elevation in POMC on E19 in the male
thymi was abolished by alcohol exposure in utero just as the
prenatal surge of T was attenuated in FAE males. Accordingly, thymic
POMC expression and plasma T levels were correlated highly, positively,
and significantly (r = 0.972; P = 0.002) in male
fetuses (Fig. 3c
). However, there was no significant correlation
between thymic POMC expression and either maternal or fetal plasma CORT
levels (r = -0.18; P = NS and r = 0.24;
P = NS, respectively).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3. a, Representative Southern blot analysis of
POMC-specific RT-PCR products derived from 1 µg thymic total RNA. The
POMC-specific PCR 290-bp product and the GAPDH-specific RT-PCR 980-bp
fragment are marked. The filter was probed first with 157-bp
internal POMC RT-PCR fragment of the intact rat pituitary gland and
then with the mouse GAPDH cDNA. b, The effect of alcohol exposure
in utero on fetal thymic POMC mRNA detected by RT-PCR.
One or two individual male and female fetal thymi were extracted for
total RNA from each litter. Values represent the mean ±
SEM (n = 56/group) ratio of optical density of the
POMC signal normalized to GAPDH signal obtained from the same
reaction tube. **, P < 0.001. c, Correlation
between relative levels of thymic POMC mRNA measured by RT-PCR in
individual male fetuses and their plasma T concentrations.
|
|
Thymic CRH was also measured by RT-PCR, and a representative Southern
blot indicating the 311-bp CRH PCR product is shown in Fig. 4a
. The developmental profile of CRH expression was
similar to that of POMC, decreasing from E19 to E21 in both males and
females (Fig. 4b
). However, in contrast to POMC, thymic CRH expression
was significantly (P = 0.009) increased in male FAE
fetuses only, specifically at the time of the T surge (E19). There was
no effect of FAE on female fetal thymic CRH expression at these time
points during embryonic development. Unexpectedly, the linear
correlation between CRH and POMC only tended to be significant (r
= 0.3166; P = 0.057). However, when the data were
further scrutinized, the correlation between CRH and POMC became highly
significant (r = 0.592; P = 0.002) after removing
the male FAE fetuses on E19 (Fig. 4c
), further emphasizing the
alcohol-induced changes that occur on E19 in the male FAE fetus. There
was no significant correlation between CRH expression and any of the
hormonal parameters measured (data not shown).
The expression of c-fos gene in fetal thymi was determined
by Northern blotting. Levels of c-fos mRNA decreased
significantly from E19 to E21 [F(1, 32) = 12.28; P =
0.001; Fig. 5
). FAE induced marked increases in
c-fos mRNA levels on E19 only (time and treatment
interaction: F = 4.96; P = 0.03). A significant
positive correlation was found between c-fos and CRH gene
expression in fetal thymi (r = 0.4317; P =
0.022).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 5. Effect of alcohol exposure in utero
on fetal thymic c-fos mRNA levels determined by Northern
blot analysis in individual thymi. One or two male and female thymi
were extracted for total RNA from each litter. Values represent the
mean ± SEM (56/group) ratio of optical densities of
the c-fos signal normalized to the ß-actin signal.
|
|
The relative expression of GR in fetal thymus was also measured by
RT-PCR. GR expression was the highest in the thymus of PF male fetuses,
specifically on E19, whereas GR expression was much lower in FAE male
fetuses on the same day (Fig. 6
). However, because of
the low number of observations, these differences were not
significant.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 6. Effect of FAE on thymic GR mRNA. Total RNA from
litter-representative male and female thymi were analyzed by RT-PCR
followed by Southern blotting. The optical density of GR-specific PCR
product was normalized to that of GAPDH-specific PCR product.
|
|
 |
Discussion
|
|---|
We have previously reported (10) that FAE leads to suppressed T
cell function in the male rat offspring, and that maternal
adrenalectomy abolishes this suppression. Thus, maternal adrenal
function may mediate, directly or indirectly, the effect of FAE on T
cell development in the thymus. The direct effects would involve
maternal adrenal steroids that cross the placenta and act on the
developing thymus either directly or by altering fetal
pituitary-adrenal function. Alternatively, as the thymus also expresses
neuroendocrine-like hormones such as CRH and POMC, which are known to
be regulated by these steroid hormones, indirect regulation of thymic
development could occur through altering the expression of these
neuropeptides.
