help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amizuka, N.
Right arrow Articles by Goltzman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amizuka, N.
Right arrow Articles by Goltzman, D.
Endocrinology Vol. 138, No. 1 469-481
Copyright © 1997 by The Endocrine Society


ARTICLES

Cell-Specific Expression of the Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene in Kidney from Kidney-Specific and Ubiquitous Promoters1

N. Amizuka2, H. S. Lee, M. Y. Kwan, A. Arazani, H. Warshawsky, G. N. Hendy2, H. Ozawa, J. H. White2 and D. Goltzman

Department of Medicine (N.A., A.A., G.N.H., D.G.) and Physiology (H.S.L., M.Y.K., G.N.H., J.H.W., D.G.), and Anatomy and Cell Biology (H.W.), McGill University, and Calcium Research Laboratory (N.A., A.A., G.N.H., D.G.), Royal Victoria Hospital, Montreal, Quebec H3G 1Y6, Canada; and the Department of Oral Anatomy (N.A., H.O.), Niigata University School of Dentistry, 5274, 2-Bancho Gakkoucho-Dori, Niigata, 951 Japan

Address all correspondence and requests for reprints to: J. H. White, Department of Physiology, McIntyre Medical Sciences Building, Room 1109, McGill University, 3655 Drummond Street, Quebec H3G 1Y6, Canada. E-mail: jwhite{at}physio.mcgill.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The kidney is the major site of expression of the PTH/PTH-related peptide receptor (PTHR) gene. Previously we have shown that the PTHR gene is expressed from two promoters in kidney, an upstream kidney-specific promoter (P1) and a downstream promoter (P2) that is active in a wide variety of tissues. Here, we have used immunohistochemical and transcript-specific in situ hybridization techniques to map the expression of the PTHR gene and protein and to determine the distribution of P1- and P2-driven messenger RNAs in renal tissue. Immunohistochemical and immunoelectron microscopic analysis showed that PTHR protein is expressed on both basolateral and luminal membranes of proximal tubular epithelial cells, strongly suggesting a bipolar mode of action of PTH. Receptor protein also was detected on the surface of glomerular podocytes. Strikingly, immunoelectron microscopic analysis showed that endothelial cells of the peritubular vasculature, but not the glomerular vasculature, contain high levels of PTHR protein. We found that both P1 and P2 are expressed at moderate levels in both cortical and medullary epithelial cells of nephrons, correlating well with the immunohistochemical localization of PTHR protein. However, although abundant transcripts were detected in peritubular endothelial cells with P1-specific and coding sequence probes, P2-specific expression was not observed in these cells. These results provide evidence that the physiological effects of PTH- and/or PTH-related peptide on renal tubular function may be mediated not only through direct effects on epithelial cells but also indirectly through endothelial cell-based signaling. In addition to expression in vascular endothelial cells, high levels of P1-specific, but not P2-specific, PTHR messenger RNA were detected in vascular smooth muscle. Taken together, these experiments provide evidence for strong PTHR gene expression in renal vascular tissues. Moreover, given that previous studies have shown that P2, but not P1, is active in other tissues with an abundant vasculature, our results suggest that regulation of PTHR gene expression in renal vascular tissue is distinct from that of other organs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTH influences the fluxes of calcium, phosphate, and hydrogen ions in the kidney and modulates the activity of 25-hydroxyvitamin D 1{alpha}-hydroxylase (1). PTH enhances calcium reabsorption in the renal distal convoluted tubule and inhibits phosphate and bicarbonate uptake in the proximal convoluted tubule. PTH-related peptide (PTHrP), originally described as the major mediator of hypercalcemia associated with a variety of malignancies (2), can mimic many of the effects of PTH when overproduced by cancers. Under physiological conditions, PTHrP is thought to act in a paracrine/autocrine mode, in contrast to PTH. Moreover, whereas PTH expression is restricted to the parathyroids, PTHrP is widely expressed and functions to modulate normal cellular growth and differentiation (3, 4, 5, 6). The most striking evidence for a physiological role for PTHrP has come from gene ablation experiments in mice that have shown that PTHrP is essential for normal endochondral ossification (7, 8, 9). In the adult, PTHrP also has been shown to act as a relaxant of smooth muscle, including vascular smooth muscle (10).

Unlike the C-terminal portions of PTH and PTHrP, the N-terminal 34 amino acids of the two hormones are partially conserved and have been postulated to form similar helix-turn-helix structures (11). The spectrum of actions common to PTH and PTHrP emanates from the capacity of the conserved N-terminal region of each hormone to interact with the same guanylyl-nucleotide binding (G) protein-coupled receptor. The complementary DNA (cDNA) and gene encoding the PTH/PTHrP receptor (PTHR) have been cloned, and like PTHrP, the PTHR is widely expressed (12).

Recently, a second PTH receptor (PTH2), with only 20% homology to PTHR, has been cloned. PTH2 is mainly localized to brain and, to some extent, in pancreas, testes, and placenta but not in kidney (13). This receptor seems to bind PTH with much higher affinity than PTHrP.

The mouse gene encoding the PTHR is composed of at least 17 exons, and its expression is regulated by at least two promoters (14, 15). These promoters give rise to two transcripts differing in their 5' untranslated sequences but not their coding regions. Transcripts expressed from the upstream promoter (P1) contain sequences derived from two 5' untranslated region exons U1 and U2. Expression of P1 is largely restricted to kidney although weak expression is detected in liver (15). The downstream mouse promoter (iP2) is very (G+C)-rich and is widely expressed (15). P2-specific transcripts contain 5' untranslated sequences derived from exon U3. RNase protection assays have suggested that P1 activity accounts for 80–90% of PTHR transcripts detected in the mouse kidney. Recently, the 5' end of the highly conserved rat PTHR gene has been found to have a very similar exonic structure and pattern of transcript expression (16). cDNAs have been isolated from human kidney cDNA libraries that contain sequences 74% similar to mouse exons U1 and U2, suggesting that the structure of the 5' end of the PTHR gene also is conserved in humans (17).

