Endocrinology Vol. 138, No. 1 469-481
Copyright © 1997 by The Endocrine Society
Cell-Specific Expression of the Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene in Kidney from Kidney-Specific and Ubiquitous Promoters1
N. Amizuka2,
H. S. Lee,
M. Y. Kwan,
A. Arazani,
H. Warshawsky,
G. N. Hendy2,
H. Ozawa,
J. H. White2 and
D. Goltzman
Department of Medicine (N.A., A.A., G.N.H., D.G.) and Physiology
(H.S.L., M.Y.K., G.N.H., J.H.W., D.G.), and Anatomy and Cell Biology
(H.W.), McGill University, and Calcium Research Laboratory (N.A., A.A.,
G.N.H., D.G.), Royal Victoria Hospital, Montreal, Quebec H3G 1Y6,
Canada; and the Department of Oral Anatomy (N.A., H.O.), Niigata
University School of Dentistry, 5274, 2-Bancho Gakkoucho-Dori, Niigata,
951 Japan
Address all correspondence and requests for reprints to: J. H. White, Department of Physiology, McIntyre Medical Sciences Building, Room 1109, McGill University, 3655 Drummond Street, Quebec H3G 1Y6, Canada. E-mail: jwhite{at}physio.mcgill.ca
 |
Abstract
|
|---|
The kidney is the major site of expression of the PTH/PTH-related
peptide receptor (PTHR) gene. Previously we have shown that the PTHR
gene is expressed from two promoters in kidney, an upstream
kidney-specific promoter (P1) and a downstream promoter (P2) that is
active in a wide variety of tissues. Here, we have used
immunohistochemical and transcript-specific in situ
hybridization techniques to map the expression of the PTHR gene and
protein and to determine the distribution of P1- and P2-driven
messenger RNAs in renal tissue. Immunohistochemical and immunoelectron
microscopic analysis showed that PTHR protein is expressed on both
basolateral and luminal membranes of proximal tubular epithelial cells,
strongly suggesting a bipolar mode of action of PTH. Receptor protein
also was detected on the surface of glomerular podocytes. Strikingly,
immunoelectron microscopic analysis showed that endothelial cells of
the peritubular vasculature, but not the glomerular vasculature,
contain high levels of PTHR protein. We found that both P1 and P2 are
expressed at moderate levels in both cortical and medullary epithelial
cells of nephrons, correlating well with the immunohistochemical
localization of PTHR protein. However, although abundant transcripts
were detected in peritubular endothelial cells with P1-specific and
coding sequence probes, P2-specific expression was not observed in
these cells. These results provide evidence that the physiological
effects of PTH- and/or PTH-related peptide on renal tubular function
may be mediated not only through direct effects on epithelial cells but
also indirectly through endothelial cell-based signaling. In addition
to expression in vascular endothelial cells, high levels of
P1-specific, but not P2-specific, PTHR messenger RNA were detected in
vascular smooth muscle. Taken together, these experiments provide
evidence for strong PTHR gene expression in renal vascular tissues.
Moreover, given that previous studies have shown that P2, but not P1,
is active in other tissues with an abundant vasculature, our results
suggest that regulation of PTHR gene expression in renal vascular
tissue is distinct from that of other organs.
 |
Introduction
|
|---|
PTH influences the fluxes of calcium,
phosphate, and hydrogen ions in the kidney and modulates the activity
of 25-hydroxyvitamin D 1
-hydroxylase (1). PTH enhances calcium
reabsorption in the renal distal convoluted tubule and inhibits
phosphate and bicarbonate uptake in the proximal convoluted tubule.
PTH-related peptide (PTHrP), originally described as the major mediator
of hypercalcemia associated with a variety of malignancies (2), can
mimic many of the effects of PTH when overproduced by cancers. Under
physiological conditions, PTHrP is thought to act in a
paracrine/autocrine mode, in contrast to PTH. Moreover, whereas PTH
expression is restricted to the parathyroids, PTHrP is widely expressed
and functions to modulate normal cellular growth and differentiation
(3, 4, 5, 6). The most striking evidence for a physiological role for PTHrP
has come from gene ablation experiments in mice that have shown that
PTHrP is essential for normal endochondral ossification (7, 8, 9). In the
adult, PTHrP also has been shown to act as a relaxant of smooth muscle,
including vascular smooth muscle (10).
Unlike the C-terminal portions of PTH and PTHrP, the N-terminal 34
amino acids of the two hormones are partially conserved and have been
postulated to form similar helix-turn-helix structures (11). The
spectrum of actions common to PTH and PTHrP emanates from the capacity
of the conserved N-terminal region of each hormone to interact with the
same guanylyl-nucleotide binding (G) protein-coupled receptor. The
complementary DNA (cDNA) and gene encoding the PTH/PTHrP receptor
(PTHR) have been cloned, and like PTHrP, the PTHR is widely expressed
(12).
Recently, a second PTH receptor (PTH2), with only 20% homology to
PTHR, has been cloned. PTH2 is mainly localized to brain and, to some
extent, in pancreas, testes, and placenta but not in kidney (13). This
receptor seems to bind PTH with much higher affinity than PTHrP.
The mouse gene encoding the PTHR is composed of at least 17 exons, and
its expression is regulated by at least two promoters (14, 15).
These promoters give rise to two transcripts differing in their 5'
untranslated sequences but not their coding regions. Transcripts
expressed from the upstream promoter (P1) contain sequences derived
from two 5' untranslated region exons U1 and U2. Expression of P1 is
largely restricted to kidney although weak expression is detected in
liver (15). The downstream mouse promoter (iP2) is very (G+C)-rich and
is widely expressed (15). P2-specific transcripts contain 5'
untranslated sequences derived from exon U3. RNase protection assays
have suggested that P1 activity accounts for 8090% of PTHR
transcripts detected in the mouse kidney. Recently, the 5' end of the
highly conserved rat PTHR gene has been found to have a very similar
exonic structure and pattern of transcript expression (16). cDNAs have
been isolated from human kidney cDNA libraries that contain sequences
74% similar to mouse exons U1 and U2, suggesting that the structure of
the 5' end of the PTHR gene also is conserved in humans (17).