In the present study, we characterized the changes in maternal and
fetal CORT and fetal T levels in response to alcohol exposure in
utero. We also investigated whether these hormonal changes
correlate with the FAE-induced alterations in expression of the
steroid-regulated genes CRH and POMC in the fetal thymus.
Elevated maternal plasma CORT levels were observed in alcohol-consuming
dams, a finding similar to that reported previously (13). We also
confirm and extend our previous finding that FAE suppresses the
prenatal T surge observed in male fetuses on E19 (30). However, this
study is the first to show that maternal CORT levels are inversely
correlated with fetal plasma CORT levels, and that this correlation is
disturbed in male FAE fetuses on E19. Our results suggest that this
disturbance involves the concomitant presence of alcohol and decreased
fetal T levels.
It has been previously suggested that CORT levels in fetal and maternal
plasma undergo parallel changes throughout gestation (31) and respond
to acute stress in a similar fashion (32, 33). In addition, fetal CORT
is able to substitute for the lack of maternal CORT in adrenalectomized
dams (34). Therefore, fetal CORT can be shared by the maternal
circulation, and conversely, maternal CORT can regulate fetal
pituitary-adrenal function if the placenta is relatively permeable to
CORT in both directions. However, maternal as well as fetal CORT are
substantially metabolized in the placenta by 11ß-hydroxysteroid
dehydrogenase. The expression of this enzyme and the resulting
inactivation of CORT increases with progressing pregnancy (35),
limiting the mutual CORT exchange between maternal and fetal plasma,
particularly toward the end of gestation. In addition,
corticosteroid-binding globulin (CBG) production, which is also found
in the placenta (36), is maintained at relatively high levels in the
pregnant rat throughout gestation (37). Hence, the CBG-bound maternal
CORT cannot cross the placenta and cannot be responsible for the
increase in fetal plasma CORT on E19 observed in a number of studies
(32, 38). However, acutely increased maternal glucocorticoids could
remain partially unbound and cross the placenta; thus, increased
maternal CORT after alcohol exposure may affect fetal pituitary-adrenal
function before E19. In addition, as alcohol decreases glucocorticoid
binding to CBG and GR (39), CORT may cross the placenta more easily in
FAE animals.
Interestingly, the capacity to increase CBG production in response to
environmental challenge is sexually dimorphic, as it is only observed
in female fetuses (40). Therefore, female fetuses may be more protected
by CBG from the increased maternal CORT that occurs after alcohol
consumption in the dams. Whatever mechanism maintains the inverse
relationship between fetal and maternal CORT levels in late gestation,
the lack of such a correlation in FAE male fetuses suggests that this
mechanism is probably disrupted by maternal alcohol consumption.
If alcohol-induced changes in maternal and, subsequently, fetal CORT
levels are the direct cause of the long term suppression of T cell
function in the FAE offspring, this suppression would occur in both
male and female offspring, because fetal CORT levels are similar in
male and female FAE fetuses. As only the male FAE offspring seem to be
affected, then changes in CORT alone may not be sufficient to alter
thymic development. By E19 the rat fetal thymus has already acquired
glucocorticoid and sex hormone receptors (41, 42); therefore, hormonal
changes can alter the expression of steroid-responsive genes. Indeed, a
major finding of this study is the sexually dimorphic effect of FAE on
the expression of thymic CRH and POMC genes. Maternal alcohol
consumption had opposing effects on POMC and CRH gene expression in the
male fetal thymus on E19; POMC expression decreased, whereas CRH
expression increased. By contrast, FAE did not significantly affect
POMC or CRH gene expression in female fetal thymus or on E21 in male
fetal thymus (i.e. in the absence of elevated plasma T).
CORT and sex hormones act as major regulators of hypothalamic CRH and
anterior pituitary POMC gene expression (43, 44). Glucocorticoids also
suppress the expression of thymic CRH in the adult rat (17) and of POMC
in normal human lymphocytes (45). Therefore, fetal thymic expression of
CRH and POMC may also be regulated by these steroids. The regulation of
CRH and POMC in the fetal thymus and its relevance in FAE-induced
thymic changes remain unknown. POMC gene expression in transformed
lymphocytes, which resemble immature thymocytes, was resistant to
dexamethasone treatment (46). Furthermore, in contrast to FAE, other
manipulations of the maternal-fetal corticosteroid milieu, such as
maternal adrenalectomy or mild stress, do not change fetal thymus size
(47). These findings suggest that the fetal thymus is relatively
resistant to moderate fluctuations of fetal plasma corticosteroids, and
therefore, glucocorticoids alone may not be sufficient to cause the
effects of FAE on the fetal thymus. In fact, the present study suggests
that the impact of both maternal and fetal CORT on the modulation of
CRH and POMC gene expression in the fetal thymus appears insignificant.