The combined length of exons U1 and U2 is very similar to that of U3 (15), which accounts for the detection in most tissues of a single messenger RNA (mRNA) of 2.3 kilobase pairs (kb) (18, 19). However, larger and smaller mRNA species have been detected with PTHR cDNA probes in rat kidney, liver, brain, skin, and testes (18, 19). In addition, a receptor with different intracellular signaling properties has been detected in normal keratinocytes and malignant squamous cells (20). Whether these species represent distinct gene products or alternatively spliced forms of the PTHR remains to be determined.

The PTHR is most highly expressed in the kidney, where its action is essential for ion homeostasis. We are interested in analyzing the regulation of expression of the receptor in the kidney. Although our previous studies suggested renal PTHR expression was driven largely by the P1 promoter, gene transfer experiments presented below suggested that P2 also is active in renal epithelial cell lines. We have therefore examined the localization of PTHR protein and P1- and P2-derived mRNAs in the different tissues in the kidney by immunocytochemistry and in situ hybridization using transcript-specific probes. Our results demonstrate that both P1 and P2 are expressed in epithelial cells of the nephron and provide evidence for strong PTHR gene expression driven exclusively by P1 in renal vasculature.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
Probes for in situ hybridization and Northern blot analyses were derived from plasmids pU1/U2 and pU3/170 and the rat PTHR cDNA (21). pU1/U2, composed of 220 bp of cDNA sequence within exons U1 and U2, was constructed by inserting a PCR fragment amplified from 5' RACE clone 34 (15) using the 5' primer (GCTCTAGACCACCAGCTGTGTCCTTG) and 3' primer (CCGCTCGAGCAATTGTGTGTCCTGCC) into pBluescript SK digested with XbaI and XhoI. pU3/170 was constructed by PCR amplification of 170 nucleotides of exon U3 using plasmid pU3A/X (15), the 5' primer (GCTCTAGAGCAGCAGACGCCGAG), and the T7 promoter, oligonucleotide, as 3' primer. The PCR product was digested with ApaI and XbaI and inserted into the respective sites in pBluescript SK+. Plasmid KS-rPTHrec4-1 is as described in Pausova et al. (19). The plasmids pP1-2300/luc, which contains only P1 promoter sequences, and pP2-656 and pP2-1473/luc were constructed by inserting 2.3 kb BamHI-PvuII, 0.8 kb PvuII-BamHI, and 1.6 kb KpnI-BamHI fragments, respectively, into the polylinker region of the promoterless luciferase expression vector pXP2 (15).

Northern analysis
Northern hybridizations were performed essentially as described (21). Briefly, 20–30 µg of mouse kidney total RNA was resolved on 1% agarose formaldehyde gel and blotted onto nylon membrane (Amersham, Oakville, Ontario, Canada). Prehybridization and hybridization were carried out in 6 x SSC, 5 x Denhardt’s, 1% SDS, 100 µg/ml salmon sperm DNA, and 10% dextran sulfate at 65 C. 32P-labeled probes were synthesized by random primed labeling of DNA fragments excised from plasmids pU1/U2 (XbaI/XhoI), pU3/170 (ApaI/XbaI), and KS-rPTHrec4-1 (AccI/HindIII; 171 bp of coding sequence encompassing transmembrane region a.a. 387–427).

Cell culture and lipofections
Renal epithelial cell lines Madin-Darby canine kidney, mouse distal convoluted tubule (a generous gift of Dr. P. Friedman, Dartmouth, NH), and opossum kidney OK cells were cultured in DMEM/F12 media (GIBCO, Burlington, Ontario, Canada) supplemented with 50 U/ml each of penicillin and streptomycin and 10% FBS (GIBCO). Cells were transfected by lipofection using Lipofectin (GIBCO), according to the manufacturer’s instructions, with 1 µg of ß-galactosidase expression vector p610AZ (15) and 2 µg of PTHR promoter recombinants. Transfection efficiencies for a given cell type varied by ± 20%. Cells were harvested in 300 µl Reporter Lysis Buffer (Promega, Madison, WI) and 30 µl used for ß-galactosidase assays (to normalize for transfection efficiency) and for luciferase assays (Promega).

Immunohistochemistry for the PTHR
For the PTH receptor immunohistochemistry, 7- to 8-week-old male ddY mice (Japan SLC Inc., Hamamatsu, Japan) were anesthetized with nembutal and perfused through the left ventricle with 4% paraformaldehyde diluted in 0.1 M phosphate buffer (pH 7.4). The kidneys were extracted and immersed in the same fixative for 6 h at 4 C. Some specimens were dehydrated with an increasing concentration of ethanol before paraffin imbedding, and the others were immersed in a series of ascending concentrations from 5–25% sucrose in PBS. Paraffin or frozen cryostat sections of approximately 8 µm thickness were collected on poly-L-lysine-coated glass slides.

Rabbit polyclonal antisera were raised against epitopes in the N-terminal extracellular domain of the rat PTHR. Antiserum no. IK-XXI-89 was directed against amino acids 85–105 (GKFYPESKENKDVPTGSRRRG), which is 100% conserved in the mouse (14). This antibody recognizes the PTHR specifically as judged by Western analysis (22) and has been used previously to detect PTHR expression in rat tibiae (22). The dewaxed paraffin sections were pretreated with 0.3% H2O2 in PBS for 10 min at room temperature to inhibit endogenous peroxidase activity and subsequently treated with 1% BSA in PBS (BSA-PBS) for 30 min at room temperature. They were incubated with no. IK-XXI-89 at a dilution of 1:100 in 1% BSA-PBS overnight at 4 C. After rinsing with PBS, the sections were incubated with horseradish peroxidase-conjugated goat f(ab')2 fragment-antirabbit IgG (Calbiochem, San Diego, CA) at a dilution of 1:100 with 1% BSA-PBS for 60 min at room temperature. Visualization for the immunohistochemistry was performed using diaminobenzidine as a substrate. The specificity of signals obtained by immunohistochemistry were confirmed using nonimmune serum, which gave no signal on paraffin sections of mouse kidney cortex or medulla. As a further index of specificity, immunocytochemistry was performed on Chinese hamster ovary (CHO) cells transiently transfected with PTHR cDNA by the calcium phosphate technique (Fig. 1Go). Untransfected CHO cells served as a negative control. A specific signal was seen only in cells expressing the PTHR using anti-PTHR antiserum. No specific signal was observed in immunocytochemical experiments performed with transfected cells or tissues in the absence of anti-PTHR antiserum.



