Endocrinology Vol. 138, No. 10 4049-4057
Copyright © 1997 by The Endocrine Society
Sphingosine 1-Phosphate Mobilizes Sequestered Calcium, Activates Calcium Entry, and Stimulates Deoxyribonucleic Acid Synthesis in Thyroid FRTL-5 Cells1
Kid Törnquist,
Pia Saarinen,
Minna Vainio and
Mikael Ahlström
Department of Biosciences (K.T., P.S., M.V., M.A.), Division of
Animal Physiology, University of Helsinki, and the Minerva Foundation
Institute for Medical Research (K.T., P.S., M.V.), 00250 Helsinki,
Finland
Address all correspondence and requests for reprints to: Kid Törnquist, Ph.D., Minerva, Tukholmankatu 2, 00250 Helsinki, Finland.
 |
Abstract
|
|---|
Sphingosine 1-phosphate (SPP) potently mobilizes sequestered calcium
and is a mitogen in several cell types. In the present investigation,
we have evaluated the effect of SPP on intracellular free calcium
concentration ([Ca2+]i) and synthesis of DNA
in thyroid FRTL-5 cells. SPP rapidly and transiently mobilized
sequestered calcium and stimulated entry of extracellular calcium. The
entry of calcium, but not the mobilization, was in part inhibited by
pretreatment with pertussis toxin (Ptx), and by activation of protein
kinase C. SPP did not stimulate the production of inositol
1,4,5-trisphosphate. SPP stimulated the incorporation of
3H-thymidine in a time- and dose-dependent manner. The
effect was not inhibited by Ptx. Furthermore, SPP stimulated the
activation of the proto-oncogene c-fos. SPP rapidly
tyrosine-phosphorylated an approximately 66 kDa protein. This
phosphorylation persisted for at least 1 h. Pretreatment of the
cells with genistein abolished the SPP-evoked tyrosine phosphorylation,
and attenuated the SPP-evoked increase in
[Ca2+]i. Furthermore, the SPP-evoked
activation of Na+-H+ exchange was inhibited by
genistein. The phosphorylation was not attenuated by pretreatment of
the cells with Ptx. SPP per se did not affect cellular
cAMP levels but attenuated the TSH-evoked increase in cAMP. As the
effect of SPP might be due to activation of phospholipase D, we tested
whether phosphatidic acid (PA) mobilized calcium or stimulated the
incorporation of 3H-thymidine. PA mobilized sequestered
calcium but did not stimulate calcium entry. PA very modestly enhanced
the incorporation of 3H-thymidine. Our results suggest,
that SPP stimulates DNA synthesis and activates entry of calcium in
FRTL-5 cells. The effect on calcium entry appears to be dependent, at
least in part, on one or several tyrosine kinases.
 |
Introduction
|
|---|
SPHINGOLIPID metabolites have recently been
shown to mediate and modulate a wide spectrum of cellular events (1).
Initially these compounds, i.e. sphingosine (SP)
derivatives, were shown to inhibit protein kinase C (PKC). However,
many of the recently described effects of SP derivatives appear to be
mediated via a mechanism independent of PKC. These effects include the
modulation of calcium fluxes (2, 3), mobilization of sequestered
calcium (4, 5, 6, 7), inhibition of calcium channels (8, 9), and stimulation
of proliferation (5, 10, 11). It is interesting to note that SP
derivatives, i.e. endogenous inhibitors of PKC, can
stimulate proliferation, an event also mediated by activation of
PKC.
A potent sphingosine derivative activating proliferation is sphingosine
1-phosphate (SPP) (5, 12). Although the mechanism of action of SPP is
still unclear, it is suggested to be mediated via a pertussis toxin
(Ptx)-sensitive, MAP kinase dependent pathway, resulting in enhanced
DNA binding of the AP-1 complex (13, 14, 15). This effect of SPP could be
mediated via activation of phospholipase D, and an increased production
of phosphatidic acid (16). Furthermore, SPP mobilizes sequestered
calcium via an inositol 1,4,5-trisphosphate-independent pathway (17).
Recent results have shown that SPP can be produced in the endoplasmic
reticulum of cells (18). Both the production of phosphatidic acid, and
the mobilization of sequestered calcium are important signals in
regulating proliferation.
In thyroid cells, proliferation is mainly regulated via the
TSH-mediated increase in intracellular cAMP (see 19 . However,
several other growth factors (20), especially insulin-like growth
factor (21) and basic fibroblast growth factor (22), and transmitters
(noradrenalin, ATP) are regulating proliferation (23, 24). Lipid
metabolites produced in response to these agents (i.e.
arachidonic acid, prostaglandins, diacylglycerol) may mediate the
mitogenic stimulus (23, 25). Furthermore, changes in intracellular
calcium participates in the regulation of FRTL-5 cells (26, 27, 28). In
addition, entry of extracellular calcium probably participate in
regulating the mitogenic response (21, 24). In a recent report, we
showed that SP and sphingosylphosphorylcholine mobilized sequestered
calcium and stimulated DNA synthesis in thyroid FRTL-5 cells (7).
Furthermore, in a recent study, Okajima et al. showed that
SPP mobilized cellular calcium and activated hydrogen peroxide
generation in FRTL-5 cells (29). As SPP apparently is the mediator of
the SP-evoked responses in cells, we considered it important to further
evaluate the effects of SP derivatives on intracellular calcium levels
([Ca2+]i) and on the synthesis of DNA in
these cells. This SP derivative is of special importance, as
platelet-derived growth factor, a mitogen in FRTL-5 cells (22),
recently was shown to induced the synthesis of SPP in Swiss 3T3
fibroblasts (12). Our results show that SPP stimulates a dose-dependent
increase in [Ca2+]i and activates DNA
synthesis in a time- and dose-dependent manner. A preliminary report
has been published (30).
 |
Materials and Methods
|
|---|
Materials
Culture medium, serum, and hormones needed for the cell culture
was purchased from GIBCO (Grand Island, NY), Biological Industries
(Beth Haemek, Israel) and Sigma (St. Louis, MO). Culture dishes were
obtained from Falcon Plastics (Oxnard, CA). Sphingosine 1-phosphate and
genistein were purchased from BIOMOL Research Laboratories (Plymouth
Meeting, PA). Sphingosine, phorbol myristyl acetate, and Ptx were
purchased from Sigma. The mitogen-activated protein kinase kinase
inhibitor PD 098059 was a generous gift of Dr Alan R. Saltiel
(Department of Signal Transduction, Parke-Davis Pharmaceutical Research
Division, Warner-Lambert Co, Ann Arbour, MI). Fura 2-AM and BCECF were
purchased from Molecular Probes, Inc. (Eugene, OR). Thapsigargin and
inositol-1,4,5-trisphosphate were from LC Services Corp (Woburn, MA).