However, exposure to much higher doses of glucocorticoids during the
prenatal period of development have been shown to cause substantial
changes in T cell populations in rat thymus (48, 49). The lack of
correlation between fetal thymic CRH or POMC gene expression and
maternal or fetal plasma CORT levels suggests that CORT does not
directly affect CRH and POMC gene expression in the fetal thymus, and
therefore, the regulation of CRH and POMC expression in the fetal
thymus is not identical to that in neuroendocrine tissues or even to
that in the adult thymus.
In contrast to the lack of correlation between thymic CRH or POMC and
maternal or fetal CORT, a close positive correlation between plasma
levels of T and thymic POMC expression was observed in the male fetus.
The physiological significance of this correlation may be related to
the antiglucocorticoid activity of T on thymocytes (50). Androgen
receptors have been found in adult rat thymus (51), and it is well
established that T binds in various cellular compartments of the fetal
thymus (42). In the mature thymus, the administration of dexamethasone
results in an increase in the proportion of androgen receptor despite
thymolysis, suggesting that androgen receptors are confined to the
subpopulation of thymocytes resistant to glucocorticoids (51).
Furthermore, it has been shown that the proportion of thymocytes in
rodents treated with T shifts toward a greater proportion of mature
CD4+ cells and a lower proportion of immature
(CD8+CD4+) thymocytes (52). Therefore, in
contrast to the commonly found thymolytic effect of T in the adults, it
seems that a protective or even facilitating effect of T on thymocyte
development may occur during certain periods of development.
The effect of CRH as well as POMC-derived peptides on the function of
lymphoid cells has been demonstrated by a number of studies (4, 43).
Although the presence of CRH peptide in rat lymphoid tissues seem to be
well established (14), the production of POMC-derived peptides by the
immune organs is widely disputed (53, 54). Moreover, the major form of
POMC mRNA in the mature thymus was truncated, lacking the sequence
encoding the signal peptide (55). In the present study, however, the
presence of a full-length POMC transcript in the fetal thymus suggests
that pituitary-like processing and secretion of POMC-derived peptides
may occur there, as we have previously suggested (56). Moreover, our
observation of a significant positive correlation between
c-fos and CRH, and CRH and POMC gene expression in the
thymus of control animals suggests that the mechanisms regulating
transcription of these genes in the thymus retain some similarity to
the neuroendocrine system.
Maternal alcohol consumption disrupts the physiological relationships
between CRH and POMC expression in the thymus, as demonstrated by the
loss of correlation between CRH and POMC gene expression in the male
FAE thymus on E19. This phenomenon shows that alcohol at the time of
the prenatal T surge causes a differential response of CRH or POMC gene
expression. Recently, a similar dissociation between CRH and
POMC-derived peptide levels in immune tissues was described in rats
during chronic inflammatory stress (57).
In summary, the current findings of profound changes in many thymic
neuroendocrine indexes in the male FAE fetus at the time of the T surge
together with the previous findings of long term effects of alcohol
exposure in utero on the T cell function of male offspring
(10) support the hypothesis that alcohol interferes with certain
critical androgen-dependent steps in lymphoid development. During the
late period of gestation, the main developmental events in the thymus
involve populations of T cell precursors, T cell receptor
rearrangement, and formation of the T cell repertoire. Should maternal
adrenalectomy, which reverses some T cell dysfunctions of FAE male
offspring, reverse the effect of FAE on the fetal thymic parameters
analyzed in this study, it would provide an important step in further
understanding the role and significance of neuroendocrine factors in
thymic development.
 |
Acknowledgments
|
|---|
The authors are grateful to Drs. P. A. Rittenhause and F. Aird
for critically reviewing the manuscript.
 |
Footnotes
|
|---|
1 Presented at the Annual Meeting of the Society for Neuroscience, San
Diego, CA, November 1116, 1995. This work was supported by NIH Grant
AA-07389. 
Received May 29, 1996.
 |
References
|
|---|
-
Weinberg J 1993 Neuroendocrine effects of
prenatal alcohol exposure. Ann NY Acad Sci 697:8696[Medline]
-
Udani M, Parker S, Gavaler J, Van Tie DH 1985 Effect of the in utero exposure to alcohol upon male rats.