View larger version (112K):
[in this window]
[in a new window]
 
Figure 1. Immunocytochemical analysis of PTHR expression in transiently transfected CHO-1 cells using an antirat PTHR antibody. Untransfected control CHO-1 cells (A) and CHO-1 cells transiently transfected with a rat PTHR expression vector (B) were tested with an antirat PTHR polyclonal antibody raised against a peptide derived from sequences within the receptor extracellular domain. Immunopositivity is seen on the surface of transfected cells brown color (arrows) but not on untransfected controls. Magnification, A and B x300.

 
Cryostat sections (8 µm thick) were collected on poly-L-lysine glass slides for immunoelectron microscopy. Sections were incubated with anti-PTHR antibodies as described above. After visualization of immunoreactivity with horseradish peroxide, specimens were fixed with 4% glutaraldehyde diluted in phosphate buffer (pH 7.4) for 6 h at room temperature and then were post fixed with OsO4 for 2–3 h. Sections were dehydrated with an ascending concentration of acetone and embedded in Polybed 812 (Polyscience Inc., Warrington, PA). Thin sections were observed under transmission electron microscopy (JEM-1001CXII, Jeol, Tokyo, Japan).

In situ hybridization
Sprague Dawley rats were anesthetized with nembutal, and kidneys were extracted immediately and immersed in liquid nitrogen. Frozen sections of the kidneys were collected on poly-L-lysine-coated glass slides (Polyscience Inc.). Sections were subsequently treated with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 15–20 min. and then with proteinase K (10 µg/ml) in 10 mM Tris-HCl (pH 8.0) at 37 C for 3–5 min. Acetylation of sections was performed by incubation for 10 min. with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0). cRNA probes were prepared with digoxigenin-labeled UTP (Boehringer Mannhein Biochemical, Mannheim, Germany). Sense and antisense cRNA probes for the rat PTHR were obtained from cloned cDNA plasmid KS-rPTHrec4-1 using T7 and SP6 RNA polymerases, respectively.

For hybridizations, hybridization buffer [50% formamide, 10 mM Tris-HCl (pH 7.6), 100 µg transfer RNA, 1 x Denhardt’s solution, 10% dextran sulfate, 600 mM NaCl, 0.25% SDS, and 1 mM EDTA] was preheated for 10 min at 90 C. Each cRNA probe was adjusted to a concentration of 0.1–1.0 µg/ml. Hybridization was performed overnight at 50 C, and then sections were washed with 50% formamide in 2 x SSC at 55 C for 30 min and treated at 37 C with a solution of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, and 1 mM EDTA. Nonspecific binding of probes was reduced by RNase A treatment [20 µg/ml in 10 mM Tris (pH 7.5), 1 mM EDTA, 500 mM NaCl] at 37 C for 30 min. For immunodetection of digoxigenin-labeled probes, sections were preincubated with 2% blocking agent and incubated for 45–60 min with alkaline phosphatase-conjugated sheep antidigoxigenin antibody at a dilution of 1:1000. Visualization was performed using nitroblue tetrazolium salt and 5-bromo-4-chloro-3-indolylphosphate. Sense cRNA probes were employed to verify the specificity of hybridization conditions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of PTHR protein on basolateral and luminal surfaces of epithelial cells of renal cortical tubules and in vascular endothelial cells
In renal cortical tissue, strong PTHR immunoreactivity was detected clearly by immunohistochemistry on the basolateral membranes of tubules (Fig. 2AGo). In addition, immunoreactivity was detected on the luminal surfaces of some tubules (Fig. 2AGo). In contrast, only weak immunoreactivity was detected under the same conditions in glomeruli. No specific signal was observed using nonimmune serum (Fig. 2BGo). The distribution of PTHR protein in the cortex was further investigated by immunoelectron microscopy. PTHR protein was detected on basolateral membranes and, to a lesser extent, on the luminal surface of epithelial cells of proximal convoluted tubule cells (Fig. 3Go), confirming the results obtained by light microscopy. Immunopositivity also was seen in vesicles adjacent to the luminal membrane (Fig. 3BGo). Strikingly, we also observed high levels of expression of PTHR protein on the thin walls of endothelial cells of the cortical capillaries (Fig. 3Go, A, C, and D). This immunopositivity was severalfold more intense than that observed on basolateral membranes of adjacent epithelial cells. We also detected expression of PTHR protein on the surface of glomerular podocytes (Fig. 4Go), consistent with our previous findings (23), whereas no PTHR expression was detected in vascular endothelial cells in glomeruli.



View larger version (133K):
[in this window]
[in a new window]
 
Figure 2. Immunohistochemical analysis of PTHR expression in the renal cortex. A, In the light micrograph positive reactivity is seen as brown staining along basolateral cell surfaces of renal tubules (arrowheads). Luminal membranes of some tubules also stain positively (arrows). B, No immunoreactivity was observed when nonimmune rabbit serum was employed on paraffin sections of mouse kidney cortex. Sections were faintly counterstained by methyl green. Magnification, x700.

 


View larger version (123K):
[in this window]
[in a new window]
 
Figure 3. Immunolocalization of the PTHR on membranes of cortical epithelial cells and adjacent endothelial cells by electron microscopy. A, Electron micrograph of a proximal tubule epithelial cell (Epi) and the thin wall of a vascular endothelial cell lining the adjacent blood vessel (BV). Identification of proximal convoluted tubule cells was made by virtue of the presence of well-developed brush borders on the luminal membrane and an abundance of basal mitochondria. PTHR immunoreactivity (black color) is seen on the luminal and basolateral surfaces of the epithelial cell (arrows) and on the endothelial cell (arrowheads). Magnification, x5,500. B, Higher magnification image of the luminal region of a proximal tubule epithelial cell showing PTHR immunoreactivity on the luminal membrane (arrows) and in adjacent vesicles (V). Magnification, x24,000. C, Higher magnification of the basal region of an epithelial cell (Epi). The basement membrane and blood vessel are indicated by BM and BV, respectively. Basolateral membrane and endothelial cell PTHR immunopositivity are indicated by arrows and arrowheads, respectively. Magnification, x17,000. D, Similar to C, but including the cell body of an endothelial cell (En). Magnification, x9,500.