The combined length of exons U1 and U2 is very similar to that of U3
(15), which accounts for the detection in most tissues of a single
messenger RNA (mRNA) of 2.3 kilobase pairs (kb) (18, 19). However,
larger and smaller mRNA species have been detected with PTHR cDNA
probes in rat kidney, liver, brain, skin, and testes (18, 19). In
addition, a receptor with different intracellular signaling properties
has been detected in normal keratinocytes and malignant squamous cells
(20). Whether these species represent distinct gene products or
alternatively spliced forms of the PTHR remains to be determined.
The PTHR is most highly expressed in the kidney, where its action is
essential for ion homeostasis. We are interested in analyzing the
regulation of expression of the receptor in the kidney. Although our
previous studies suggested renal PTHR expression was driven largely by
the P1 promoter, gene transfer experiments presented below suggested
that P2 also is active in renal epithelial cell lines. We have
therefore examined the localization of PTHR protein and P1- and
P2-derived mRNAs in the different tissues in the kidney by
immunocytochemistry and in situ hybridization using
transcript-specific probes. Our results demonstrate that both P1 and P2
are expressed in epithelial cells of the nephron and provide evidence
for strong PTHR gene expression driven exclusively by P1 in renal
vasculature.
 |
Materials and Methods
|
|---|
Plasmids
Probes for in situ hybridization and Northern
blot analyses were derived from plasmids pU1/U2 and pU3/170 and the rat
PTHR cDNA (21). pU1/U2, composed of 220 bp of cDNA sequence within
exons U1 and U2, was constructed by inserting a PCR fragment amplified
from 5' RACE clone 34 (15) using the 5' primer
(GCTCTAGACCACCAGCTGTGTCCTTG) and 3' primer (CCGCTCGAGCAATTGTGTGTCCTGCC)
into pBluescript SK digested with XbaI and XhoI.
pU3/170 was constructed by PCR amplification of 170 nucleotides of exon
U3 using plasmid pU3A/X (15), the 5' primer (GCTCTAGAGCAGCAGACGCCGAG),
and the T7 promoter, oligonucleotide, as 3' primer. The PCR product was
digested with ApaI and XbaI and inserted into the
respective sites in pBluescript SK+. Plasmid KS-rPTHrec4-1
is as described in Pausova et al. (19). The plasmids
pP1-2300/luc, which contains only P1 promoter sequences, and pP2-656
and pP2-1473/luc were constructed by inserting 2.3 kb
BamHI-PvuII, 0.8 kb
PvuII-BamHI, and 1.6 kb
KpnI-BamHI fragments, respectively, into the
polylinker region of the promoterless luciferase expression vector pXP2
(15).
Northern analysis
Northern hybridizations were performed essentially as
described (21). Briefly, 2030 µg of mouse kidney total RNA was
resolved on 1% agarose formaldehyde gel and blotted onto nylon
membrane (Amersham, Oakville, Ontario, Canada). Prehybridization and
hybridization were carried out in 6 x SSC, 5 x Denhardts,
1% SDS, 100 µg/ml salmon sperm DNA, and 10% dextran sulfate at 65
C. 32P-labeled probes were synthesized by random primed
labeling of DNA fragments excised from plasmids pU1/U2
(XbaI/XhoI), pU3/170
(ApaI/XbaI), and KS-rPTHrec4-1
(AccI/HindIII; 171 bp of coding sequence encompassing
transmembrane region a.a. 387427).
Cell culture and lipofections
Renal epithelial cell lines Madin-Darby canine kidney, mouse
distal convoluted tubule (a generous gift of Dr. P. Friedman,
Dartmouth, NH), and opossum kidney OK cells were cultured in DMEM/F12
media (GIBCO, Burlington, Ontario, Canada) supplemented with 50 U/ml
each of penicillin and streptomycin and 10% FBS (GIBCO). Cells were
transfected by lipofection using Lipofectin (GIBCO), according to the
manufacturers instructions, with 1 µg of ß-galactosidase
expression vector p610AZ (15) and 2 µg of PTHR promoter recombinants.
Transfection efficiencies for a given cell type varied by ± 20%.
Cells were harvested in 300 µl Reporter Lysis Buffer (Promega,
Madison, WI) and 30 µl used for ß-galactosidase assays (to
normalize for transfection efficiency) and for luciferase assays
(Promega).
Immunohistochemistry for the PTHR
For the PTH receptor immunohistochemistry, 7- to 8-week-old male
ddY mice (Japan SLC Inc., Hamamatsu, Japan) were anesthetized with
nembutal and perfused through the left ventricle with 4%
paraformaldehyde diluted in 0.1 M phosphate buffer (pH
7.4). The kidneys were extracted and immersed in the same fixative for
6 h at 4 C. Some specimens were dehydrated with an increasing
concentration of ethanol before paraffin imbedding, and the others were
immersed in a series of ascending concentrations from 525% sucrose
in PBS. Paraffin or frozen cryostat sections of approximately 8 µm
thickness were collected on poly-L-lysine-coated glass slides.
Rabbit polyclonal antisera were raised against epitopes in the
N-terminal extracellular domain of the rat PTHR. Antiserum no.
IK-XXI-89 was directed against amino acids 85105
(GKFYPESKENKDVPTGSRRRG), which is 100% conserved in the mouse (14).
This antibody recognizes the PTHR specifically as judged by Western
analysis (22) and has been used previously to detect PTHR expression in
rat tibiae (22). The dewaxed paraffin sections were pretreated with
0.3% H2O2 in PBS for 10 min at room
temperature to inhibit endogenous peroxidase activity and subsequently
treated with 1% BSA in PBS (BSA-PBS) for 30 min at room temperature.
They were incubated with no. IK-XXI-89 at a dilution of 1:100 in 1%
BSA-PBS overnight at 4 C. After rinsing with PBS, the sections were
incubated with horseradish peroxidase-conjugated goat f(ab')2
fragment-antirabbit IgG (Calbiochem, San Diego, CA) at a dilution of
1:100 with 1% BSA-PBS for 60 min at room temperature. Visualization
for the immunohistochemistry was performed using diaminobenzidine as a
substrate. The specificity of signals obtained by immunohistochemistry
were confirmed using nonimmune serum, which gave no signal on paraffin
sections of mouse kidney cortex or medulla. As a further index of
specificity, immunocytochemistry was performed on Chinese hamster ovary
(CHO) cells transiently transfected with PTHR cDNA by the calcium
phosphate technique (Fig. 1
). Untransfected CHO cells
served as a negative control. A specific signal was seen only in cells
expressing the PTHR using anti-PTHR antiserum. No specific signal was
observed in immunocytochemical experiments performed with transfected
cells or tissues in the absence of anti-PTHR antiserum.