Alcohol Clin Exp Res 9:355359[Medline]
-
Kincade PW, Medina KL, Smithson G 1994 Sex
hormones as negative regulators of lymphopoiesis. Immunol Rev 137:119134[CrossRef][Medline]
-
Bateman A, Singh A, Kral T, Solomon S 1989 The
immune-hypothalamic-pituitary-adrenal axis. Endocr Rev 10:92112[Abstract/Free Full Text]
-
Johnson S, Knight R, Marmier DJ, Steele RW 1981 Immune deficiency in fetal alcohol syndrome. Pediatr Res 15:908911[Medline]
-
Amman AJ, Wara EW, Conan MJ, Barrett DJ, Stiehm ER 1982 The DiGeorge syndrome and the fetal alcohol syndrome. Am J
Dis Child 136:906908[Abstract/Free Full Text]
-
Gottesfeld Z, Abel EL 1991 Maternal and paternal
alcohol use: effects on the immune system of the offspring. Life Sci 48:18[CrossRef][Medline]
-
Gottesfeld Z, Trippe K, Wargovich MJ, Berkowitz AS 1992 Fetal alcohol exposure and adult tumorigenesis. Alcohol 9:465471[CrossRef][Medline]
-
Weinberg J, Jerrels TR 1991 Suppression of immune
responsiveness: sex differences in prenatal ethanol effects. Alcohol
Clin Exp Res 15:525531[CrossRef][Medline]
-
Redei E, Halasz I, Li L-F, Prystowsky M, Aird F 1993 Maternal adrenalectomy alters the immune and endocrine functions
of fetal alcohol-exposed male offspring. Endocrinology 133:452460[Abstract/Free Full Text]
-
Angervall L, Lundin PM 1964 Corticosteroid action
on the fetal thymus and spleen. Endocrinology 74:986989
-
Redei E, Clark WR, McGivern RF 1989 Alcohol
exposure in utero results in diminished T-cell function and
alterations in brain corticotropin-releasing factor and ACTH content.
Alcohol Clin Exp Res 13:439443[CrossRef][Medline]
-
Weinberg J, Bezio S 1987 Alcohol-induced changes in
pituitary-adrenal activity during pregnancy. Alcohol Clin Exp Res 11:274280[CrossRef][Medline]
-
Redei E 1992 Immuno-reactive and bioactive
corticotropin-releasing factor in rat thymus. Neuroendocrinology 55:115118[CrossRef][Medline]
-
Aird F, Clevenger CV, Prystowsky MB, Redei E 1993 Corticotropin-releasing factor mRNA in rat thymus and spleen. Proc Natl
Acad Sci USA 90:71047106[Abstract/Free Full Text]
-
Revskoy S, Gupta D 1992 Ontogenetic studies of POMC
gene expression in the immune organs in rats. Neuroendocrinol Lett 14:6774
-
Aird F, Halasz I, Redei E Glucocorticoids inhibit
CRH expression in the rat thymus. 23rd Annual Meeting of the Society
for Neuroscience, Washington DC, 1993, p 507 (Abstract)
-
Batoeva GT, Chesnokov VN, Kozlov VA, Mertvetsov NP 1992 Absence of glucocorticoid inhibitory action on proopiomelanocortin
gene expression in the immune system organs. Immunologia 3:1315[CrossRef]
-
Jessop DS, Lightman SL, Chowdrey HS 1994 Effects of
chronic inflammatory stress on levels of pro-opiomelanocortin-derived
peptides in the rat spleen and thymus. J Neuroendocrinol 49:197203
-
Itoh T, Kasahara S 1987 Development of Thy 1
positive rat thymocytes: analysis of fetal and neonatal thymocytes by
flow microfluorometry. Thymus 9:1323[Medline]
-
Adkins B 1991 Developmental regulation of the
intrathymic T cell precursor population. J Immunol 5:13871393
-
Hsiao L, Takahashi K, Takeya M, Arao T 1991 Differentiation and maturation of macrophages into interdigitating
cells and their multicellular complex formation in the fetal and
postnatal rat thymus. Thymus 17:219235[Medline]
-
Ward IL, Weisz J 1984 Differential effects of
maternal stress on circulating levels of corticosterone, progesterone,
and testosterone in male and female rat fetuses and their mothers.
Endocrinology 114:16351644[Abstract/Free Full Text]
-
Redei E, Li L, Halasz I, McGivern RF, Aird F 1994 Fast glucocorticoid feedback inhibition of ACTH secretion in the
ovariectomized rat: effect of chronic estrogen and progesterone.