 


View larger version (112K):
[in this window]
[in a new window]
 
Figure 4. Immunoelectron micrograph of a renal corpuscle. Immunoreactivity of the PTHR on the plasma membrane of a glomerular podocyte (P) is indicated by arrowheads. Adjacent glomerular blood vessels (BV) are not immunopositive. Magnification, x6,200.

 
PTHR protein expression in the renal medulla
In the renal medulla, moderate immunoreactivity, specific for the PTHR, was detected in the collecting ducts (Fig. 5Go). These results are consistent with previous radioautographic detection of specific binding of PTH to this site of the nephron (23). Having examined the distribution of expression of PTHR protein in renal tissues, we were interested next in determining the distribution of the different species of PTHR mRNA expressed in the kidney



View larger version (155K):
[in this window]
[in a new window]
 
Figure 5. Light microscopic immunohistochemical analysis of PTHR protein expression in the mouse renal medulla. Longitudinal (A) and cross- (B) sections in the medulla show PTHR-immunopositivity on cell surfaces of collecting ducts (arrows). Longitudinal (C) or cross- (D) sections of the medulla were treated with nonimmune rabbit serum, resulting in no immunoreaction. Magnification, x250.

 
Analysis of renal PTHR gene expression: mRNAs transcribed from promoters P1 and P2
The kidney-specific promoter P1 and the ubiquitous promoter P2 are both expressed in the kidney. Previous RNase protection assays have suggested that P1-specific transcription drives the expression of the large majority of PTHR mRNAs in kidney (15). However, this type of analysis does not provide any information as to the lengths and, hence, downstream splicing patterns of the mRNAs or whether the combined activity of P1 and P2 accounts for all of the renal PTHR gene transcription. Renal PTHR mRNAs were therefore characterized by Northern analysis using a coding region probe along with probes specific to transcripts derived from P1 and P2 (Fig. 6AGo). The coding region probe detects a predominant band of approximately 2.3 kb (Fig. 6BGo, lane C) (18, 19). P1- and P2-specific probes recognize distinct 5' untranslated regions but detect major transcripts indistinguishable in size from those identified with the coding region probe (Fig. 6BGo, lanes P1 and P2). These results are consistent with the large majority of transcripts derived from P1 and P2, differing in their 5' untranslated regions but not in their coding sequence (14, 15), although we cannot rule out the possibility of alternative splicing of the coding region of the gene.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. Promoter-specific transcription of the PTHR gene in kidney. A, Top; structure of the 5' untranslated region of the mouse PTHR gene. The previously characterized (14, 15) P1 and P2 promoters are indicated. The three 5'untranslated region exons (U1–U3) and the exon containing the signal sequence (SS) are indicated. Splicing patterns of the gene are indicated up to exon E1. Below; promoter-specific probes used for Northern analysis and in situ hybridization (see Materials and Methods). B and C, Northern analysis of PTHR transcripts in kidney in part B and heart in part C using coding region (C) and promoter-specific probes (P1 and P2). In each case, identical aliquots of total mouse RNA were loaded on three different lanes of a 1% agarose gel and probed separately.

 
The proportions of P1- and P2- specific mRNAs detected by Northern analysis are in close agreement with previous RNase protection studies (15) and are consistent with P1 being the major PTHR gene promoter in kidney. The signal obtained with the coding region probe was approximately equivalent to the combined signals obtained with the promoter-specific probes (Fig. 6BGo), suggesting that the P1 and P2 promoters account for the large majority of PTHR gene transcription in the kidney. In contrast to the expression pattern in kidney, Northern analysis of PTHR transcripts in heart (Fig. 6CGo) did not detect any P1-specific transcripts, whereas the P2-specific probe detected a 2.3-kb band of similar intensity to that seen with the coding sequence probe. These results serve as an important control by inferring that the relatively weak expression of P2-specific transcripts seen in kidney was not caused by inefficient hybridization of the probe.

The relatively high levels of renal expression of the P1 promoter are striking, given the results of a series of gene transfer experiments performed in the renal epithelial cell lines OK, mouse distal convoluted tubule, and Madin-Darby canine kidney using P1- and P2-promoter-luciferase constructs (Table 1Go). These experiments suggested that the P2 promoter showed comparable or greater activity than P1 sequences. Similar results were obtained in transiently transfected OK cells with P1 and P2 promoter recombinants containing 5.7 and 6 kb of flanking sequence, respectively (data not shown). The apparent discrepancy between the relative expression of P1- and P2-specific transcripts in total kidney detected by Northern analysis and the relative activities of our reporter constructs in epithelial cells indicated that it was important to determine the expression patterns of the two promoters in different renal tissues before undertaking comprehensive promoter analyses.


View this table:
[in this window]
[in a new window]
 
Table 1. Activity of PTHR promoter-luciferase recombinants in renal epithelial cell lines

 
Tissue-specific distribution of P1- and P2-specific PTHR transcripts in glomeruli, cortical tubules, and vascular endothelial cells
The expression of PTHR transcripts in rat cortical tubules and glomeruli was analyzed by in situ hybridization using digoxigenin-labeled antisense probes recognizing coding region, P1- or P2-specific sequences (see Fig. 6Go). Intense hybridization signals specific for the PTHR coding region were observed in epithelial cells of cortical tubules (Fig. 7Go, A and D). Consistent with observation of PTHR protein in glomeruli (Fig. 4Go), coding sequence-specific hybridization also was observed in some, but not all, cells in glomeruli (Fig. 7AGo). A very similar pattern of expression was detected with P1-specific sequences. Extensive hybridization was detected in cortical epithelial cells (Fig. 7Go, B and E) along with focal hybridization in glomeruli (Fig. 7BGo). In addition, we observed intense hybridization in capillary endothelial cells located adjacent to tubules with both coding region and P1 probes (Fig. 7Go, D and E). No specific signals were observed with sense probes corresponding to coding region-specific and P1-specific sequences (Fig. 7Go, G and H). These results are consistent with the abundance of PTHR protein observed in endothelial cells lining cortical capillaries (Fig. 4Go).