[3H]-myo-inositol (91 Ci/mmol), (5, 6, 8, 9,
11, 12, 14, 15-3H)-arachidonic acid (207 Ci/mmol),
[methyl-3H]-thymidine (7090 Ci/mmol) and the Amprep
(SAX) minicolumns were from Amersham (Amersham, UK). The enhanced
chemiluminescence Western blot detection kit was from Amersham. The
tyrosine antibody PY20 and the c-fos p62 antibody were from
Santa Cruz, Inc. (Santa Cruz, CA). All other chemicals used were of
reagent grade. Bovine TSH was a generous gift from the NIDDK (NIH,
Bethesda, MD).
Cell culture
Rat thyroid FRTL-5 cells were a generous gift of Dr. Egil Haug
(Akers Hospital, Oslo, Norway). The cells were grown in Coons
modified Hams F-12 medium, supplemented with 5% calf serum and six
hormones (31) (insulin, 10 µg/ml; transferrin, 5 µg/ml;
hydrocortisone, 10 nM; the tripeptide
gly-L-his-L-lys, 10 ng/ml; TSH, 0.3 mU/ml;
somatostatin, 10 ng/ml) in a water-saturated atmosphere of 5%
CO2 and 95% air at 37 C. Before an experiment, cells from
one donor culture dish were harvested with a 0.25% trypsin solution
and plated onto plastic 100-, 60-, or 35-mm culture dishes. The cells
were grown for 78 days before an experiment, with two to three
changes of the culture medium. Fresh medium was always added 24 h
before an experiment.
Measurement of [Ca2+]i
The medium was aspirated, and the cells were then harvested with
buffered saline solution (BSS, in millimolar concentrations: NaCl, 118;
KCl, 4.6; glucose, 10; CaCl2, 1.0; HEPES, 20; pH 7.2)
containing 0.02% EDTA and 0.1% trypsin. After washing the cells three
times by pelleting, the cells were incubated with 1 µM
Fura 2-AM for 30 min at 37 C. Following the loading period, the cells
were washed twice with BSS buffer, incubated for at least 10 min at
room temperature, and washed once again. The cells were added to a
quartz cuvette, kept at 37 C, and stirred throughout the experiment. A
stock solution (1 mM) of sphingosine 1-phosphate was made
in methanol. Before an experiment, an appropriate aliquot was taken,
and the methanol was evaporated under a stream of nitrogen. The
sphingosine 1-phosphate was dissolved in BSS buffer containing BSA (4
mg/ml) to give a final concentration of 125 µM.
Fluorescence was measured with a Hitachi F2000 fluorimeter. The
excitation wavelengths were 340 and 380 nm, and emission was measured
at 510 nm. The signal was calibrated by addition of 1 mM
CaCl2 and digitonin to obtain maximal fluorescence.
Chelating extracellular Ca2+ with 5 mM EGTA and
the addition of Tris-base was used to elevate pH above 8.3 to obtain
minimal fluorescence. [Ca2+]i was calculated
as described by Gryenkiewicz et al. (32), using a computer
program designed for the fluorimeter with a Kd-value of 224
nM for Fura 2.
Incubation with Ptx
The cells were treated with Ptx (50 ng/ml) for 24 h (33)
and then harvested and loaded with Fura 2 as described above.
Measurement of phosphoinositides in FRTL-5 cells
The cells were incubated with
3H-myo-inositol (6 µCi/plate) for 48 h
and then harvested with trypsin as mentioned above. The cells were
incubated for 10 min at 37 C in BSS buffer, and for 10 min at 37 C in
BSS buffer containing 10 mM LiCl2. The cells
were then stimulated with 0.5 µM sphingosine 1-phosphate
for 10 min at 37 C. Inositol phosphates were extracted using 20%
perchloric acid, and the different inositol phosphates were separated
using Amprep (SAX) minicolumns (34).
Measurement of 3H-thymidine incorporation in FRTL-5
cells
The cells were plated onto 35-mm dishes and grown in 6H for 3
days. Then the cells were washed twice with PBS (in millimolar
concentrations; NaCl, 137; KCl, 2.7; Na2HPO4,
8, KH2PO4, 1.5; pH 7.4) and grown in 0H
(Coons medium without hormones or serum) containing 0.2% BSA for 2
days (0H-BSA). The medium was then changed to 0H-BSA containing the
appropriate concentrations of sphingosine 1-phosphate, and
3H-thymidine (0.4 µCi/ml), and incubated for the times
indicated (35). The cells were washed two to three times with cold
PBS-solution, and once with cold 5% TCA. The TCA-insoluble precipitate
was dissolved in 0.1 N NaOH, and the radioactivity was
measured by scintillation counting using a 1214 Rackbeta liquid
scintillation spectrophotometer.
3H-arachidonic acid release
The cells were incubated with 3H-arachidonic acid
(0.1 µCi/ml) for 24 h (36) in 35-mm plastic dishes, as described
earlier (37). After the incubation, the cells were washed three times
(5-min intervals) with release buffer (in millimolar concentrations:
NaCl, 134; KCl, 4.7; glucose, 5; CaCl2, 2.0;
MgSO4, 1.2; KH2PO4, 1.2;
NaHCO3, 2.5; HEPES, 10; pH 7.2; and 0.1% BSA). The cells
were then incubated in 750 µl of the release buffer for the times
indicated with the appropriate concentration of sphingosine
1-phosphate. Then 600 µl was removed and the radioactivity was
measured by scintillation counting.
Measurement of cAMP
The cells were grown in 6H in 24-well plates for 3 days. The
cells were then deprived of serum and mitogens for 2 days. Before an
experiment, the cells were preincubated in HBSS containing 0.2% BSA
and 0.3 mM isobutyl-methylxhanthin (IBMX) for 10 min at 37
C. The cells were then stimulated for 10 min with SPP or TSH in
HBSS-BSA-IBMX. After a rapid wash with ice-cold buffer, cAMP was
extracted with ice-cold ethanol for at least 18 h, and cAMP was
determined as described earlier (38).