Neuroendocrinology 60:113123[CrossRef][Medline]
-
Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama
S 1986 Nucleotide sequence of a full-length cDNA for mouse
cytoskeletal beta-actin mRNA. Nucleic Acids Res 14:2829[Free Full Text]
-
Curran T, MacConnell WP, van Straaten F, Verma IM 1983 Structure of the FBJ murine osteosarcoma virus genome: molecular
cloning of its associated helper virus and the cellular homologue of
the v-fos gene from mouse and human cells. Mol Cell Biol 3:914921[Abstract/Free Full Text]
-
Crofford LJ, Sano H, Karalis K, Webster EL, Goldmuntz
EA, Chrousos GP, Wilder RL 1992 Local secretion of
corticotropin-releasing hormone in the joints of Lewis rats with
inflammatory arthritis. J Clin Invest 90:25552564
-
Todd-Turla KM, Schnermann J, Fejes-Toth G,
Naray-Fejes-Toth A, Smart A, Killen PD, Briggs JP 1993 Distribution of mineralcorticoid and glucocorticoid receptor mRNA along
the nephron. Am J Physiol 264:F781F791
-
Rappolee DA 1990 Optimizing the sensitivity of
RT-PCR. Amplification 4:57
-
McGivern RF, Raum WJ, Salido E, Redei E 1988 Lack
of prenatal testosterone surge in fetal rats exposed to alcohol:
alterations in testicular morphology and physiology. Alcohol Clin Exp
Res 12:243247[CrossRef][Medline]
-
Dupouy JP, Coffigny H, Magre S 1975 Maternal and
foetal corticosterone levels during late pregnancy in rats. J
Endocrinol 65:347352[Abstract/Free Full Text]
-
Ohkawa T, Takeshita S, Murase T, Kambegawa A, Okinaga S,
Arai K 1991 Ontogeny of the response of the
hypothalamo-pituitary-adrenal axis to maternal immobilization stress in
rats. Endocrinol Jap 38:187194[Medline]
-
Montano MM, Wang M-H, vom Saal FS 1993 Sex
differences in plasma corticosterone in mouse fetuses are mediated by
differential placental transport from the mother and eliminated by
maternal adrenalectomy or stress. J Reprod Fertil 93:283290
-
Chatelain A, Dupouy JP, Allaume P 1980 Fetal-maternal adrenocorticotropin and corticosterone relationships in
the rat: effect of maternal adrenalectomy. Endocrinology 106:12971303[Medline]
-
Burton J, Waddell BJ 1994 ß-Hydroxysteroid
dehydrogenase in the rat placenta: developmental changes and the
effects of altered glucocorticoid exposure. J Endocrinol 143:505513[Abstract/Free Full Text]
-
Krupenko SA, Kolesnik OI, Krupenko NI, Strelchyonok
OA 1995 Organization of the transcortin-binding domain on
placental plasma membranes. Biochim Biophys Acta 123:387394
-
Smith CL, Hammond GL 1991 Ontogeny of
corticosteroid-binding globulin biosynthesis in the rat. Endocrinology 128:983988[Abstract/Free Full Text]
-
Boudouresque F, Guillaume V, Grino M, Strbak V, Chautard
T, Conte-Devolx B, Oliver C 1988 Maturation of the
pituitary-adrenal function in rat fetuses. Neuroendocrinology 48:417422[Medline]
-
Hiramatsu R and Nisula BC 1989 Effect of alcohol on
the interaction of cortisol with plasma proteins, glucocorticoid
receptors and erythrocytes. J Steroid Biochem 33:6570[CrossRef][Medline]
-
McCormick CM, Smythe JW, Sharma S, Meaney MJ 1995 Sex-specific effects of prenatal stress on
hypothalamic-pituitary-adrenal responses to stress and brain
glucocorticoid receptor density in adult rats. Dev Brain Res 84:5561[Medline]
-
Duval D, Dardenne M, Homo F 1979 Glucocorticoid
receptors in thymocytes of fetus, newborn, and adult CBA mice.
Endocrinology 104:11521157[Abstract/Free Full Text]
-
Leposavic G, Micic M 1992 Testosterone binding
sites in the rat thymus during late embryonal and postnatal period.
Thymus 20:7788[Medline]
-
Vamvakopoulos NC, Chrousos GP 1994 Hormonal
regulation of human corticotropin-releasing hormone gene expression:
implications for the stress response and immune/inflammatory reaction.