View larger version (186K):
[in this window]
[in a new window]
 
Figure 7. In situ hybridization, demonstrating expression of P1- and P2-specific transcripts and of the PTHR coding region in renal cortex. A–C, Light micrographs of outer cortex (including glomeruli); D–F, light micrographs of inner cortex (closer to the medulla); A, Expression of PTHR coding region sequences (brown color) is widespread in cortical epithelial cells (E) and in some cells of the glomeruli (G, arrows denote hybridization), B, Expression of P1-specific sequences shows a similar distribution, i.e. widespread in tubular epithelial cells (E) and focal expression in glomeruli (G, indicated by arrows). Endothelial cells (arrowheads) show intense expression of P1-specific transcripts. C, Expression of P2-specific transcripts (faint brown color) can be seen in renal cortical epithelial cells but not glomeruli. D, In situ hybridization, revealing moderate-to-strong reaction with coding region sequences in endothelial cells of the microvasculature (arrowheads) and weaker, generalized reaction in epithelial cells. E, similar to D, except sections were probed with P1 specific sequences. Expression in endothelial cells is indicated by arrowheads. F, Similar to D, except performed with a P2-specific probe. Note lack of expression in endothelial cells. G–I, As controls, in situ hybridizations employing sense cRNA probes obtained from coding sequence, exons U1/U2 (promoter P1-specific), and U3 (promoter P2-specific) are shown in G, H, and I, respectively. No hybridization signal was seen in any of these sections. All sections were faintly counterstained with methyl green. Magnification, A–I x650.

 
Expression of P2 in the cortex is more restricted. A P2-specific antisense probe, but not a sense probe, detected expression in epithelial cells (Fig. 7Go, C, F, and I). No (or only weak) expression of P2-specific transcripts was detected with an antisense probe in glomeruli (Fig. 7CGo), and no P2-specific expression was seen in vascular endothelial cells (Fig. 7Go, C and F; and data not shown). This indicates that expression of the PTHR gene in glomeruli and in vascular endothelial cells is controlled exclusively by the kidney-specific P1 promoter.

Expression of PTHR transcripts in the medulla
We also analyzed expression of PTHR transcripts in longitudinal and cross-sections taken from medulla. PTHR transcripts were detected using a coding region probe in collecting ducts in longitudinal and cross-sections of the medulla (Fig. 8Go, A and C). A similar expression pattern was observed in the medulla with a P1-specific probe (Fig. 8Go, B and D). Further evidence for PTHR transcript expression in the renal medulla was seen at lower magnification (Fig. 9Go). Coding sequence and P1-specific expression was clearly evident (Fig. 9Go, A and C), whereas P2-specific expression was virtually undetectable (Fig. 9EGo). These results are consistent with immunohistochemical analyses presented in Fig. 5Go.



View larger version (158K):
[in this window]
[in a new window]
 
Figure 8. In situ hybridization study of longitudinal (A and C) and cross- (B and D) sections of renal medulla with PTHR gene coding region probe (A and B), and P1-specific probe (C and D). Expression in collecting ducts is indicated by arrows. Magnifications: A and B, x230; C and D, x140.

 


View larger version (141K):
[in this window]
[in a new window]
 
Figure 9. Expression of PTHR transcripts in whole kidney sections. A, Low power magnification (x26) of a section of kidney showing intense coding sequence-specific staining (dark brown) in the walls of medium-sized blood vessels (framed area) and lighter staining in cortical and medullary tubules; B, higher-power magnification (x250) of framed area in A showing intense coding region-specific staining in smooth muscle of the blood vessels; C and D, studies similar to those shown in A and B using a P1-specific probe; E and F, similar studies to those shown in A and B using a P2-specific probe. Note the lack of staining in vascular smooth muscle.

 
Strong expression of P1-specific PTHR transcripts in renal vascular smooth muscle
Given that PTH and PTHrP stimulate vascular smooth muscle relaxation, it was of interest to examine PTHR expression in renal vascular smooth muscle. A strong signal was seen in vascular smooth muscle with coding region and P1-specific probes (Fig. 9Go, A–D). This signal persisted even after washing sections under high stringency (not shown). In contrast, no specific signal was observed with a P2-specific probe (Fig. 9Go, E and F), indicating that P2 expression is very low or nonexistent in these cells. These results provide evidence for high levels of P1-specific PTHR mRNA expression in renal vascular smooth muscle.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of our immunohistochemical analyses are consistent with a broad distribution of PTHR protein in cortical and medullary epithelial cells and are in excellent agreement with the expression pattern of the PTHR gene determined by in situ hybridization. These results provide a molecular basis for specific and competitive binding of PTH that occurs in cells of proximal and distal tubules of the cortex and cortical thick ascending limb of the loop of Henle and in collecting ducts (23). Moreover, our present in situ hybridization analyses indicate that both kidney-specific promoter P1 and ubiquitously active promoter P2 function to produce PTHR mRNAs in these epithelial cells.

PTHR protein was detected on both the basolateral and luminal surfaces of cortical epithelial cells by immunoelectron microscopy. The dual delivery of circulating, bioactive PTH to the nephron by glomerular filtration and by peritubular uptake, which might result in PTH action on both brush border and basolateral membrane, has been previously reported (24). Our demonstration of the bipolar distribution of PTHR protein in proximal tubule cells, therefore, provides a structural basis for such interactions, and for studies demonstrating PTH binding, and PTH-stimulated adenylate cyclase on basolateral and brush border surfaces (23, 25). It is possible that the receptors we identified on the apical surface are bound by PTHrP that has translocated from the cytoplasm to the subapical region after the induction of ischemia (26).