Expression of c-fos proteins and measurement of tyrosine
phosphorylation
FRTL-5 cells were grown on 60-mm or 100-mm plates as described
above. The cells were deprived of serum and mitogens for 2 days before
an experiment. The cells were harvested as described above. The cells
were preincubated at 37 C for 5 min in HBSS before an experiment. After
incubation with SPP for the times indicated, the cells were rapidly
centrifuged and extracted in ice-cold lysis buffer (in mM
concentrations: NaCl, 100; Na3VO4, 2; EDTA, 2;
Tris-base, 20 mM, pH 8.0; and 3% Nonidet P-40). For the
measurement of the p62 c-fos protein, the experiments were
performed using cells growing on 60-mm dishes. After the experiment,
lysis buffer was added to the plates and the cells were scraped off the
plates. A sample of the extract was mixed with an equal amount of
boiling SDS-buffer (glycerol, 20%; 2-mercaptoethanol, 10%; SDS, 4%;
bromophenolblue 0.02%; Tris-base; 0.125 mM, pH 6.8), and
equal amounts of proteins were separated by SDS-PAGE on 10%
polyacrylamide gels. The proteins from the gels were transferred
electrophoretically to nitrocellulose membranes (Schleicher & Schuell,
Dassel, Germany) The membrane was incubated with 5% nonfat dry milk
for 1 h at room temperature in Tris-buffered saline (TBS, in
mM concentrations: NaCl, 500; Tris-base, 20, pH 7.5) to
block the remaining binding sites. The blots were then incubated with
anti p62 (c-fos; 1:500), or the PY20 antibody (1:1000)
diluted in TBS containing 5% nonfat dry milk at 4 C overnight. Then
the blots were incubated with peroxidase-conjugated antimouse or
antirabbit antibodies (1:24000) for 2 h at room temperature, and
the proteins were detected using the ECL Western blotting detection kit
according to the manufacturers instructions. Densitometric analysis
was made with a Kodak DC 40 digital camera, and 1D Image Analysis
Software (Eastman Kodak Company, Rochester, NY).
RT-PCR for c-fos
Total RNA was isolated using the guanidine thiocyanate method
(39). A random primed complementary DNA was generated from 1.0 µg of
total RNA template with Moloney murine leukemia reverse transcriptase
according to the manufacturers recommendation (GIBCO). For
complementary DNA amplification, the PCR was performed for 24 cycles
with 0.3 nM of the c-fos sens primer
CACGACCATGATGTTCTCGG, and the c-fos antisens primer
AGTAGATTGGCAATCTCGGT (40), 1.25 U Dynazyme II polymerase (Finnzymes,
Espoo, Finland), and 1 mM each of dATP, dGTP, dTTP, and
dCTP, and 0.1 µl
(32P)-dCTP (3000 mCi/mM,
Amersham, UK) in a final volume of 50 µl. ß-actin was used as an
internal standard. The PCR products were separated by 2% agarose gel
electrophoresis and visualized with ethidium bromide. The radioactivity
of the PCR bands was measured by scintillation counting, and the
results are expressed as relative levels of c-fos messenger
RNA (mRNA) normalized to actin mRNA.
Measurement of intracellular pH (pHi)
The medium was aspirated and the cells were harvested with BSS
exactly as described for the [Ca2+]i
measurements. The cells were then incubated with 3 µM
BCECF-AM for 20 min at 37 C. Following the loading period, the cells
were washed twice with BSS buffer and incubated for at least 10 min at
room temperature to ensure complete cleavage of the AM group. Before an
experiment, the cells were washed once again (41). The cells were added
to a quartz cuvette, kept at 37 C, and stirred throughout the
experiment. Fluorescence was measured with a Hitachi F2000 fluorimeter.
The excitation wavelengths were 500 nm and 440 nm, and the emission
wavelength was 530 nm. The calibration procedure was exactly as
described previously (41).
Statistics
The results are expressed as the mean ± SE.
The [Ca2+]i- and the pHi-traces
shown are representative traces of at least five independent
experiments. The 3H-thymidine experiments, the
IP3-experiments, and the cAMP-experiments, the Western blot
experiments, and the RT-PCR experiments were repeated at least three
times. Statistical analysis was made using Students t test
for paired observations. When three or more means were tested, ANOVA
was used.
 |
Results
|
|---|
SPP increases intracellular free calcium in FRTL-5 cells
SPP has been shown to stimulate the release of sequestered calcium
in several cell types (5, 18). We observed that, in FRTL-5 cells, SPP
released sequestered calcium and stimulated calcium entry (Fig. 1A
). The effect was dose dependent (Fig. 1B
). The ED50 value for SPP was about 0.1 µM
in a calcium containing buffer and about 0.1 µM in a
calcium free buffer, respectively. Pretreatment of the cells with
thapsigargin (Tg) depletes IP3-sensitive calcium stores in
FRTL-5 cells (42). SPP apparently mobilized calcium from an
IP3-sensitive calcium stores, as pretreatment of the cells
with 2 µM Tg for 15 min abolished the SPP-evoked increase
in [Ca2+]i (data not shown). Repeated
applications of SPP to cells in a calcium-containing buffer resulted in
a slightly attenuated response to SPP (data not shown). In cells
incubated in a calcium-free buffer, the response was abolished after
the third addition of SPP (data not shown).
The SPP-evoked calcium entry was decreased in Ptx-treated cells but not
the SPP-evoked release of sequestered calcium (Fig. 1C
). Pretreatment
with Ptx had no effect on the basal [Ca2+]i
levels. In these cells, basal [Ca2+]i was
90 ± 9 nM and 58 ± 4 nM in a
calcium-containing buffer and a calcium-free buffer, respectively. In
control cells the values were 105 ± 21 nM and 60
± 13 nM, respectively. Activation of protein kinase C
inhibits G protein mediated signal transduction (43). Addition of PMA
before stimulation with SPP decreased the entry of calcium, but not the
SPP-evoked release of sequestered calcium (Fig. 1
), suggesting that the
SPP-evoked entry might be mediated via a G protein. Another possibility
is that the decreased entry of calcium resulted from the PMA-evoked
depolarization of the cells (44), and the concomitant decreased
electrochemical gradient for calcium. PMA had no effect on basal
[Ca2+]i in either a calcium-containing buffer
(120 ± 11 nM, or in a calcium-free buffer (71 ±
32 nM). Taken together, our results thus suggest that SPP
apparently can both mobilize calcium from an intracellular store and
stimulate a substantial calcium entry in the cells. Part of this effect
probably occurs independent of a G protein-mediated mechanism.