Endocr Rev 15:409420[Abstract/Free Full Text]
-
Lundblad JR, Roberts JL 1988 Regulation of
proopiomelanocortin gene expression in pituitary. Endocr Rev 9:13558[Abstract/Free Full Text]
-
Smith EM, Morrill AC, Meyer WJ, Blalock JE 1986 Corticotropin releasing factor induction of leukocyte-derived
immunoreactive ACTH and endorphins. Nature 321:881882[CrossRef][Medline]
-
Oates EL, Allaway GP, Prabhakar BS 1990 A potential
for mutual regulation of proopiomelanocortin gene and Epstein-Barr
virus expression in human lymphocytes. Ann NY Acad Sci 594:6065[CrossRef][Medline]
-
Inomata T, Iwaki T, Murakata S, Ninomiya H, Nakamura
T 1985 Evidence for no influence of fetal and maternal
adrenalectomy on the development of the fetal thymus in the rat. Jpn J
Vet Sci 47:665668
-
Eishi Y, Hirikawa K, Hatakeyama S 1983 Long-lasting
impairment of immune and endocrine systems of offspring induced by
injection of dexamethasone. Clin Immunol Immunopathol 26:335349[CrossRef][Medline]
-
Bakker JM, Schmidt ED, Kroes H, Kavelaar A, Heijen CJ,
Tilders FJH, van Rees P 1995 Effect of short-term dexamethasone
treatment during pregnancy on the development of the immune system and
hypothalamo-pituitary-adrenal axis in the rat. J Neuroimmunol 63:183191[CrossRef][Medline]
-
Sasson S, Mayer M 1981 Antiglucocorticoid activity
of androgens in rat thymus lymphocytes. Endocrinology 108:760766[Abstract/Free Full Text]
-
Kumar N, Shan L-X, Hardy MP, Bardin CW 1995 Mechanism of androgen-induced thymolysis in rats. Endocrinology 136:48874893[Abstract]
-
Olsen NJ, Watson MB, Hendreson GS, Kovacs WJ 1991 Androgen deprivation induces phenotypic and functional changes in the
thymus of adult male mice. Endocrinology 129:24712476[Abstract/Free Full Text]
-
Kavelaars A, Berkenbosch F, Croiset G, Ballieux RE,
Heijnen CJ 1990 Induction of beta-endorphin secretion by
lymphocytes after subcutaneous administration of
corticortropin-releasing factor. Endocrinology 126:759764[Abstract/Free Full Text]
-
Olsen NJ, Nicholson WE, DeBold CR, Orth D 1992 Lymphocyte-derived adrenocorticotropin is insufficient to stimulate
adrenal steroidogenesis in hypophysectomized rats. Endocrinology 130:21132119[Abstract/Free Full Text]
-
Galin FS, LeBoeuf RD, Blalock JE 1991 Corticotropin-releasing factor upregulates expression of two truncated
pro-opiomelanocortin transcripts in murine lymphocytes. J
Neuroimmunol 31:5158[CrossRef][Medline]
-
Revskoy S, Frey C, Gupta D 1992 Exons of
proopiomelanocortin gene in the rat lymphoid tissues are differentially
expressed during early ontogenesis. 8th International Congress of
Immunology, Budapest, p 24 (Abstract)
-
Jessop DS, Renshow D, Lightman SL, Harbuz MS 1995 Changes in ACTH and ß-endorphin immunoreactivity in immune tissues
during a chronic inflammatory stress are not correlated with changes in
corticotropin-releasing hormone and arginine vasopressin. J
Neuroimmnol 60:2935[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
X. Zhang, J. H. Sliwowska, and J. Weinberg
Prenatal Alcohol Exposure and Fetal Programming: Effects on Neuroendocrine and Immune Function
Experimental Biology and Medicine,
June 1, 2005;
230(6):
376 - 388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Wilcoxon, J. Schwartz, F. Aird, and E. E. Redei
Sexually dimorphic effects of maternal alcohol intake and adrenalectomy on left ventricular hypertrophy in rat offspring
Am J Physiol Endocrinol Metab,
July 1, 2003;
285(1):
E31 - E39.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sinha, I. Halasz, J. F. Choi, R. F. McGivern, and E. Redei
Maternal Adrenalectomy Eliminates a Surge of Plasma Dehydroepiandrosterone in the Mother and Attenuates the Prenatal Testosterone Surge in the Male Fetus
Endocrinology,
November 1, 1997;
138(11):
4792 - 4797.
[Abstract]
[Full Text]
[PDF]
|
 |
|