PTH exerts pleiotropic effects in the renal tubule. Although the precise distribution of the different functions of PTH may vary from species to species, several approaches have localized PTH-mediated inhibition of phosphate (27) and bicarbonate reabsorption (28) and stimulation of 25 hydroxyvitamin D 1{alpha} hydroxylase activity to the proximal tubule. PTH stimulation of calcium reabsorption has been localized to the ascending limb of Henle’s loop (29) and to portions of the distal tubule (30). Our studies, demonstrating the presence of PTHR mRNA and protein along the nephron, correlate well with results obtained with physiological approaches (31).

PTH binding in vivo (23) and in vitro (32) and adenylate cyclase stimulation in vitro (33) have been reported in glomeruli. In addition, PTH has been shown to influence glomerular filtration in vivo (34). Our immunoelectron microscopic analyses have detected PTHR protein on the surface of podocytes, and our in situ hybridization studies demonstrated expression of PTHR transcripts in selected cells in glomeruli. Of special importance is the finding that PTHR expression in these cells was derived from kidney-specific promoter P1 but not from ubiquitous promoter P2.

Immunoelectron microscopic analyses detected high levels of PTHR protein on endothelial cells of the peritubular vasculature. In situ hybridization studies with promoter-specific probes showed that this expression is controlled exclusively by the kidney-specific P1 promoter of the PTHR gene. Moreover, P1, but not P2, is strongly expressed in vascular smooth muscle of the kidney. These striking observations indicate that high levels of PTHR are expressed in renal vascular tissue, either in endothelial or smooth muscle cells. Both PTH and PTHrP exert hypotensive effects mediated by their N-terminal domains when they are infused in vivo, and both are believed to directly interact with blood vessels (35). Abundant PTHrP expression has been reported in rat aortic smooth muscle cells, which also respond to the peptide, consistent with an autocrine/paracrine effect of PTHrP on the vasculature (36). PTHrP also is known to be expressed in kidney (26) and may therefore play an autoregulatory role as a renal autocrine/paracrine factor. Thus, in the kidney, both PTH and PTHrP can increase regional blood flow and/or decrease vascular resistance (35) and can relax the renal artery in the preconstricted rat kidney (37). Both hormones bind to vascular smooth muscle of rabbit renal microvessels (38). Furthermore, both endothelium-dependent nitric oxide-mediated vasodilatation (39) and endothelium-independent cAMP-stimulated vasodilatation (40) have been implicated in the mechanism of vascular action of PTH and PTHrP.

Our present studies documenting the presence of the PTHR in renal endothelial cells and in vascular smooth muscle therefore provide a molecular basis for the action of PTHrP and PTH in the renal vasculature through stimulation of endothelium-related and endothelium-independent events. It is also noteworthy that the microvasculature has not been implicated in control of vascular tension. This raises the possibility that the high levels of PTHR expressed in the endothelium of peritubular capillaries may exert some of the physiological effects of PTH on adjacent epithelial cells of the nephron through endothelium-based signaling events.

Several studies have shown that the kidney is the major site of expression of PTHR mRNA (15, 18). Our previous RNase protection experiments indicated that activity of the PTHR P1 promoter is largely restricted to kidney (15), and moreover, that P1 expression is responsible for at least 90% of renal PTHR transcripts (Fig. 6Go). Nevertheless, P1 and P2 promoter sequences stimulated similar levels of reporter gene expression in gene transfer experiments in several renal epithelial cell lines (Table 1Go). This apparent discrepancy was resolved by our finding that P1-, but not P2-, specific transcripts were detected in renal vascular endothelial and smooth muscle tissue. It is noteworthy that P1 is only weakly active in liver, and its activity is undetectable in heart (two organs with abundant vascular tissue), whereas P2 is active in both tissues (15). Taken together, the above results suggest that expression of PTHR in renal vasculature is regulated differently from its expression in the vasculature of other tissues. Therefore, further studies will be necessary to determine the precise control of P1 in renal vs. extrarenal vascular tissues and to examine the different regulatory signals modulating P1 and P2 expression in the kidney.

In summary, our immunohistochemical and in situ hybridization studies have documented broad expression of the PTHR in the kidney and emphasize the abundant expression of the receptor in vascular tissues, particularly in peritubular capillary endothelial cells. Promoter-specific in situ hybridization experiments showed that both P1- and P2-specific PTHR transcripts are present in epithelial cells of the nephron, whereas strong P1-specific expression was found in the renal vasculature. Our results are consistent with the PTHR being the predominant receptor for PTH in the kidney. Moreover, they underline the importance of PTH signaling in the renal vasculature through stimulation of events mediated by both endothelial and nonendothelial cells.


    Acknowledgments
 
We are grateful to Asahi Kasei Industry for their support in raising anti-PTHR antisera.


    Footnotes
 
1 This work was supported by Medical Research Council of Canada Grants MT-12896 (to J.H.W.), MT-5775 (to D.G.), MT-9315 (to G.N.H.) and by a grant from the National Cancer Institute (to D.G.) and from the Kidney Foundation of Canada (to G.N.H.). Back

2 N. Amizuka was the recipient of a Research Fellowship from the Royal Victoria Hospital and currently is the recipient of a fellowship from the Naito Foundation. G. N. Hendy is a Medical Research Council of Canada Scientist. J. H. White is a chercheur-boursier of the Fonds de Recherche en Santé du Québec. Back