View larger version (112K):
[in this window]
[in a new window]
|
Figure 1. Immunocytochemical analysis of PTHR expression in
transiently transfected CHO-1 cells using an antirat PTHR antibody.
Untransfected control CHO-1 cells (A) and CHO-1 cells transiently
transfected with a rat PTHR expression vector (B) were tested with an
antirat PTHR polyclonal antibody raised against a peptide derived from
sequences within the receptor extracellular domain. Immunopositivity is
seen on the surface of transfected cells brown color
(arrows) but not on untransfected controls.
Magnification, A and B x300.
|
|
Cryostat sections (8 µm thick) were collected on poly-L-lysine glass
slides for immunoelectron microscopy. Sections were incubated with
anti-PTHR antibodies as described above. After visualization of
immunoreactivity with horseradish peroxide, specimens were fixed with
4% glutaraldehyde diluted in phosphate buffer (pH 7.4) for 6 h at
room temperature and then were post fixed with OsO4 for 23 h.
Sections were dehydrated with an ascending concentration of acetone and
embedded in Polybed 812 (Polyscience Inc., Warrington, PA). Thin
sections were observed under transmission electron microscopy
(JEM-1001CXII, Jeol, Tokyo, Japan).
In situ hybridization
Sprague Dawley rats were anesthetized with nembutal, and kidneys
were extracted immediately and immersed in liquid nitrogen. Frozen
sections of the kidneys were collected on poly-L-lysine-coated glass
slides (Polyscience Inc.). Sections were subsequently treated with 4%
paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for
1520 min. and then with proteinase K (10 µg/ml) in 10
mM Tris-HCl (pH 8.0) at 37 C for 35 min. Acetylation of
sections was performed by incubation for 10 min. with 0.25% acetic
anhydride in 0.1 M triethanolamine (pH 8.0). cRNA probes
were prepared with digoxigenin-labeled UTP (Boehringer Mannhein
Biochemical, Mannheim, Germany). Sense and antisense cRNA probes for
the rat PTHR were obtained from cloned cDNA plasmid KS-rPTHrec4-1 using
T7 and SP6 RNA polymerases, respectively.
For hybridizations, hybridization buffer [50% formamide, 10
mM Tris-HCl (pH 7.6), 100 µg transfer RNA, 1 x
Denhardts solution, 10% dextran sulfate, 600 mM NaCl,
0.25% SDS, and 1 mM EDTA] was preheated for 10 min at 90
C. Each cRNA probe was adjusted to a concentration of 0.11.0 µg/ml.
Hybridization was performed overnight at 50 C, and then sections were
washed with 50% formamide in 2 x SSC at 55 C for 30 min and
treated at 37 C with a solution of 10 mM Tris-HCl (pH 8.0),
0.5 M NaCl, and 1 mM EDTA. Nonspecific binding
of probes was reduced by RNase A treatment [20 µg/ml in 10
mM Tris (pH 7.5), 1 mM EDTA, 500 mM
NaCl] at 37 C for 30 min. For immunodetection of digoxigenin-labeled
probes, sections were preincubated with 2% blocking agent and
incubated for 4560 min with alkaline phosphatase-conjugated sheep
antidigoxigenin antibody at a dilution of 1:1000. Visualization was
performed using nitroblue tetrazolium salt and
5-bromo-4-chloro-3-indolylphosphate. Sense cRNA probes were employed to
verify the specificity of hybridization conditions.
 |
Results
|
|---|
Detection of PTHR protein on basolateral and luminal surfaces of
epithelial cells of renal cortical tubules and in vascular endothelial
cells
In renal cortical tissue, strong PTHR immunoreactivity was
detected clearly by immunohistochemistry on the basolateral membranes
of tubules (Fig. 2A
). In addition, immunoreactivity was
detected on the luminal surfaces of some tubules (Fig. 2A
). In
contrast, only weak immunoreactivity was detected under the same
conditions in glomeruli. No specific signal was observed using
nonimmune serum (Fig. 2B
). The distribution of PTHR protein in the
cortex was further investigated by immunoelectron microscopy. PTHR
protein was detected on basolateral membranes and, to a lesser extent,
on the luminal surface of epithelial cells of proximal convoluted
tubule cells (Fig. 3
), confirming the results obtained
by light microscopy. Immunopositivity also was seen in vesicles
adjacent to the luminal membrane (Fig. 3B
). Strikingly, we also
observed high levels of expression of PTHR protein on the thin walls of
endothelial cells of the cortical capillaries (Fig. 3
, A, C, and D).
This immunopositivity was severalfold more intense than that observed
on basolateral membranes of adjacent epithelial cells. We also detected
expression of PTHR protein on the surface of glomerular podocytes (Fig. 4
), consistent with our previous findings (23), whereas
no PTHR expression was detected in vascular endothelial cells in
glomeruli.

View larger version (133K):
[in this window]
[in a new window]
|
Figure 2. Immunohistochemical analysis of PTHR expression in
the renal cortex. A, In the light micrograph positive reactivity is
seen as brown staining along basolateral cell surfaces
of renal tubules (arrowheads). Luminal membranes of some
tubules also stain positively (arrows). B, No
immunoreactivity was observed when nonimmune rabbit serum was employed
on paraffin sections of mouse kidney cortex. Sections were faintly
counterstained by methyl green. Magnification, x700.
|
|

View larger version (123K):
[in this window]
[in a new window]
|
Figure 3. Immunolocalization of the PTHR on membranes of
cortical epithelial cells and adjacent endothelial cells by electron
microscopy. A, Electron micrograph of a proximal tubule epithelial cell
(Epi) and the thin wall of a vascular endothelial cell lining the
adjacent blood vessel (BV). Identification of proximal convoluted
tubule cells was made by virtue of the presence of well-developed brush
borders on the luminal membrane and an abundance of basal mitochondria.
PTHR immunoreactivity (black color) is seen on the
luminal and basolateral surfaces of the epithelial cell
(arrows) and on the endothelial cell
(arrowheads). Magnification, x5,500. B, Higher
magnification image of the luminal region of a proximal tubule
epithelial cell showing PTHR immunoreactivity on the luminal membrane
(arrows) and in adjacent vesicles (V). Magnification,
x24,000. C, Higher magnification of the basal region of an epithelial
cell (Epi). The basement membrane and blood vessel are indicated by BM
and BV, respectively. Basolateral membrane and endothelial cell PTHR
immunopositivity are indicated by arrows and
arrowheads, respectively. Magnification, x17,000. D,
Similar to C, but including the cell body of an endothelial cell (En).
Magnification, x9,500.
|
|

View larger version (112K):
[in this window]
[in a new window]
|
Figure 4. Immunoelectron micrograph of a renal corpuscle.
Immunoreactivity of the PTHR on the plasma membrane of a glomerular
podocyte (P) is indicated by arrowheads. Adjacent
glomerular blood vessels (BV) are not immunopositive. Magnification,
x6,200.
|
|
PTHR protein expression in the renal medulla
In the renal medulla, moderate immunoreactivity, specific for the
PTHR, was detected in the collecting ducts (Fig. 5
).
These results are consistent with previous radioautographic detection
of specific binding of PTH to this site of the nephron (23). Having
examined the distribution of expression of PTHR protein in renal
tissues, we were interested next in determining the distribution of the
different species of PTHR mRNA expressed in the kidney

View larger version (155K):
[in this window]
[in a new window]
|
Figure 5. Light microscopic immunohistochemical analysis of
PTHR protein expression in the mouse renal medulla. Longitudinal (A)
and cross- (B) sections in the medulla show PTHR-immunopositivity on
cell surfaces of collecting ducts (arrows). Longitudinal
(C) or cross- (D) sections of the medulla were treated with nonimmune
rabbit serum, resulting in no immunoreaction. Magnification, x250.
|
|
Analysis of renal PTHR gene expression: mRNAs transcribed from
promoters P1 and P2
The kidney-specific promoter P1 and the ubiquitous promoter P2 are
both expressed in the kidney. Previous RNase protection assays have
suggested that P1-specific transcription drives the expression of the
large majority of PTHR mRNAs in kidney (15). However, this type of
analysis does not provide any information as to the lengths and, hence,
downstream splicing patterns of the mRNAs or whether the combined
activity of P1 and P2 accounts for all of the renal PTHR gene
transcription. Renal PTHR mRNAs were therefore characterized by
Northern analysis using a coding region probe along with probes
specific to transcripts derived from P1 and P2 (Fig. 6A
). The coding region probe detects a predominant band
of approximately 2.3 kb (Fig. 6B
, lane C) (18, 19). P1- and P2-specific
probes recognize distinct 5' untranslated regions but detect major
transcripts indistinguishable in size from those identified with the
coding region probe (Fig. 6B
, lanes P1 and P2). These results are
consistent with the large majority of transcripts derived from P1 and
P2, differing in their 5' untranslated regions but not in their coding
sequence (14, 15), although we cannot rule out the possibility of
alternative splicing of the coding region of the gene.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 6. Promoter-specific transcription of the PTHR gene
in kidney. A, Top; structure of the 5' untranslated
region of the mouse PTHR gene. The previously characterized (14, 15) P1
and P2 promoters are indicated. The three 5'untranslated region exons
(U1U3) and the exon containing the signal sequence (SS) are
indicated. Splicing patterns of the gene are indicated up to exon E1.
Below; promoter-specific probes used for Northern
analysis and in situ hybridization (see Materials
and Methods). B and C, Northern analysis of PTHR transcripts in
kidney in part B and heart in part C using coding region (C) and
promoter-specific probes (P1 and P2). In each case, identical aliquots
of total mouse RNA were loaded on three different lanes of a 1%
agarose gel and probed separately.
|
|
The proportions of P1- and P2- specific mRNAs detected by Northern
analysis are in close agreement with previous RNase protection studies
(15) and are consistent with P1 being the major PTHR gene promoter in
kidney. The signal obtained with the coding region probe was
approximately equivalent to the combined signals obtained with the
promoter-specific probes (Fig. 6B
), suggesting that the P1 and P2
promoters account for the large majority of PTHR gene transcription in
the kidney. In contrast to the expression pattern in kidney, Northern
analysis of PTHR transcripts in heart (Fig. 6C
) did not detect any
P1-specific transcripts, whereas the P2-specific probe detected a
2.3-kb band of similar intensity to that seen with the coding sequence
probe. These results serve as an important control by inferring that
the relatively weak expression of P2-specific transcripts seen in
kidney was not caused by inefficient hybridization of the probe.
The relatively high levels of renal expression of the P1 promoter are
striking, given the results of a series of gene transfer experiments
performed in the renal epithelial cell lines OK, mouse distal
convoluted tubule, and Madin-Darby canine kidney using P1- and
P2-promoter-luciferase constructs (Table 1
). These
experiments suggested that the P2 promoter showed comparable or greater
activity than P1 sequences. Similar results were obtained in
transiently transfected OK cells with P1 and P2 promoter recombinants
containing 5.7 and 6 kb of flanking sequence, respectively (data not
shown). The apparent discrepancy between the relative expression of P1-
and P2-specific transcripts in total kidney detected by Northern
analysis and the relative activities of our reporter constructs in
epithelial cells indicated that it was important to determine the
expression patterns of the two promoters in different renal tissues
before undertaking comprehensive promoter analyses.
Tissue-specific distribution of P1- and P2-specific PTHR
transcripts in glomeruli, cortical tubules, and vascular endothelial
cells
The expression of PTHR transcripts in rat cortical tubules and
glomeruli was analyzed by in situ hybridization using
digoxigenin-labeled antisense probes recognizing coding region, P1- or
P2-specific sequences (see Fig. 6
). Intense hybridization signals
specific for the PTHR coding region were observed in epithelial cells
of cortical tubules (Fig. 7
, A and D). Consistent with
observation of PTHR protein in glomeruli (Fig. 4
), coding
sequence-specific hybridization also was observed in some, but not all,
cells in glomeruli (Fig. 7A
). A very similar pattern of expression was
detected with P1-specific sequences. Extensive hybridization was
detected in cortical epithelial cells (Fig. 7
, B and E) along with
focal hybridization in glomeruli (Fig. 7B
). In addition, we observed
intense hybridization in capillary endothelial cells located adjacent
to tubules with both coding region and P1 probes (Fig. 7
, D and E). No
specific signals were observed with sense probes corresponding to
coding region-specific and P1-specific sequences (Fig. 7
, G and H).
These results are consistent with the abundance of PTHR protein
observed in endothelial cells lining cortical capillaries (Fig. 4
).

View larger version (186K):
[in this window]
[in a new window]
|
Figure 7. In situ hybridization,
demonstrating expression of P1- and P2-specific transcripts and of the
PTHR coding region in renal cortex. AC, Light micrographs of outer
cortex (including glomeruli); DF, light micrographs of inner cortex
(closer to the medulla); A, Expression of PTHR coding region sequences
(brown color) is widespread in cortical epithelial cells
(E) and in some cells of the glomeruli (G, arrows denote
hybridization), B, Expression of P1-specific sequences shows a similar
distribution, i.e. widespread in tubular epithelial
cells (E) and focal expression in glomeruli (G, indicated by
arrows). Endothelial cells (arrowheads)
show intense expression of P1-specific transcripts. C, Expression of
P2-specific transcripts (faint brown color) can be seen
in renal cortical epithelial cells but not glomeruli. D, In
situ hybridization, revealing moderate-to-strong reaction with
coding region sequences in endothelial cells of the microvasculature
(arrowheads) and weaker, generalized reaction in
epithelial cells. E, similar to D, except sections were probed with P1
specific sequences. Expression in endothelial cells is indicated by
arrowheads. F, Similar to D, except performed with a
P2-specific probe. Note lack of expression in endothelial cells. GI,
As controls, in situ hybridizations employing sense cRNA
probes obtained from coding sequence, exons U1/U2 (promoter
P1-specific), and U3 (promoter P2-specific) are shown in G, H, and I,
respectively. No hybridization signal was seen in any of these
sections. All sections were faintly counterstained with methyl green.
Magnification, AI x650.
|
|
Expression of P2 in the cortex is more restricted. A P2-specific
antisense probe, but not a sense probe, detected expression in
epithelial cells (Fig. 7
, C, F, and I). No (or only weak) expression of
P2-specific transcripts was detected with an antisense probe in
glomeruli (Fig. 7C
), and no P2-specific expression was seen in vascular
endothelial cells (Fig. 7
, C and F; and data not shown). This indicates
that expression of the PTHR gene in glomeruli and in vascular
endothelial cells is controlled exclusively by the kidney-specific P1
promoter.
Expression of PTHR transcripts in the medulla
We also analyzed expression of PTHR transcripts in longitudinal
and cross-sections taken from medulla. PTHR transcripts were detected
using a coding region probe in collecting ducts in longitudinal and
cross-sections of the medulla (Fig. 8
, A and C). A
similar expression pattern was observed in the medulla with a
P1-specific probe (Fig. 8
, B and D). Further evidence for PTHR
transcript expression in the renal medulla was seen at lower
magnification (Fig. 9
). Coding
sequence and P1-specific expression was clearly evident (Fig. 9
, A and
C), whereas P2-specific expression was virtually undetectable (Fig. 9E
). These results are consistent with immunohistochemical analyses
presented in Fig. 5
.

View larger version (158K):
[in this window]
[in a new window]
|
Figure 8. In situ hybridization study of
longitudinal (A and C) and cross- (B and D) sections of renal medulla
with PTHR gene coding region probe (A and B), and P1-specific probe (C
and D). Expression in collecting ducts is indicated by
arrows. Magnifications: A and B, x230; C and D,
x140.
|
|

View larger version (141K):
[in this window]
[in a new window]
|
Figure 9. Expression of PTHR transcripts
in whole kidney sections. A, Low power magnification (x26) of a
section of kidney showing intense coding sequence-specific staining
(dark brown) in the walls of medium-sized blood vessels
(framed area) and lighter staining in cortical and
medullary tubules; B, higher-power magnification (x250) of
framed area in A showing intense coding region-specific
staining in smooth muscle of the blood vessels; C and D, studies
similar to those shown in A and B using a P1-specific probe; E and F,
similar studies to those shown in A and B using a P2-specific probe.
Note the lack of staining in vascular smooth muscle.
|
|
Strong expression of P1-specific PTHR transcripts in renal vascular
smooth muscle
Given that PTH and PTHrP stimulate vascular smooth muscle
relaxation, it was of interest to examine PTHR expression in renal
vascular smooth muscle. A strong signal was seen in vascular smooth
muscle with coding region and P1-specific probes (Fig. 9
, AD). This
signal persisted even after washing sections under high stringency (not
shown). In contrast, no specific signal was observed with a P2-specific
probe (Fig. 9
, E and F), indicating that P2 expression is very low or
nonexistent in these cells. These results provide evidence for high
levels of P1-specific PTHR mRNA expression in renal vascular smooth
muscle.
 |
Discussion
|
|---|
The results of our immunohistochemical analyses are consistent
with a broad distribution of PTHR protein in cortical and medullary
epithelial cells and are in excellent agreement with the expression
pattern of the PTHR gene determined by in situ
hybridization. These results provide a molecular basis for specific and
competitive binding of PTH that occurs in cells of proximal and distal
tubules of the cortex and cortical thick ascending limb of the loop of
Henle and in collecting ducts (23). Moreover, our present in
situ hybridization analyses indicate that both kidney-specific
promoter P1 and ubiquitously active promoter P2 function to produce
PTHR mRNAs in these epithelial cells.
PTHR protein was detected on both the basolateral and luminal surfaces
of cortical epithelial cells by immunoelectron microscopy. The dual
delivery of circulating, bioactive PTH to the nephron by glomerular
filtration and by peritubular uptake, which might result in PTH action
on both brush border and basolateral membrane, has been previously
reported (24). Our demonstration of the bipolar distribution of PTHR
protein in proximal tubule cells, therefore, provides a structural
basis for such interactions, and for studies demonstrating PTH binding,
and PTH-stimulated adenylate cyclase on basolateral and brush border
surfaces (23, 25). It is possible that the receptors we identified on
the apical surface are bound by PTHrP that has translocated from the
cytoplasm to the subapical region after the induction of ischemia
(26).
PTH exerts pleiotropic effects in the renal tubule. Although the
precise distribution of the different functions of PTH may vary from
species to species, several approaches have localized PTH-mediated
inhibition of phosphate (27) and bicarbonate reabsorption (28) and
stimulation of 25 hydroxyvitamin D 1
hydroxylase activity to the
proximal tubule. PTH stimulation of calcium reabsorption has been
localized to the ascending limb of Henles loop (29) and to portions
of the distal tubule (30). Our studies, demonstrating the presence of
PTHR mRNA and protein along the nephron, correlate well with results
obtained with physiological approaches (31).
PTH binding in vivo (23) and in vitro (32) and
adenylate cyclase stimulation in vitro (33) have been
reported in glomeruli. In addition, PTH has been shown to influence
glomerular filtration in vivo (34). Our immunoelectron
microscopic analyses have detected PTHR protein on the surface of
podocytes, and our in situ hybridization studies
demonstrated expression of PTHR transcripts in selected cells in
glomeruli. Of special importance is the finding that PTHR expression in
these cells was derived from kidney-specific promoter P1 but not from
ubiquitous promoter P2.
Immunoelectron microscopic analyses detected high levels of PTHR
protein on endothelial cells of the peritubular vasculature. In
situ hybridization studies with promoter-specific probes showed
that this expression is controlled exclusively by the kidney-specific
P1 promoter of the PTHR gene. Moreover, P1, but not P2, is strongly
expressed in vascular smooth muscle of the kidney. These striking
observations indicate that high levels of PTHR are expressed in renal
vascular tissue, either in endothelial or smooth muscle cells. Both PTH
and PTHrP exert hypotensive effects mediated by their N-terminal
domains when they are infused in vivo, and both are believed
to directly interact with blood vessels (35). Abundant PTHrP expression
has been reported in rat aortic smooth muscle cells, which also respond
to the peptide, consistent with an autocrine/paracrine effect of PTHrP
on the vasculature (36). PTHrP also is known to be expressed in kidney
(26) and may therefore play an autoregulatory role as a renal
autocrine/paracrine factor. Thus, in the kidney, both PTH and PTHrP can
increase regional blood flow and/or decrease vascular resistance (35)
and can relax the renal artery in the preconstricted rat kidney (37).
Both hormones bind to vascular smooth muscle of rabbit renal
microvessels (38). Furthermore, both endothelium-dependent nitric
oxide-mediated vasodilatation (39) and endothelium-independent
cAMP-stimulated vasodilatation (40) have been implicated in the
mechanism of vascular action of PTH and PTHrP.
Our present studies documenting the presence of the PTHR in renal
endothelial cells and in vascular smooth muscle therefore provide a
molecular basis for the action of PTHrP and PTH in the renal
vasculature through stimulation of endothelium-related and
endothelium-independent events. It is also noteworthy that the
microvasculature has not been implicated in control of vascular
tension. This raises the possibility that the high levels of PTHR
expressed in the endothelium of peritubular capillaries may exert some
of the physiological effects of PTH on adjacent epithelial cells of the
nephron through endothelium-based signaling events.
Several studies have shown that the kidney is the major site of
expression of PTHR mRNA (15, 18). Our previous RNase protection
experiments indicated that activity of the PTHR P1 promoter is largely
restricted to kidney (15), and moreover, that P1 expression is
responsible for at least 90% of renal PTHR transcripts (Fig. 6
).
Nevertheless, P1 and P2 promoter sequences stimulated similar levels of
reporter gene expression in gene transfer experiments in several renal
epithelial cell lines (Table 1
). This apparent discrepancy was resolved
by our finding that P1-, but not P2-, specific transcripts were
detected in renal vascular endothelial and smooth muscle tissue. It is
noteworthy that P1 is only weakly active in liver, and its activity is
undetectable in heart (two organs with abundant vascular tissue),
whereas P2 is active in both tissues (15). Taken together, the above
results suggest that expression of PTHR in renal vasculature is
regulated differently from its expression in the vasculature of other
tissues. Therefore, further studies will be necessary to determine the
precise control of P1 in renal vs. extrarenal vascular
tissues and to examine the different regulatory signals modulating P1
and P2 expression in the kidney.
In summary, our immunohistochemical and in situ
hybridization studies have documented broad expression of the PTHR in
the kidney and emphasize the abundant expression of the receptor in
vascular tissues, particularly in peritubular capillary endothelial
cells. Promoter-specific in situ hybridization experiments
showed that both P1- and P2-specific PTHR transcripts are present in
epithelial cells of the nephron, whereas strong P1-specific expression
was found in the renal vasculature. Our results are consistent with the
PTHR being the predominant receptor for PTH in the kidney. Moreover,
they underline the importance of PTH signaling in the renal vasculature
through stimulation of events mediated by both endothelial and
nonendothelial cells.
 |
Acknowledgments
|
|---|
We are grateful to Asahi Kasei Industry for their support in
raising anti-PTHR antisera.
 |
Footnotes
|
|---|
1 This work was supported by Medical Research Council of Canada Grants
MT-12896 (to J.H.W.), MT-5775 (to D.G.), MT-9315 (to G.N.H.) and by a
grant from the National Cancer Institute (to D.G.) and from the Kidney
Foundation of Canada (to G.N.H.). 
2 N. Amizuka was the recipient of a Research Fellowship from the Royal
Victoria Hospital and currently is the recipient of a fellowship from
the Naito Foundation. G. N. Hendy is a Medical Research Council of
Canada Scientist. J. H. White is a chercheur-boursier of the Fonds de
Recherche en Santé du Québec. 
Received May 13, 1996.
 |
References
|
|---|
-
Goltzman D, Hendy GN 1995 Parathyroid hormone.
In: Becker KL (ed) Principles and Practice of Endocrinology and
Metabolism, ed 2. J. B. Lippincott Co., Philadelphia, pp 455467
-
Suva LJ, Winslow GA, Wettenhall REH, Hammonds RG,
Moseley JM, Diefenbach-Jagger H, Rodda CP, Kemp BE, Rodriguez H,
Chen EY, Hudson PJ, Martin TJ, Wood WI 1987 A parathyroid
hormone-related protein implicated in malignant hypercalcemia: cloning
and expression. Science 237:893896[Abstract/Free Full Text]
-
Ikeda K, Mangin M, Dreyer BE, Webb AC, Posillico JT,
Stewart AF, Bander NH, Weir EC, Insogna KL, Broadus AE 1988 Identification of transcripts encoding parathyroid hormone-like peptide
in messenger RNAs from a variety of human and animal tumors associated
with humoral hypercalcemia of malignancy. J Clin Invest 81:20102014
-
Strewler GD, Nissenson RA 1993 Parathyroid
hormone-related peptide. In: Favus MJ (ed) Primer on Metabolic Bone
Diseases and Disorders of Mineral Metabolism, ed. 2. Raven Press, New
York, pp 169173
-
Stewart AF 1993 Humoral hypercalcemia of
malignancy. In: Favus, MJ (ed) Primer on Metabolic Bone Diseases and
Disorders of Mineral Metabolism, ed 2. Raven Press, New York, pp
6163
-
Henderson J, Bernier S, DAmour P, Goltzman D 1990 Effects of passive immunization against parathyroid-hormone
(PTH)-like peptide and PTH in hypercalcemic tumor-bearing rats and
normocalcemic controls. Endocrinology 127:13101318[Abstract]
-
Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz
VLJ, Kronenberg HM, Mulligan RC 1994 Lethal skeletal dysplasia
from targeted disruption of the parathyroid hormone-related peptide
gene. Genes Dev 8:277289[Abstract/Free Full Text]
-
Amizuka N, Warshawsky H, Goltzman D, Karaplis AC 1994 Parathyroid hormone-related peptide-depleted mice show abnormal
epiphiseal cartilage development and altered endochondral bone
formation. J Cell Biol 126:16111623[Abstract/Free Full Text]
-
Amizuka N, Karaplis AC, Warshawsky H, Henderson JE,
Lipman ML, Matsuki Y, Ejiri S, Tanaka M, Izumi N, Ozawa H, Goltzman
D 1996 Haploinsufficiency of parathyroid hormone related peptide
(PTHrP) results in abnormal post-natal bone development. Dev Biol 175:166176[CrossRef][Medline]
-
Musso MJ, Plante M, Judes C, Bathelmebs M, Helwig
JJ 1989 Renal vasodilation and microvessel adenylated cyclase
stimulation by synthetic parathyroid hormone-like protein fragments.
Eur J Pharmacol 174:139151[CrossRef][Medline]
-
Cohen FE, Strewler GJ, Bradley MS, Carlquist M, Nilsson
M, Ericsson M, Ciardelli TL, Nissenson RA 1991 Analogs of
parathyroid hormone modified at positions 3 and 6. J Biol Chem 266:19972004[Abstract/Free Full Text]
-
Jüppner H, Abou-Samra A-B, Freeman M, Kong XF,
Schipani E, Richards J, Kolakowski LJ, Hock J, Potts JJ, Kronenberg HM,
Segre GV 1991 A G protein-linked receptor for parathyroid hormone
and parathyroid hormone-related peptide. Science 254:10241026[Abstract/Free Full Text]
-
Usdin TB, Gruber C, Bonner TI 1995 Identification
and functional expression of a receptor selectively recognizing
parathyroid hormone, the PTH2 receptor. J Biol Chem 270:1545515458[Abstract/Free Full Text]
-
McCuaig KA, Clarke JC, White JH 1994 Molecular
cloning of the gene encoding the mouse parathyroid hormone/parathyroid
hormone-related peptide receptor. Proc Nat Acad Sci USA 91:50515055[Abstract/Free Full Text]
-
McCuaig KA, Lee H, Clarke JC, Assar H, Horsford J, White
JH 1995 Parathyroid hormone/parathyroid hormone related peptide
receptor gene transcripts are expressed from tissue-specific and
ubiquitous promoters. Nucleic Acids Res 23:19481955[Abstract/Free Full Text]
-
Joun H, Lanske B, Abou-Samra AB 1995 Tissue-specific transcription-start site and 5' alternative splicing of
the PTH/PTHrP receptor (PPR) gene. J Bone Miner Res 10:S488
-
Adams AE, Pines M, Nakamoto C, Behar V,
Rashti-BehBessalle R, Chorev M Rosenblatt M, Levine MA, Suva LJ 1995 Probing the bimolecular interactions of parathyroid hormone and
the human parathyroid hormone/parathyroid hormone-related peptide
receptor. 2. Cloning, characterization and photoaffinity labeling of
the recombinant human receptor. Biochemistry 34:1055310559[CrossRef][Medline]
-
Urena P, Kong XF, Abou-Samra AB, Jüppner H,
Kronenberg HM, Potts Jr JT, Segre GV 1993 Parathyroid hormone
(PTH)/PTH-related peptide receptor messenger ribonucleic acids are
widely distributed in rat tissues. Endocrinology 133:617623[Abstract]
-
Pausova Z, Bourdon J, Clayton D, Mattei M-G, Seldin MF,
Janicic N, Riviére M, Szpirer J, Levan G, Szpirer C, Goltzman D,
Hendy GN 1994 Cloning of a parathyroid hormone/parathyroid
hormone-related peptide receptor (PTHR) cDNA from a rat osteosarcoma
(UMR 106) cell line: chromosomal assignment of gene in the human, mouse
and rat genomes. Genomics 20:2026[CrossRef][Medline]
-
Orloff JJ, Ganz MB, Ribaudo AE, Burtis WJ, Reiss M,
Milstone LM, Stewart AF 1992 Analysis of parathyroid
hormone-related protein binding and signal transduction mechanism in
benign and malignant squamous cells. Am J Physiol
262:E599E607
-
Sambrook J, Fritsch EF, Maniatis T 1989 Molecular
cloning. A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY, pp 7.397.52
-
Irie K, Ozawa H 1996 Immunohistochemical
localization of parathyroid hormone/parathyroid hormone-related peptide
receptor in rat tibiae. J Bone Miner Metab 14:1014[CrossRef]
-
Rouleau MF, Warshawsky H, Goltzman DG 1986 Parathyroid hormone binding in vivo to renal, hepatic and
skeletal tissues of the rat using a radioautographic approach.
Endocrinology 118:919931[Abstract]
-
Martin KJ, Hrushka KA, Freitag JJ, Klahr S, Slatopolsky
E 1979 The peripheral metabolism of parathyroid hormone. N
Engl J Med 301:10921097[Medline]
-
Kaufman M, Muff R, Steiger B, Biber J, Murer H, Fisher
JA 1994 Apical and basolateral parathyroid hormone receptor in rat
cortical membranes. Endocrinology 134:11731178[Abstract]
-
Soifer NE, Van Why SK, Ganz MB, Kashgarian M, Siegel NJ,
Stewart AF 1993 Expression of parathyroid hormone-related protein
in the rat glomerulus and tubule during recovery from renal ischemia.
J Clin Invest 92:28502857
-
Muff R, Fischer JA, Biber J, Murer H 1992 Parathyroid hormone receptors in control of proximal tubule function.
Annu Rev Physiol 54:6779[CrossRef][Medline]
-
Alpern RJ 1990 Cell mechanisms of proximal tubule
acidification. Physiol Rev 70:79114[Free Full Text]
-
Suki WN, Rouse D 1979 Heterogeneity of calcium
transport in the medullary and cortical thick ascending limb of Henle.
Kidney Int 16:840846
-
Backsai BJ, Friedman PA 1995 Activation of latent
calcium channels in renal epithelial cells by parathyroid hormone.
Nature 347:388391
-
Morel F, Imbert-Teboul M, Chabardes D 1981 Distribution of hormone-dependent adenylate cyclase in the nephron and
its physiological significance. Annu Rev Physiol 43:569585[CrossRef][Medline]
-
Sraer J, Sraer JD, Chansel D, , Hesch D, Ardaillou
R 1978 Evidence for glomerular receptors for parathyroid hormone.
Am J Physiol 235:F96F103
-
Sraer J, Ardaillou R, Loreau N, Sraer JD 1978 Evidence for parathyroid hormone-sensitive adenylate cyclase in rat
glomeruli 1974. Mol Cell Endocrinol 1:285294
-
Schorr N, Ichikawa I, Brenner BM 1981 Mechanisms of
action of various hormones and vasoactive substances on glomerular
ultrafiltration in the rat. Kidney Int 20:442451[Medline]
-
Rocacusachs A, DiPette DJ, Nichols GA 1991 Regional
and synthetic effects of parathyroid hormone-related protein -
preservation of cardiac function and coronary and renal flow with
reduced blood pressure. J Pharmacol Exp Ther 256:110118[Abstract/Free Full Text]
-
Hongo T, Kupfer J, Enomoto H, Sharifi B, Giannella-Neto
D, Forrester JS, Singer FR, Goltzman D, Hendy GN, Pirola C, Fagin JA,
Clemens TL 1991 Abundant expression of parathyroid hormone-related
protein in primary rat aortic smooth muscle cells accompanies
serum-induced proliferation. J Clin Invest 6:18411847
-
Winquist RJ, Baskin EP, Vlasuk GP 1987 Synthetic
tumor-derived human hypercalcemic factor exhibits parathyroid hormone
like vasal relaxation in renal arteries. Biochem Biophys Res Commun 149:227232[CrossRef][Medline]
-
Nichols GA, Nichols MA, Helwig JJ 1990 Binding of
parathyroid hormone and parathyroid hormone-related peptide to vascular
smooth muscle of rabbit renal microvessels. Endocrinology 126:721727[Abstract]
-
Simeoni U, Massfelder T, Saussine C, Judes C, Geisert J,
Helwig JJ 1994 Involvement of nitric oxide in the vasodilatory
response to parathyroid hormone-related peptide in the isolated rabbit
kidney. Clin Sci 86:245249[Medline]
-
Nichols GA, Metz MA, Cline Jr WH 1986 Endothelium-independent linkage of parathyroid hormone receptors of rat
vascular tissue with increased adenosine 3' 5'-monophosphate and
relaxation of vascular smooth muscle. Endocrinology 119:349356[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
M. J. Mahon
Ezrin promotes functional expression and parathyroid hormone-mediated regulation of the sodium-phosphate cotransporter 2a in LLC-PK1 cells
Am J Physiol Renal Physiol,
March 1, 2008;
294(3):
F667 - F675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Rashid, J. Bernheim, J. Green, and S. Benchetrit
Parathyroid hormone stimulates the endothelial nitric oxide synthase through protein kinase A and C pathways
Nephrol. Dial. Transplant.,
October 1, 2007;
22(10):
2831 - 2837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Mahon and G. V. Segre
Stimulation by Parathyroid Hormone of a NHERF-1-assembled Complex Consisting of the Parathyroid Hormone I Receptor, Phospholipase C{beta}, and Actin Increases Intracellular Calcium in Opossum Kidney Cells
J. Biol. Chem.,
May 28, 2004;
279(22):
23550 - 23558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ba, D. Brown, and P. A. Friedman
Calcium-sensing receptor regulation of PTH-inhibitable proximal tubule phosphate transport
Am J Physiol Renal Physiol,
December 1, 2003;
285(6):
F1233 - F1243.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Minagawa, M. Y. Kwan, J. D. Bettoun, F. W. Mansour, J. Dassa, G. N. Hendy, D. Goltzman, and J. H. White
Dissection of Differentially Regulated (G+C)-Rich Promoters of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene
Endocrinology,
July 1, 2000;
141(7):
2410 - 2421.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mannstadt, H. Juppner, and T. J. Gardella
Receptors for PTH and PTHrP: their biological importance and functional properties
Am J Physiol Renal Physiol,
November 1, 1999;
277(5):
F665 - F675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Murer, I. Forster, N. Hernando, G. Lambert, M. Traebert, and J. Biber
Posttranscriptional regulation of the proximal tubule NaPi-II transporter in response to PTH and dietary Pi
Am J Physiol Renal Physiol,
November 1, 1999;
277(5):
F676 - F684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Karperien, H. Farih-Sips, J. A.A. Hendriks, B. Lanske, S. E. Papapoulos, A.-B. Abou-Samra, C. W.G.M. Löwik, and L. H.K. Defize
Identification of a Retinoic Acid-Inducible Element in the Murine PTH/PTHrP (Parathyroid Hormone/Parathyroid Hormone-Related Peptide) Receptor Gene
Mol. Endocrinol.,
July 1, 1999;
13(7):
1183 - 1196.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Jagger, A. Gallagher, T. Chambers, and M. Pondel
The Porcine Calcitonin Receptor Promoter Directs Expression of a Linked Reporter Gene in a Tissue and Developmental Specific Manner in Transgenic Mice
Endocrinology,
January 1, 1999;
140(1):
492 - 499.
[Abstract]
[Full Text]
|
 |
|