Lack of an effect of SPP on the production of inositol
1,4,5-trisphosphate in FRTL-5 cells
SPP has been shown to activate the production of IP3
in some cell types (15, 17). In cells stimulated with 0.5
µM SPP (i.e. the dose giving the maximal
increase in [Ca2+]i), or with 5
µM SPP (i.e. the dose giving the maximal
increase in 3H-thymidine incorporation) for 10 min, the
amount of IP3 was 3488 ± 606 cpm/tube and 4172
± 500 cpm/tube, respectively. In vehicle-treated cells, the result was
4628 ± 553 cpm/tube. Furthermore, if all the IP-metabolites,
i.e. IP, IP2, and IP3 were
summarized, SPP was without an effect, compared with control cells
(data not shown). Our results thus suggested that the effect of SPP on
[Ca2+]i was apparently mediated via a
mechanism not involving the production of inositol phosphates.
Stimulatory effect of SPP on DNA synthesis in FRTL-5 cells
In Swiss 3T3 fibroblasts, SPP is a potent activator of
DNA-synthesis and proliferation (5). In FRTL-5 cells, SPP activated the
incorporation of 3H-thymidine in DNA in a time- and
dose-dependent manner (Fig. 2
). The
maximal stimulation of 3H-thymidine incorporation occurred
with 5 µM SPP, a dose 10-fold higher than the dose
evoking maximal increase in [Ca2+]i. Usually
at least a 48-h incubation with SPP was necessary to observe an
enhanced incorporation of 3H-thymidine. The
ED50 value for the SPP-evoked incorporation of
3H-thymidine was about 1 µM.
The effect of SPP may in part be dependent on a Ptx-sensitive G protein
(14, 15). We investigated whether the effect of SPP on the
incorporation of 3H-thymidine in FRTL-5 cells was mediated
via a Ptx-sensitive pathway. Pretreatment of the cells with Ptx did
not, however, inhibit the effect of SPP (Fig. 3
).
Activation of c-fos is of importance in the proliferation of
thyroid cells (20, 45, 46). In Fig. 4A
, we show that SPP stimulated the expression of a c-fos
related protein in a time-dependent manner. Figure 4B
shows the
time-dependent expression of mRNA coding for c-fos mRNA in
response to SPP.
SPP activates a tyrosine kinase
We investigated whether SPP could stimulate DNA synthesis via
activation of a tyrosine kinase. We observed that SPP in a
time-dependent manner tyrosine-phosphorylated an approximately 66-kDa
protein (Fig. 5
). The densitometric data
are given in Table 1
. Further studies
showed that the phosphorylation was abolished by genistein (Fig. 6
). Pretreatment with Ptx did not inhibit
the effect of SPP (Fig. 7
).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5. SPP-evoked tyrosine-phosphorylation of a 66 kDa
protein in FRTL-5 cells. Cells grown first in 6H and then in 0H for 2
days were harvested as described in Materials and
Methods, and stimulated with either 5 µM SPP, or
vehicle for the times indicated. The experiment was repeated three
times with identical results.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. Genistein inhibits the tyrosine phosphorylation
evoked by SPP. Cells grown first in 6H and then in 0H for 2 days were
harvested as described in Materials and Methods. Part of
the cells were pretreated with genistein (30 µM for 30
min) before stimulation with 5 µM SPP for 15 min. The
lower panel gives the densitometric data from three
separate experiments. Relative density was determined by taking the
basal phosphorylation at 15 min as 100%.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 7. Lack of an effect of Ptx on the tyrosine
phosphorylation evoked by SPP. Cells grown first in 6H and then in 0H
for 2 days were harvested as described in Materials and
Methods. Part of the cells had been incubated with Ptx (50
ng/ml) for 24 h. The cells were stimulated with 5 µM
SPP for 15 min. The lower panel gives the densitometric
data from three separate experiments. Relative density was determined
by taking the basal phosphorylation at 15 min as 100%.
|
|
Pretreatment of the cells with genistein inhibited in part the
SPP-evoked calcium entry but did not affect the mobilization of
sequestered calcium (Fig. 8
).
Pretreatment with genistein did not affect the basal
[Ca2+]i levels (110 ± 19 nM
and 66 ± 11 nM in a calcium-containing buffer and a
calcium-free buffer, respectively. In control cells, the corresponding
values were 105 ± 21 nM and 60 ± 13
nM, respectively. Furthermore, in genistein-treated cells,
the SPP-evoked incorporation of 3H-thymidine was decreased
by 55% (data not shown). However, in control experiments genistein
also significantly decreased both the PMA- and the TSH-evoked
incorporation of 3H-thymidine (data not shown), rendering
any conclusions on the importance of the SPP-evoked activation of the
tyrosine kinase impossible to make.
We have recently shown that SPP activates
Na+-H+ exchange in FRTL-5 cells (47). We next
investigated whether this effect was mediated via activation of a
tyrosine kinase. Pretreatment of the cells with 30 µM
genistein for 15 min totally abolished the SPP-evoked activation of the
Na+-H+ exchange (Fig. 9
).
Lack of an effect of SPP per se on cellular cAMP in FRTL-5
cells
In airway smooth muscle cells, SPP inhibits the formation of cAMP
(48). In FRTL-5 cells stimulated with 5 µM SPP,
i.e. the dose stimulating maximal incorporation of
3H-thymidine, we could not detect any effects on cellular
cAMP. However, this dose of SPP attenuated the TSH-evoked increase in
cAMP (Table 2
).
Effect of phosphatidic acid on [Ca2+]i
and the incorporation of 3H-thymidine in FRTL-5 cells
The effect of SPP has been attributed, at least in part, to
activation of phospholipase D and the production of phosphatidic acid
(PA) (49). PA (final concentration 10 µg/ml) rapidly mobilized
sequestered calcium. The increase in [Ca2+]i
was 142 ± 7 nM in a calcium containing buffer, and
142 ± 19 nM in a calcium free buffer. However, no
calcium entry was detected in response to PA. Furthermore, PA very
modestly stimulated the incorporation of 3H-thymidine in
FRTL-5 cells, and a significant effect was observed only after 48
h of incubation with 10 µg/ml (31072 ± 315 cpm/well, compared
with 27123 ± 1137 cpm/well in control cells, P <
0.05). A higher dose of PA tested (30 µg/ml) did not further increase
the incorporation of 3H-thymidine (data not shown). Longer
incubations with PA were without an effect (data not shown).
Furthermore, PA did not stimulate the expression of c-fos
(data not shown). Thus, the effect of SPP was apparently not mediated
via production of PA.
Lack of an effect of SPP on the release of arachidonic acid
In some cell types, sphingosine derivatives may activate
phospholipase A2 and the release of arachidonic acid (7, 50). However, SPP did not stimulate the release of
3H-labeled arachidonic acid from FRTL-5 cells (160 ±
16 cpm, compared with 173 ± 17 cpm in control cells).
 |
Discussion
|
|---|
The results in the present study show that SPP is a potent
activator of calcium entry in FRTL-5 cells, whereas the mobilization of
sequestered calcium by SPP was modest. Several sphingosine derivatives,
including SPP, potently mobilizes sequestered calcium (4, 5, 6). Similar
results have been obtained previously in FRTL-5 cells using SP and
sphingosylphosphorylcholine (SPC) (7). Furthermore, Okajima et
al. (29) recently showed that SPP increased
[Ca2+]i in FRTL-5 cells, although the source
of the Ca2+ was not further evaluated. Our present results
suggest that SPP released sequestered calcium independently of an
increase in inositol phosphates. This observation is in contrast to the
observations made by Okajima et al. (29), who could show a
clear effect of SPP on IP3 in their cells. Presently we
have no explanation for the discrepancy in the results. A lack of an
SPP-evoked increase in IP3 formation was also shown in skin
fibroblasts (51) and in Swiss 3T3 fibroblasts (17). In these cells, as
well as in HL60 leukemia cells, SPP also induced the formation of
IP3, and this effect was attenuated by Ptx (15, 52),
resulting in a potent attenuation of the SPP-evoked
[Ca2+]i-response. Furthermore, the SPP-evoked
increase in [Ca2+]i in HEK 292 cells was
almost totally blocked by pretreatment with Ptx (53). Thus, these
results strongly suggest that SPP may activate a receptor coupled to a
Gi/Go protein. The partial inhibition of the
SPP-evoked increase in [Ca2+]i that we
observed in a calcium containing buffer in cells treated with Ptx
suggests that some of the effects of SPP in FRTL-5 cells may be
mediated via a Gi/Go protein. Similar results
have also been seen in FRTL-5 cells by others (29). We have also shown
recently that treatment with Ptx attenuated the SPC-evoked calcium
entry in FRTL-5 cells (7). The PMA-evoked attenuation of the SPP-evoked
calcium entry also suggests the involvement of a G protein, as
activation of protein kinase C inhibits G protein-mediated signal
transduction (43). Another possibility is that the decreased entry of
calcium resulted from the PMA-evoked depolarization of the cells (44)
and the concomitant decreased electrochemical gradient for calcium. The
lack of an effect of either Ptx or PMA on the release of sequestered
calcium suggests that some mechanisms other than those mediated via G
proteins probably are involved. Thus, although a receptor-mediated
event regulating SPP-evoked calcium fluxes is quite probable, it is
important to note that the exact mechanism is presently unknown.
Whether these fluxes are directly linked to the SPP-evoked release of
sequestered endoplasmic calcium (see 18 , or to the recently
cloned sphingolipid Ca2+ release-mediating protein
(SCaMPER) from the endoplasmic reticulum (54) remains to be
determined.
We also observed that SPP activated a tyrosine kinase(s), resulting in
the phosphorylation of one or more 66-kDa proteins. Recent studies have
suggested that tyrosine kinases are of importance in regulating calcium
entry (55, 56) and that calcium entry can be blocked by the tyrosine
kinase inhibitor genistein. Our results agree with these observations,
as both the SPP-evoked the tyrosine phosphorylation of the 66-kDa
protein and the SPP-evoked increase in
[Ca2+]i was attenuated by genistein.
In addition to its action on [Ca2+]i, SPP is
an activator of DNA synthesis in FRTL-5 cells. In Swiss 3T3
fibroblasts, in which SPP is a very potent mitogen (5), the mitogenic
effect appears to be mediated via the MAP kinase pathway (14). This
pathway seems to involve a Gi/Go protein, as
the effect was sensitive to treatment with Ptx (14, 15). The results
from our experiments suggest that the SPP-evoked DNA synthesis is not
dependent on the activation of a Gi/Go protein,
as the effect was insensitive to Ptx. In preliminary experiments, we
observed that SPP phosphorylated MAP kinase p42 in our cells but that
the effect was very modest and transient. Furthermore, the MAP kinase
kinase inhibitor PD 098059 (57) did not inhibit the SPP-evoked
incorporation of 3H-thymidine, although the effect of
insulin, PMA, and serum was inhibited by this compound
(Törnquist, K., unpublished observations). We also showed that
genistein inhibited the SPP-evoked incorporation of
3H-thymidine. Genistein has recently been shown to inhibit
tyrosine kinase-mediated mitogenic signals in FRTL-5 cells (58, 59).
However, as genistein in control experiments inhibited the effects of
both PMA and TSH on the incorporation of 3H-thymidine, any
conclusions regarding the importance of a tyrosine kinase as a mediator
of the SPP-evoked incorporation of 3H-thymidine is
impossible to make.
One mechanism of action described for SPP is to stimulate phospholipase
D and the production of phosphatidic acid (49). We cannot exclude the
possibility that SPP may activate PLD and the production of PA in
FRTL-5 cells. However, the weak effect of PA on both
[Ca2+]i and on the incorporation of
3H-thymidine suggested that a possible SPP-evoked
activation of PLD is of little importance for the SPP-evoked effects
reported in the present study. Furthermore, SPP could stimulate the
incorporation of 3H-thymidine via activation PKC, or via
activation of adenylate cyclase and the production of cAMP. However, no
reports are available showing an effect of SPP on PKC (see 60 . We
could not observe an effect of SPP per se on cAMP, although
SPP attenuated the TSH-evoked increase in cAMP, an effect also shown by
others in FRTL-5 cells (29). A recent study in airway smooth muscle
cells also showed that SPP in fact decreased the production of cAMP
(48).
An Na+-H+ exchange mechanism exists in most
cell types. This mechanism participates in a multitude of cellular
events (61). Na+-H+ exchange has also been
suggested to participate in the regulation of proliferation (62) (but
see 63 . In FRTL-5 cells, this antiport may participate in the
uptake of I- (64). Furthermore, mitogens like TSH, IGF-1,
ATP, and phorbol myristyl acetate activate this exchange mechanism (41, 65, 66). We have recently observed that SPP is a potent activator of
Na+-H+ exchange in FRTL-5 cells (47). Thus, it
is possible that the SPP-evoked activation of
Na+-H+ exchange may be part of the events
initializing DNA synthesis. Furthermore, the SPP-evoked activation of
Na+-H+ exchange was inhibited by genistein.
Thus, the tyrosine kinase activated by SPP participates apparently in
regulating both calcium entry and activation of
Na+-H+ exchange. In conclusion, the results
obtained in the present study show that SPP is a potent modulator of
cellular events important for the regulation of proliferation in FRTL-5
cells. Although it is not yet known whether growth factors, like
platelet-derived growth factor, can induce the synthesis of SPP in
thyroid cells, the present study adds a new lipid derivative to the
list of compounds modulating thyroid cell function.
 |
Acknowledgments
|
|---|
We wish to thank Ms. Satu Määttänen for
excellent technical assistance.
 |
Footnotes
|
|---|
1 This study was supported by the Sigrid Juselius Foundation, the Liv
och Hälsa Foundation, the Academy of Finland, and the Novo
Nordisk Foundation, which is gratefully acknowledged. 
Received December 17, 1996.
 |
References
|
|---|
-
Hannun YA, Bell RM 1989 Functions of
sphingolipids and sphingolipid breakdown products in cellular
regulation. Science 243:500506[Abstract/Free Full Text]
-
Breittmayer J-P, Bernard A, Aussel C 1994 Regulation by sphingomyelinase and sphingosine of Ca2+
signals elicited by CD3 monoclonal antibody, thapsigargin, or ionomycin
in the Jurkat T cell line. J Biol Chem 269:50545058[Abstract/Free Full Text]
-
Hudson PL, Pedersen WA, Saltsman WS, Liscovitch M,
MacLaughlin DT, Donahoe PK, Blusztajn JK 1994 Modulation by
sphingolipids of calcium signals evoked by epidermal growth factor.
J Biol Chem 269:2188521890[Abstract/Free Full Text]
-
Ghosh T, Bian J, Gill DL 1990 Intracellular
calcium release mediated by sphingosine derivatives generated in cells.
Science 248:16531656[Abstract/Free Full Text]
-
Zhang H, Desai NN, Olivera A, Seki T, Brooker G,
Spiegel S 1991 Sphingosine-1-phosphate, a novel lipid, involved in
cellular proliferation. J Cell Biol 114:155167[Abstract/Free Full Text]
-
Yule DI, Wu D, Essington TE, Shayman JA, Williams
JA 1993 Sphingosine metabolism induces Ca2+
oscillations in rat pancreatic acinar cells. J Biol Chem 268:1235312358[Abstract/Free Full Text]
-
Törnquist K, Ekokoski E 1994 Effect of
sphingosine derivatives on calcium fluxes in thyroid FRTL-5 cells.
Biochem J 299:213218
-
McDonough PM, Yasui K, Betto R, Salvati G, Glembotski
CC, Palade PT, Sabbadini RA 1994 Control of cardiac
Ca2+ levels. Inhibitory actions of sphingosine on
Ca2+ transients and L-type Ca2+ channel
conductance. Circ Res 75:981989[Abstract/Free Full Text]
-
Törnquist K, Pasternack M, Kaila K 1995 Sphingosine derivatives inhibit depolarization-evoked calcium entry in
GH4C1 pituitary cells. Endocrinology 136:48944902[Abstract]
-
Zangh H, Buckley NE, Gibson K, Spiegel S 1990 Sphingosine stimulates cellular proliferation via a protein kinase
C-independent pathway. J Biol Chem 265:7681[Abstract/Free Full Text]
-
Desai NN, Carlson RO, Mattie ME, Olivera N, Buckley NE,
Seki T, Brooker G, Spiegel S 1993 Signaling pathways for
sphingosylphosphorylcholine-mediated mitogenesis in Swiss 3T3
fibroblasts. J Cell Biol 121:13851395[Abstract/Free Full Text]
-
Olivera A, Spiegel S 1993 Sphingosine-1-phosphate
as second messenger in cell proliferation induced by PDGF and FCS
mitogens. Nature 365:557560[CrossRef][Medline]
-
Su Y, Rosenthal D, Smulson M, Spiegel S 1994 Sphingosine 1-phosphate, a novel signaling molecule, stimulates DNA
binding activity of AP-1 in quiescent Swiss 3T3 fibroblasts. J
Biol Chem 269:1651216517[Abstract/Free Full Text]
-
Wu J, Spiegel S, Sturgill TW 1995 Sphingosine
1-phosphate rapidly activates the mitogen-activated protein kinase
pathway by a G-protein-dependent mechanism. J Biol Chem 270:1148411488[Abstract/Free Full Text]
-
Goodemote KA, Mattie ME, Berger A, Spiegel S 1995 Involvement of a pertussis toxin-sensitive G protein in the mitogenic
signaling pathway of sphingosine 1-phosphate. J Biol Chem 270:1027210277[Abstract/Free Full Text]
-
Zhang H, Desai NN, Murphey JM, Spiegel S 1990 Increase in phosphatidic acid levels accompany sphingosine-stimulated
proliferation of quiscent Swiss 3T3 cells. J Biol Chem 265:2130921316[Abstract/Free Full Text]
-
Mattie M, Brooker G, Spiegel S 1994 Sphingosine-1-phosphate, a putative second messenger, mobilizes calcium
from internal stores via an inositol trisphosphate-independent pathway.
J Biol Chem 269:31813188[Abstract/Free Full Text]
-
Ghosh TK, Bian J, Gill DL 1994 Sphingosine
1-phosphate generated in the endoplasmic reticulum membrane activates
release of stored calcium. J Biol Chem 269:2262822635[Abstract/Free Full Text]
-
Vassart G, Dumont JE 1992 The thyrotropin receptor
and the regulation of thyrocyte function and growth. Endocr Rev 13:596611[CrossRef][Medline]
-
Dumont JE, Maenhaut C, Pirson I, Baptist M, Roger
PP 1991 Growth factors controlling the thyroid gland. Bailieres
Clin Endocrinol Metab 5:727754[Medline]
-
Takada K, Amino N, Tada H, Miyai K 1990 Relationship between proliferation and cell cycle-dependent
Ca2+ influx induced by a combination of thyrotropin and
insulin-like growth factor-1 in rat thyroid cells. J Clin Invest 86:15481555
-
Pang XP, Hershman JM 1990 Differential effects of
growth factors on 3H-thymidine incorporation and
125I-iodine uptake in FRTL-5 rat thyroid cells. Proc Soc
Exp Biol Med 194:240244[Abstract]
-
Burch RM, Luini A, Mais DE, Corda D, Vanderhoek JY, Kohn
LD, Axelrod J 1986 Alpha1-adrenergic stimulation of arachidonic
acid release and metabolism in a rat thyroid cell line. Mediation of
cell replication by prostaglandin E2. J Biol Chem 261:1123611241[Abstract/Free Full Text]
-
Törnquist K, Ekokoski E, Dugué B 1996 ATP functions as a comitogen in thyroid FRTL-5 cells. J Cell Physiol 166:241248[CrossRef][Medline]
-
Brenner-Gati L, Berg KA, Gershengorn MC 1988 Thyroid-stimulating hormone and insulin-like growth factor-1 synergize
to elevate 1,2-diacylglycerol in rat thyroid cells. Stimulation of DNA
synthesis via interaction between lipid and adenylyl cyclase signal
transduction systems. J Clin Invest 82:11441148
-
Weiss SJ, Philp NJ, Grollman EF 1984 Effect of
thyrotropin on iodide efflux in FRTL-5 cells mediated by Ca.
Endocrinology 114:11081113[Abstract]
-
Corda D, Marocci R, Kohn LD, Axelrod J, Luini A 1985 Association of the changes in cytosolic Ca and iodide efflux
induced by thyrotropin and by the stimulation of alpha 1-adrenergic
receptors in cultured rat thyroid cells. J Biol Chem 260:92309236[Abstract/Free Full Text]
-
Berman MI, Thomas Jr CG, Nayfeh SN 1987 Stimulation
of inositol phosphate formation in FRTL-5 rat thyroid cells by
catecholamines and its relationship to changes in
45Ca2+ efflux and cyclic AMP accumulation. Mol
Cell Endocrinol 54:151163[CrossRef][Medline]
-
Okajima F, Tomura H, Sho K, Kimura T, Sato K, Im D-S,
Akbar M, Kondo Y 1997 Sphingosine 1-phosphate stimulates hydrogen
peroxide generation through activation of phospholipase
C-Ca2+ system in FRTL-5 thyroid cells: possible involvement
of guanosine triphosphate-binding proteins in the lipid signaling.
Endocrinology 138:220229[Abstract/Free Full Text]
-
Törnquist K, Saarinen P, Heiskanen M
Sphingosine 1-phosphate mobilizes sequestered calcium, stimulates DNA
synthesis, and activates Na-H exchange in thyroid FRTL-5 cells. Program
of the 10th International Congress of Endocrinology, San Francisco, CA, 1996 (Abstract P2144)
-
Ambesi-Impiombato FS, Parks LAM, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat
thyroids. Proc Natl Acad Sci USA 77:34553459[Abstract/Free Full Text]
-
Gryenkiewicz G, Poenia M, Tsien RY 1985 A new
generation of Ca2+ indicators with greatly improved
fluorescence properties. J Biol Chem 260:34403450[Abstract/Free Full Text]
-
Sho K, Okajima F, Majid MA, Kondo Y 1991 Reciprocal
modulation of thyrotropin actions by P1-purinergic
agonists in FRTL-5 thyroid cells. Inhibition of cAMP pathway and
stimulation of phospholipase C-Ca2+ pathway. J Biol
Chem 266:1218012184[Abstract/Free Full Text]
-
Oldham KG 1990 Polyphosphoinositide turnover. In:
Hume EC (ed) Receptor-Effector Coupling. A Practical Approach. Oxford
University Press, Oxford, New York, Tokyo, pp 99117
-
Valente WA, Vitti P, Kohn LD, Brandi M, Toccafondi R,
Tramontano D, Azou SM, Ambesi-Impiombato FS 1983 The relationship
of growth and adenylate cyclase activity in cultured thyroid cells:
separate bioeffects of thyrotropin. Endocrinology 112:7179[Medline]
-
Di Girolamo M, AArcangelo D, Bizzarri C, Corda D 1991 Muscarinic regulation of phospholipase A2 and iodide
fluxes in FRTL-5 thyroid cells. Acta Endocrinol (Copenh) 125:192200[Medline]
-
Okajima F, Sato K, Nazarea M, Sho K, Kondo Y 1989 A
permissive role of pertussis toxin substrate G-protein in
P2-purinergic stimulation of phosphoinositide turnover and
arachidonate release in FRTL-5 cells. Cooperative mechanism of signal
transduction systems. J Biol Chem 164:1302913037
-
Frandsen EK, Krishna G 1976 A simple ultrasensitive
method for the assay of cyclic AMP and cyclic GMP in tissues. Life Sci 18:529542[CrossRef][Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acidic guanidium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Curran T, Gordon MB, Rubino KL, Sambucetti LC 1987 Isolation and characterization of the c-fos (rat) cDNA and analysis of
post-translational modification in vitro. Oncogene 2:7984[Medline]
-
Törnquist K, Alinen S 1992 Characterization
of Na+/H+ exchange in FRTL-5 thyroid cells.
Evidence for dependence on activation of protein kinase C. Biochim
Biophys Acta 1106:221226[Medline]
-
Törnquist K 1993 ATP-induced entry of calcium
in thyroid FRTL-5 cells. Studies with phorbol myristate acetate and
thapsigargin. Mol Cell Endocrinol 93:1721[CrossRef][Medline]
-
Nishizuka Y 1992 Intracellular signaling by
hydrolysis of phospholipids and activation of protein kinase C. Science 258:607614[Abstract/Free Full Text]
-
Törnquist K 1993 Modulatory effect of protein
kinase C on thapsigargin-induced calcium entry in thyroid FRTL-5 cells.
Biochem J 290:443447
-
Tramontano D, Chin WW, Moses AC, Ingbar SH 1986 Thyrotropin and dibutyryl cyclic AMP increases levels of c-myc and
c-fos mRNAs in cultured rat thyroid cells. J Biol Chem 261:39193922[Abstract/Free Full Text]
-
Isozaki O, Kohn LD 1987 Control of c-fos and c-myc
proto-oncogene induction in rat thyroid cells in culture. Mol
Endocrinol 1:839848[Abstract]
-
Törnquist K 1997 Sphingosine 1-phosphate
activates Na+-H+ exchange in thyroid FRTL-5
cells. Am J Physiol 272:C1052C1057
-
Payne S, Payne NJ 1996 The differential regulation
of cyclic AMP by sphingomyelin-derived lipids and the modulation of
sphingolipid-stimulated extracellular kinase-2 in airway smooth muscle.
Biochem J 315:917923
-
Desai NN, Zhang H, Olivera A, Mattie ME, Spiegel S 1992 Sphingosine-1-phosphate, a metabolite of Spingosine, increases
phosphatidic acid levels by phospholipase D activation. J Biol
Chem 267:2312223128[Abstract/Free Full Text]
-
Desai NN, Spiegel S 1991 Sphingosylphosphorylcholine is a potent mitogen for a variety of cell
lines. Biochem Biophys Res Commun 181:361366[CrossRef][Medline]
-
Chao CP, Laulederkind SF, Ballou LR 1994 Sphingosine-mediated phosphatidylinositol metabolism and calcium
mobilization. J Biol Chem 269:58495856[Abstract/Free Full Text]
-
Okajima F, Tomura H, Sho K, Nochi H, Tamato K, Kondo
Y 1996 Involvement of pertussis toxin-sensitive GTP-binding
proteins in sphingosine 1-phosphate-induced activation of phospholipase
C-Ca2+ system in HL60 leukemia cells. FEBS Lett 379:260264[CrossRef][Medline]
-
van Koppen CJ, Meyer zu Heringdorf D, Laser KT, Fhang C,
Jakobs KH, Bünemann M, Pott L 1996 Activation of a high
affinity Gi protein-coupled plasma membrane receptor by
sphingosine-1-phosphate. J Biol Chem 271:10821087
-
Mao C, Kim SH, Almenoff JS, Rudner XL, Kearney DM,
Kindman LA 1996 Molecular cloning and characterization of SCaMPER,
a sphingolipid Ca2+ release-mediating protein from
endoplasmic reticulum. Proc Natl Acad Sci USA 93:19931996[Abstract/Free Full Text]
-
Lee K-M, Toscas K, Villereal ML 1993 Inhibition of
bradykinin- and thapsigargin-induced Ca2+ entry by tyrosine
kinase inhibitors. J Biol Chem 268:99459948[Abstract/Free Full Text]
-
Sargeant P, Farndale RW, Sage SO 1993 ADP- and
thapsigargin-evoked Ca2+ entry and protein-tyrosine
phosphorylation are inhibited by the tyrosine kinase inhibitors
genistein and methyl-2,5-dihydroxycinnamate in Fura-2-loaded human
platelets. J Biol Chem 268:1815118156[Abstract/Free Full Text]
-
Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel
AR 1995 A synthetic inhibitor of the mitogen-activated protein
kinase cascade. Proc Natl Acad Sci USA 92:76867689[Abstract/Free Full Text]
-
Takano T, Takada K, Tada H, Nishiyama S, Amino N 1993 Genistein, a tyrosine kinase inhibitor, blocks the cell cycle
progression but not Ca2+ influx induced by Bay k 8644 in
FRTL-5 cells. Biochem Biophys Res Commun 190:801807[CrossRef][Medline]
-
Takano T, Takada K, Tada H, Nishiyama S, Amino N 1994 Genistein but not staurosporin can inhibit the mitogenic signal
evoked by lithium in rat thyroid cells (FRTL-5). J Endocrinol 143:221226[Abstract]
-
Spiegel S, Milstein S 1995 Sphingolipid
metabolites: members of a new class of lipid second messengers. J Membr
Biol 146:225237[Medline]
-
Grinstein S, Rothstein A 1986 Mechanism of
regulation of the Na+/H+ exchanger. J Membr
Biol 90:112[CrossRef][Medline]
-
Grinstein S, Rotin D, Mason MJ 1989 Na/H exchange
and growth factor-induced cytosolic pH changes. Role in cellular
proliferation. Biochim Biophys Acta 988:7397[Medline]
-
Ganz MB, Boyarsky G, Sterzel RB, Boron WF 1989 Arginine vasopressin enhances pHi regulation in the presence of
HCO3- by stimulating three acid-base transport
systems. Nature 337:648651[CrossRef][Medline]
-
Marcocci C, Grollman EF 1988 Sodium/proton
exchange in the maintenance of intracellular pH in FRTL-5 thyroid
cells. Endocrinology 123:17051711[Abstract]
-
Woods DJ, Soden J, Tomlinson S, Bidey SP 1990 Transmembrane Na/H exchange in the rat thyroid cell strain FRTL-5:
a possible role in insulin-like growth factor-I mediated proliferation.
J Mol Endocrinol 4:177185[Abstract]
-
Takasu N, Komiya I, Nagasawa Y, Asawa T,
Shimizu Y, Yamada T 1991 Interrelationship between insulin-like
growth factor I-induced activation of the
Na+/H+-antiporter and intracellular
Ca2+-mobilization in thyroid cells. Biochem Biophys Res
Commun 177:113119[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
H. M. ROSENFELDT, Y. AMRANI, K. R. WATTERSON, K. S. MURTHY, R. A. PANETTIERI JR, and S. SPIEGEL
Sphingosine-1-phosphate stimulates contraction of human airway smooth muscle cells
FASEB J,
October 1, 2003;
17(13):
1789 - 1799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. T. Windh, M.-J. Lee, T. Hla, S. An, A. J. Barr, and D. R. Manning
Differential Coupling of the Sphingosine 1-Phosphate Receptors Edg-1, Edg-3, and H218/Edg-5 to the Gi, Gq, and G12 Families of Heterotrimeric G Proteins
J. Biol. Chem.,
September 24, 1999;
274(39):
27351 - 27358.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. An, T. Bleu, and Y. Zheng
Transduction of Intracellular Calcium Signals through G Protein-Mediated Activation of Phospholipase C by Recombinant Sphingosine 1-Phosphate Receptors
Mol. Pharmacol.,
May 1, 1999;
55(5):
787 - 794.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Tornquist, A.-M. Malm, M. Pasternack, R. Kronqvist, S. Bjorklund, R. Tuominen, and J. P. Slotte
Tumor Necrosis Factor-alpha , Sphingomyelinase, and Ceramide Inhibit Store-operated Calcium Entry in Thyroid FRTL-5 Cells
J. Biol. Chem.,
April 2, 1999;
274(14):
9370 - 9377.
[Abstract]
[Full Text]
[PDF]
|
 |
|