Received May 13, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Goltzman D, Hendy GN 1995 Parathyroid hormone. In: Becker KL (ed) Principles and Practice of Endocrinology and Metabolism, ed 2. J. B. Lippincott Co., Philadelphia, pp 455–467
  2. Suva LJ, Winslow GA, Wettenhall REH, Hammonds RG, Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H, Chen EY, Hudson PJ, Martin TJ, Wood WI 1987 A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science 237:893–896[Abstract/Free Full Text]
  3. Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT, Stewart AF, Bander NH, Weir EC, Insogna KL, Broadus AE 1988 Identification of transcripts encoding parathyroid hormone-like peptide in messenger RNAs from a variety of human and animal tumors associated with humoral hypercalcemia of malignancy. J Clin Invest 81:2010–2014
  4. Strewler GD, Nissenson RA 1993 Parathyroid hormone-related peptide. In: Favus MJ (ed) Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism, ed. 2. Raven Press, New York, pp 169–173
  5. Stewart AF 1993 Humoral hypercalcemia of malignancy. In: Favus, MJ (ed) Primer on Metabolic Bone Diseases and Disorders of Mineral Metabolism, ed 2. Raven Press, New York, pp 61–63
  6. Henderson J, Bernier S, D’Amour P, Goltzman D 1990 Effects of passive immunization against parathyroid-hormone (PTH)-like peptide and PTH in hypercalcemic tumor-bearing rats and normocalcemic controls. Endocrinology 127:1310–1318[Abstract/Free Full Text]
  7. Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VLJ, Kronenberg HM, Mulligan RC 1994 Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 8:277–289[Abstract/Free Full Text]
  8. Amizuka N, Warshawsky H, Goltzman D, Karaplis AC 1994 Parathyroid hormone-related peptide-depleted mice show abnormal epiphiseal cartilage development and altered endochondral bone formation. J Cell Biol 126:1611–1623[Abstract/Free Full Text]
  9. Amizuka N, Karaplis AC, Warshawsky H, Henderson JE, Lipman ML, Matsuki Y, Ejiri S, Tanaka M, Izumi N, Ozawa H, Goltzman D 1996 Haploinsufficiency of parathyroid hormone related peptide (PTHrP) results in abnormal post-natal bone development. Dev Biol 175:166–176[CrossRef][Medline]
  10. Musso MJ, Plante M, Judes C, Bathelmebs M, Helwig JJ 1989 Renal vasodilation and microvessel adenylated cyclase stimulation by synthetic parathyroid hormone-like protein fragments. Eur J Pharmacol 174:139–151[CrossRef][Medline]
  11. Cohen FE, Strewler GJ, Bradley MS, Carlquist M, Nilsson M, Ericsson M, Ciardelli TL, Nissenson RA 1991 Analogs of parathyroid hormone modified at positions 3 and 6. J Biol Chem 266:1997–2004[Abstract/Free Full Text]
  12. Jüppner H, Abou-Samra A-B, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski LJ, Hock J, Potts JJ, Kronenberg HM, Segre GV 1991 A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  13. Usdin TB, Gruber C, Bonner TI 1995 Identification and functional expression of a receptor selectively recognizing parathyroid hormone, the PTH2 receptor. J Biol Chem 270:15455–15458[Abstract/Free Full Text]
  14. McCuaig KA, Clarke JC, White JH 1994 Molecular cloning of the gene encoding the mouse parathyroid hormone/parathyroid hormone-related peptide receptor. Proc Nat Acad Sci USA 91:5051–5055[Abstract/Free Full Text]
  15. McCuaig KA, Lee H, Clarke JC, Assar H, Horsford J, White JH 1995 Parathyroid hormone/parathyroid hormone related peptide receptor gene transcripts are expressed from tissue-specific and ubiquitous promoters. Nucleic Acids Res 23:1948–1955[Abstract/Free Full Text]
  16. Joun H, Lanske B, Abou-Samra AB 1995 Tissue-specific transcription-start site and 5' alternative splicing of the PTH/PTHrP receptor (PPR) gene. J Bone Miner Res 10:S488
  17. Adams AE, Pines M, Nakamoto C, Behar V, Rashti-BehBessalle R, Chorev M Rosenblatt M, Levine MA, Suva LJ 1995 Probing the bimolecular interactions of parathyroid hormone and the human parathyroid hormone/parathyroid hormone-related peptide receptor. 2. Cloning, characterization and photoaffinity labeling of the recombinant human receptor. Biochemistry 34:10553–10559[CrossRef][Medline]
  18. Urena P, Kong XF, Abou-Samra AB, Jüppner H, Kronenberg HM, Potts Jr JT, Segre GV 1993 Parathyroid hormone (PTH)/PTH-related peptide receptor messenger ribonucleic acids are widely distributed in rat tissues. Endocrinology 133:617–623[Abstract/Free Full Text]
  19. Pausova Z, Bourdon J, Clayton D, Mattei M-G, Seldin MF, Janicic N, Riviére M, Szpirer J, Levan G, Szpirer C, Goltzman D, Hendy GN 1994 Cloning of a parathyroid hormone/parathyroid hormone-related peptide receptor (PTHR) cDNA from a rat osteosarcoma (UMR 106) cell line: chromosomal assignment of gene in the human, mouse and rat genomes. Genomics 20:20–26[CrossRef][Medline]
  20. Orloff JJ, Ganz MB, Ribaudo AE, Burtis WJ, Reiss M, Milstone LM, Stewart AF 1992 Analysis of parathyroid hormone-related protein binding and signal transduction mechanism in benign and malignant squamous cells. Am J Physiol 262:E599–E607
  21. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning. A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp 7.39–7.52
  22. Irie K, Ozawa H 1996 Immunohistochemical localization of parathyroid hormone/parathyroid hormone-related peptide receptor in rat tibiae. J Bone Miner Metab 14:10–14[CrossRef]
  23. Rouleau MF, Warshawsky H, Goltzman DG 1986 Parathyroid hormone binding in vivo to renal, hepatic and skeletal tissues of the rat using a radioautographic approach. Endocrinology 118:919–931[Abstract/Free Full Text]
  24. Martin KJ, Hrushka KA, Freitag JJ, Klahr S, Slatopolsky E 1979 The peripheral metabolism of parathyroid hormone. N Engl J Med 301:1092–1097[Medline]
  25. Kaufman M, Muff R, Steiger B, Biber J, Murer H, Fisher JA 1994 Apical and basolateral parathyroid hormone receptor in rat cortical membranes. Endocrinology 134:1173–1178[Abstract/Free Full Text]
  26. Soifer NE, Van Why SK, Ganz MB, Kashgarian M, Siegel NJ, Stewart AF 1993 Expression of parathyroid hormone-related protein in the rat glomerulus and tubule during recovery from renal ischemia. J Clin Invest 92:2850–2857
  27. Muff R, Fischer JA, Biber J, Murer H 1992 Parathyroid hormone receptors in control of proximal tubule function. Annu Rev Physiol 54:67–79[CrossRef][Medline]
  28. Alpern RJ 1990 Cell mechanisms of proximal tubule acidification. Physiol Rev 70:79–114[Free Full Text]
  29. Suki WN, Rouse D 1979 Heterogeneity of calcium transport in the medullary and cortical thick ascending limb of Henle. Kidney Int 16:840–846
  30. Backsai BJ, Friedman PA 1995 Activation of latent calcium channels in renal epithelial cells by parathyroid hormone. Nature 347:388–391
  31. Morel F, Imbert-Teboul M, Chabardes D 1981 Distribution of hormone-dependent adenylate cyclase in the nephron and its physiological significance. Annu Rev Physiol 43:569–585[CrossRef][Medline]
  32. Sraer J, Sraer JD, Chansel D, , Hesch D, Ardaillou R 1978 Evidence for glomerular receptors for parathyroid hormone. Am J Physiol 235:F96–F103
  33. Sraer J, Ardaillou R, Loreau N, Sraer JD 1978 Evidence for parathyroid hormone-sensitive adenylate cyclase in rat glomeruli 1974. Mol Cell Endocrinol 1:285–294
  34. Schorr N, Ichikawa I, Brenner BM 1981 Mechanisms of action of various hormones and vasoactive substances on glomerular ultrafiltration in the rat. Kidney Int 20:442–451[Medline]
  35. Rocacusachs A, DiPette DJ, Nichols GA 1991 Regional and synthetic effects of parathyroid hormone-related protein - preservation of cardiac function and coronary and renal flow with reduced blood pressure. J Pharmacol Exp Ther 256:110–118[Abstract/Free Full Text]
  36. Hongo T, Kupfer J, Enomoto H, Sharifi B, Giannella-Neto D, Forrester JS, Singer FR, Goltzman D, Hendy GN, Pirola C, Fagin JA, Clemens TL 1991 Abundant expression of parathyroid hormone-related protein in primary rat aortic smooth muscle cells accompanies serum-induced proliferation. J Clin Invest 6:1841–1847
  37. Winquist RJ, Baskin EP, Vlasuk GP 1987 Synthetic tumor-derived human hypercalcemic factor exhibits parathyroid hormone like vasal relaxation in renal arteries. Biochem Biophys Res Commun 149:227–232[CrossRef][Medline]
  38. Nichols GA, Nichols MA, Helwig JJ 1990 Binding of parathyroid hormone and parathyroid hormone-related peptide to vascular smooth muscle of rabbit renal microvessels. Endocrinology 126:721–727[Abstract/Free Full Text]
  39. Simeoni U, Massfelder T, Saussine C, Judes C, Geisert J, Helwig JJ 1994 Involvement of nitric oxide in the vasodilatory response to parathyroid hormone-related peptide in the isolated rabbit kidney. Clin Sci 86:245–249[Medline]
  40. Nichols GA, Metz MA, Cline Jr WH 1986 Endothelium-independent linkage of parathyroid hormone receptors of rat vascular tissue with increased adenosine 3' 5'-monophosphate and relaxation of vascular smooth muscle. Endocrinology 119:349–356[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
M. J. Mahon
The Parathyroid Hormone 1 Receptor Directly Binds to the FERM Domain of Ezrin, an Interaction that Supports Apical Receptor Localization and Signaling in LLC-PK1 Cells
Mol. Endocrinol., October 1, 2009; 23(10): 1691 - 1701.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. J. Mahon
Ezrin promotes functional expression and parathyroid hormone-mediated regulation of the sodium-phosphate cotransporter 2a in LLC-PK1 cells
Am J Physiol Renal Physiol, March 1, 2008; 294(3): F667 - F675.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. Rashid, J. Bernheim, J. Green, and S. Benchetrit
Parathyroid hormone stimulates the endothelial nitric oxide synthase through protein kinase A and C pathways
Nephrol. Dial. Transplant., October 1, 2007; 22(10): 2831 - 2837.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Mahon and G. V. Segre
Stimulation by Parathyroid Hormone of a NHERF-1-assembled Complex Consisting of the Parathyroid Hormone I Receptor, Phospholipase C{beta}, and Actin Increases Intracellular Calcium in Opossum Kidney Cells
J. Biol. Chem., May 28, 2004; 279(22): 23550 - 23558.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Ba, D. Brown, and P. A. Friedman
Calcium-sensing receptor regulation of PTH-inhibitable proximal tubule phosphate transport
Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1233 - F1243.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
M. Minagawa, M. Y. Kwan, J. D. Bettoun, F. W. Mansour, J. Dassa, G. N. Hendy, D. Goltzman, and J. H. White
Dissection of Differentially Regulated (G+C)-Rich Promoters of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene
Endocrinology, July 1, 2000; 141(7): 2410 - 2421.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Mannstadt, H. Juppner, and T. J. Gardella
Receptors for PTH and PTHrP: their biological importance and functional properties
Am J Physiol Renal Physiol, November 1, 1999; 277(5): F665 - F675.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Murer, I. Forster, N. Hernando, G. Lambert, M. Traebert, and J. Biber
Posttranscriptional regulation of the proximal tubule NaPi-II transporter in response to PTH and dietary Pi
Am J Physiol Renal Physiol, November 1, 1999; 277(5): F676 - F684.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Karperien, H. Farih-Sips, J. A.A. Hendriks, B. Lanske, S. E. Papapoulos, A.-B. Abou-Samra, C. W.G.M. Löwik, and L. H.K. Defize
Identification of a Retinoic Acid-Inducible Element in the Murine PTH/PTHrP (Parathyroid Hormone/Parathyroid Hormone-Related Peptide) Receptor Gene
Mol. Endocrinol., July 1, 1999; 13(7): 1183 - 1196.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
C. Jagger, A. Gallagher, T. Chambers, and M. Pondel
The Porcine Calcitonin Receptor Promoter Directs Expression of a Linked Reporter Gene in a Tissue and Developmental Specific Manner in Transgenic Mice
Endocrinology, January 1, 1999; 140(1): 492 - 499.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amizuka, N.
Right arrow Articles by Goltzman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amizuka, N.
Right arrow Articles by Goltzman, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals