help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Törnquist, K.
Right arrow Articles by Ahlström, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Törnquist, K.
Right arrow Articles by Ahlström, M.
Endocrinology Vol. 138, No. 10 4049-4057
Copyright © 1997 by The Endocrine Society


ARTICLES

Sphingosine 1-Phosphate Mobilizes Sequestered Calcium, Activates Calcium Entry, and Stimulates Deoxyribonucleic Acid Synthesis in Thyroid FRTL-5 Cells1

Kid Törnquist, Pia Saarinen, Minna Vainio and Mikael Ahlström

Department of Biosciences (K.T., P.S., M.V., M.A.), Division of Animal Physiology, University of Helsinki, and the Minerva Foundation Institute for Medical Research (K.T., P.S., M.V.), 00250 Helsinki, Finland

Address all correspondence and requests for reprints to: Kid Törnquist, Ph.D., Minerva, Tukholmankatu 2, 00250 Helsinki, Finland.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sphingosine 1-phosphate (SPP) potently mobilizes sequestered calcium and is a mitogen in several cell types. In the present investigation, we have evaluated the effect of SPP on intracellular free calcium concentration ([Ca2+]i) and synthesis of DNA in thyroid FRTL-5 cells. SPP rapidly and transiently mobilized sequestered calcium and stimulated entry of extracellular calcium. The entry of calcium, but not the mobilization, was in part inhibited by pretreatment with pertussis toxin (Ptx), and by activation of protein kinase C. SPP did not stimulate the production of inositol 1,4,5-trisphosphate. SPP stimulated the incorporation of 3H-thymidine in a time- and dose-dependent manner. The effect was not inhibited by Ptx. Furthermore, SPP stimulated the activation of the proto-oncogene c-fos. SPP rapidly tyrosine-phosphorylated an approximately 66 kDa protein. This phosphorylation persisted for at least 1 h. Pretreatment of the cells with genistein abolished the SPP-evoked tyrosine phosphorylation, and attenuated the SPP-evoked increase in [Ca2+]i. Furthermore, the SPP-evoked activation of Na+-H+ exchange was inhibited by genistein. The phosphorylation was not attenuated by pretreatment of the cells with Ptx. SPP per se did not affect cellular cAMP levels but attenuated the TSH-evoked increase in cAMP. As the effect of SPP might be due to activation of phospholipase D, we tested whether phosphatidic acid (PA) mobilized calcium or stimulated the incorporation of 3H-thymidine. PA mobilized sequestered calcium but did not stimulate calcium entry. PA very modestly enhanced the incorporation of 3H-thymidine. Our results suggest, that SPP stimulates DNA synthesis and activates entry of calcium in FRTL-5 cells. The effect on calcium entry appears to be dependent, at least in part, on one or several tyrosine kinases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SPHINGOLIPID metabolites have recently been shown to mediate and modulate a wide spectrum of cellular events (1). Initially these compounds, i.e. sphingosine (SP) derivatives, were shown to inhibit protein kinase C (PKC). However, many of the recently described effects of SP derivatives appear to be mediated via a mechanism independent of PKC. These effects include the modulation of calcium fluxes (2, 3), mobilization of sequestered calcium (4, 5, 6, 7), inhibition of calcium channels (8, 9), and stimulation of proliferation (5, 10, 11). It is interesting to note that SP derivatives, i.e. endogenous inhibitors of PKC, can stimulate proliferation, an event also mediated by activation of PKC.

A potent sphingosine derivative activating proliferation is sphingosine 1-phosphate (SPP) (5, 12). Although the mechanism of action of SPP is still unclear, it is suggested to be mediated via a pertussis toxin (Ptx)-sensitive, MAP kinase dependent pathway, resulting in enhanced DNA binding of the AP-1 complex (13, 14, 15). This effect of SPP could be mediated via activation of phospholipase D, and an increased production of phosphatidic acid (16). Furthermore, SPP mobilizes sequestered calcium via an inositol 1,4,5-trisphosphate-independent pathway (17). Recent results have shown that SPP can be produced in the endoplasmic reticulum of cells (18). Both the production of phosphatidic acid, and the mobilization of sequestered calcium are important signals in regulating proliferation.

In thyroid cells, proliferation is mainly regulated via the TSH-mediated increase in intracellular cAMP (see 19 . However, several other growth factors (20), especially insulin-like growth factor (21) and basic fibroblast growth factor (22), and transmitters (noradrenalin, ATP) are regulating proliferation (23, 24). Lipid metabolites produced in response to these agents (i.e. arachidonic acid, prostaglandins, diacylglycerol) may mediate the mitogenic stimulus (23, 25). Furthermore, changes in intracellular calcium participates in the regulation of FRTL-5 cells (26, 27, 28). In addition, entry of extracellular calcium probably participate in regulating the mitogenic response (21, 24). In a recent report, we showed that SP and sphingosylphosphorylcholine mobilized sequestered calcium and stimulated DNA synthesis in thyroid FRTL-5 cells (7). Furthermore, in a recent study, Okajima et al. showed that SPP mobilized cellular calcium and activated hydrogen peroxide generation in FRTL-5 cells (29). As SPP apparently is the mediator of the SP-evoked responses in cells, we considered it important to further evaluate the effects of SP derivatives on intracellular calcium levels ([Ca2+]i) and on the synthesis of DNA in these cells. This SP derivative is of special importance, as platelet-derived growth factor, a mitogen in FRTL-5 cells (22), recently was shown to induced the synthesis of SPP in Swiss 3T3 fibroblasts (12). Our results show that SPP stimulates a dose-dependent increase in [Ca2+]i and activates DNA synthesis in a time- and dose-dependent manner. A preliminary report has been published (30).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Culture medium, serum, and hormones needed for the cell culture was purchased from GIBCO (Grand Island, NY), Biological Industries (Beth Haemek, Israel) and Sigma (St. Louis, MO). Culture dishes were obtained from Falcon Plastics (Oxnard, CA). Sphingosine 1-phosphate and genistein were purchased from BIOMOL Research Laboratories (Plymouth Meeting, PA). Sphingosine, phorbol myristyl acetate, and Ptx were purchased from Sigma. The mitogen-activated protein kinase kinase inhibitor PD 098059 was a generous gift of Dr Alan R. Saltiel (Department of Signal Transduction, Parke-Davis Pharmaceutical Research Division, Warner-Lambert Co, Ann Arbour, MI). Fura 2-AM and BCECF were purchased from Molecular Probes, Inc. (Eugene, OR). Thapsigargin and inositol-1,4,5-trisphosphate were from LC Services Corp (Woburn, MA). [3H]-myo-inositol (91 Ci/mmol), (5, 6, 8, 9, 11, 12, 14, 15-3H)-arachidonic acid (207 Ci/mmol), [methyl-3H]-thymidine (70–90 Ci/mmol) and the Amprep (SAX) minicolumns were from Amersham (Amersham, UK). The enhanced chemiluminescence Western blot detection kit was from Amersham. The tyrosine antibody PY20 and the c-fos p62 antibody were from Santa Cruz, Inc. (Santa Cruz, CA). All other chemicals used were of reagent grade. Bovine TSH was a generous gift from the NIDDK (NIH, Bethesda, MD).

Cell culture
Rat thyroid FRTL-5 cells were a generous gift of Dr. Egil Haug (Akers Hospital, Oslo, Norway). The cells were grown in Coon’s modified Ham’s F-12 medium, supplemented with 5% calf serum and six hormones (31) (insulin, 10 µg/ml; transferrin, 5 µg/ml; hydrocortisone, 10 nM; the tripeptide gly-L-his-L-lys, 10 ng/ml; TSH, 0.3 mU/ml; somatostatin, 10 ng/ml) in a water-saturated atmosphere of 5% CO2 and 95% air at 37 C. Before an experiment, cells from one donor culture dish were harvested with a 0.25% trypsin solution and plated onto plastic 100-, 60-, or 35-mm culture dishes. The cells were grown for 7–8 days before an experiment, with two to three changes of the culture medium. Fresh medium was always added 24 h before an experiment.

Measurement of [Ca2+]i
The medium was aspirated, and the cells were then harvested with buffered saline solution (BSS, in millimolar concentrations: NaCl, 118; KCl, 4.6; glucose, 10; CaCl2, 1.0; HEPES, 20; pH 7.2) containing 0.02% EDTA and 0.1% trypsin. After washing the cells three times by pelleting, the cells were incubated with 1 µM Fura 2-AM for 30 min at 37 C. Following the loading period, the cells were washed twice with BSS buffer, incubated for at least 10 min at room temperature, and washed once again. The cells were added to a quartz cuvette, kept at 37 C, and stirred throughout the experiment. A stock solution (1 mM) of sphingosine 1-phosphate was made in methanol. Before an experiment, an appropriate aliquot was taken, and the methanol was evaporated under a stream of nitrogen. The sphingosine 1-phosphate was dissolved in BSS buffer containing BSA (4 mg/ml) to give a final concentration of 125 µM. Fluorescence was measured with a Hitachi F2000 fluorimeter. The excitation wavelengths were 340 and 380 nm, and emission was measured at 510 nm. The signal was calibrated by addition of 1 mM CaCl2 and digitonin to obtain maximal fluorescence. Chelating extracellular Ca2+ with 5 mM EGTA and the addition of Tris-base was used to elevate pH above 8.3 to obtain minimal fluorescence. [Ca2+]i was calculated as described by Gryenkiewicz et al. (32), using a computer program designed for the fluorimeter with a Kd-value of 224 nM for Fura 2.

Incubation with Ptx
The cells were treated with Ptx (50 ng/ml) for 24 h (33) and then harvested and loaded with Fura 2 as described above.

Measurement of phosphoinositides in FRTL-5 cells
The cells were incubated with 3H-myo-inositol (6 µCi/plate) for 48 h and then harvested with trypsin as mentioned above. The cells were incubated for 10 min at 37 C in BSS buffer, and for 10 min at 37 C in BSS buffer containing 10 mM LiCl2. The cells were then stimulated with 0.5 µM sphingosine 1-phosphate for 10 min at 37 C. Inositol phosphates were extracted using 20% perchloric acid, and the different inositol phosphates were separated using Amprep (SAX) minicolumns (34).

Measurement of 3H-thymidine incorporation in FRTL-5 cells
The cells were plated onto 35-mm dishes and grown in 6H for 3 days. Then the cells were washed twice with PBS (in millimolar concentrations; NaCl, 137; KCl, 2.7; Na2HPO4, 8, KH2PO4, 1.5; pH 7.4) and grown in 0H (Coon’s medium without hormones or serum) containing 0.2% BSA for 2 days (0H-BSA). The medium was then changed to 0H-BSA containing the appropriate concentrations of sphingosine 1-phosphate, and 3H-thymidine (0.4 µCi/ml), and incubated for the times indicated (35). The cells were washed two to three times with cold PBS-solution, and once with cold 5% TCA. The TCA-insoluble precipitate was dissolved in 0.1 N NaOH, and the radioactivity was measured by scintillation counting using a 1214 Rackbeta liquid scintillation spectrophotometer.

3H-arachidonic acid release
The cells were incubated with 3H-arachidonic acid (0.1 µCi/ml) for 24 h (36) in 35-mm plastic dishes, as described earlier (37). After the incubation, the cells were washed three times (5-min intervals) with release buffer (in millimolar concentrations: NaCl, 134; KCl, 4.7; glucose, 5; CaCl2, 2.0; MgSO4, 1.2; KH2PO4, 1.2; NaHCO3, 2.5; HEPES, 10; pH 7.2; and 0.1% BSA). The cells were then incubated in 750 µl of the release buffer for the times indicated with the appropriate concentration of sphingosine 1-phosphate. Then 600 µl was removed and the radioactivity was measured by scintillation counting.

Measurement of cAMP
The cells were grown in 6H in 24-well plates for 3 days. The cells were then deprived of serum and mitogens for 2 days. Before an experiment, the cells were preincubated in HBSS containing 0.2% BSA and 0.3 mM isobutyl-methylxhanthin (IBMX) for 10 min at 37 C. The cells were then stimulated for 10 min with SPP or TSH in HBSS-BSA-IBMX. After a rapid wash with ice-cold buffer, cAMP was extracted with ice-cold ethanol for at least 18 h, and cAMP was determined as described earlier (38).

Expression of c-fos proteins and measurement of tyrosine phosphorylation
FRTL-5 cells were grown on 60-mm or 100-mm plates as described above. The cells were deprived of serum and mitogens for 2 days before an experiment. The cells were harvested as described above. The cells were preincubated at 37 C for 5 min in HBSS before an experiment. After incubation with SPP for the times indicated, the cells were rapidly centrifuged and extracted in ice-cold lysis buffer (in mM concentrations: NaCl, 100; Na3VO4, 2; EDTA, 2; Tris-base, 20 mM, pH 8.0; and 3% Nonidet P-40). For the measurement of the p62 c-fos protein, the experiments were performed using cells growing on 60-mm dishes. After the experiment, lysis buffer was added to the plates and the cells were scraped off the plates. A sample of the extract was mixed with an equal amount of boiling SDS-buffer (glycerol, 20%; 2-mercaptoethanol, 10%; SDS, 4%; bromophenolblue 0.02%; Tris-base; 0.125 mM, pH 6.8), and equal amounts of proteins were separated by SDS-PAGE on 10% polyacrylamide gels. The proteins from the gels were transferred electrophoretically to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) The membrane was incubated with 5% nonfat dry milk for 1 h at room temperature in Tris-buffered saline (TBS, in mM concentrations: NaCl, 500; Tris-base, 20, pH 7.5) to block the remaining binding sites. The blots were then incubated with anti p62 (c-fos; 1:500), or the PY20 antibody (1:1000) diluted in TBS containing 5% nonfat dry milk at 4 C overnight. Then the blots were incubated with peroxidase-conjugated antimouse or antirabbit antibodies (1:2–4000) for 2 h at room temperature, and the proteins were detected using the ECL Western blotting detection kit according to the manufacturer’s instructions. Densitometric analysis was made with a Kodak DC 40 digital camera, and 1D Image Analysis Software (Eastman Kodak Company, Rochester, NY).

RT-PCR for c-fos
Total RNA was isolated using the guanidine thiocyanate method (39). A random primed complementary DNA was generated from 1.0 µg of total RNA template with Moloney murine leukemia reverse transcriptase according to the manufacturer’s recommendation (GIBCO). For complementary DNA amplification, the PCR was performed for 24 cycles with 0.3 nM of the c-fos sens primer CACGACCATGATGTTCTCGG, and the c-fos antisens primer AGTAGATTGGCAATCTCGGT (40), 1.25 U Dynazyme II polymerase (Finnzymes, Espoo, Finland), and 1 mM each of dATP, dGTP, dTTP, and dCTP, and 0.1 µl {alpha}(32P)-dCTP (3000 mCi/mM, Amersham, UK) in a final volume of 50 µl. ß-actin was used as an internal standard. The PCR products were separated by 2% agarose gel electrophoresis and visualized with ethidium bromide. The radioactivity of the PCR bands was measured by scintillation counting, and the results are expressed as relative levels of c-fos messenger RNA (mRNA) normalized to actin mRNA.

Measurement of intracellular pH (pHi)
The medium was aspirated and the cells were harvested with BSS exactly as described for the [Ca2+]i measurements. The cells were then incubated with 3 µM BCECF-AM for 20 min at 37 C. Following the loading period, the cells were washed twice with BSS buffer and incubated for at least 10 min at room temperature to ensure complete cleavage of the AM group. Before an experiment, the cells were washed once again (41). The cells were added to a quartz cuvette, kept at 37 C, and stirred throughout the experiment. Fluorescence was measured with a Hitachi F2000 fluorimeter. The excitation wavelengths were 500 nm and 440 nm, and the emission wavelength was 530 nm. The calibration procedure was exactly as described previously (41).

Statistics
The results are expressed as the mean ± SE. The [Ca2+]i- and the pHi-traces shown are representative traces of at least five independent experiments. The 3H-thymidine experiments, the IP3-experiments, and the cAMP-experiments, the Western blot experiments, and the RT-PCR experiments were repeated at least three times. Statistical analysis was made using Student’s t test for paired observations. When three or more means were tested, ANOVA was used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SPP increases intracellular free calcium in FRTL-5 cells
SPP has been shown to stimulate the release of sequestered calcium in several cell types (5, 18). We observed that, in FRTL-5 cells, SPP released sequestered calcium and stimulated calcium entry (Fig. 1AGo). The effect was dose dependent (Fig. 1BGo). The ED50 value for SPP was about 0.1 µM in a calcium containing buffer and about 0.1 µM in a calcium free buffer, respectively. Pretreatment of the cells with thapsigargin (Tg) depletes IP3-sensitive calcium stores in FRTL-5 cells (42). SPP apparently mobilized calcium from an IP3-sensitive calcium stores, as pretreatment of the cells with 2 µM Tg for 15 min abolished the SPP-evoked increase in [Ca2+]i (data not shown). Repeated applications of SPP to cells in a calcium-containing buffer resulted in a slightly attenuated response to SPP (data not shown). In cells incubated in a calcium-free buffer, the response was abolished after the third addition of SPP (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Effect of sphingosine 1-phosphate on [Ca2+]i in FRTL-5 cells. The cells were harvested and loaded with Fura 2 as described in Materials and Methods. A, Effect of 1 µM SPP on [Ca2+]i in cells incubated in a calcium-containing buffer (a), or in a calcium-free buffer (b). The horizontal bar denotes 1 min. B, Dose-dependent effect of SPP on [Ca2+]i in FRTL-5 cells incubated in a calcium-containing buffer ({square}), or in a calcium-free buffer ({blacksquare}). C, Effect of 1 µM SPP on [Ca2+]i in control cells ({blacksquare}), cells pretreated with 50 ng/ml Ptx for 24 h (), or cells pretreated with 200 nM PMA for 2 min (). The experiments were performed in calcium-containing buffer (Ca buffer), or in calcium-free buffer (Ca-free). Each point or bar denotes the mean ± SD of four to six separate determinations. *, P < 0.05 from respective control.

 
The SPP-evoked calcium entry was decreased in Ptx-treated cells but not the SPP-evoked release of sequestered calcium (Fig. 1CGo). Pretreatment with Ptx had no effect on the basal [Ca2+]i levels. In these cells, basal [Ca2+]i was 90 ± 9 nM and 58 ± 4 nM in a calcium-containing buffer and a calcium-free buffer, respectively. In control cells the values were 105 ± 21 nM and 60 ± 13 nM, respectively. Activation of protein kinase C inhibits G protein mediated signal transduction (43). Addition of PMA before stimulation with SPP decreased the entry of calcium, but not the SPP-evoked release of sequestered calcium (Fig. 1Go), suggesting that the SPP-evoked entry might be mediated via a G protein. Another possibility is that the decreased entry of calcium resulted from the PMA-evoked depolarization of the cells (44), and the concomitant decreased electrochemical gradient for calcium. PMA had no effect on basal [Ca2+]i in either a calcium-containing buffer (120 ± 11 nM, or in a calcium-free buffer (71 ± 32 nM). Taken together, our results thus suggest that SPP apparently can both mobilize calcium from an intracellular store and stimulate a substantial calcium entry in the cells. Part of this effect probably occurs independent of a G protein-mediated mechanism.

Lack of an effect of SPP on the production of inositol 1,4,5-trisphosphate in FRTL-5 cells
SPP has been shown to activate the production of IP3 in some cell types (15, 17). In cells stimulated with 0.5 µM SPP (i.e. the dose giving the maximal increase in [Ca2+]i), or with 5 µM SPP (i.e. the dose giving the maximal increase in 3H-thymidine incorporation) for 10 min, the amount of IP3 was 3488 ± 606 cpm/tube and 4172 ± 500 cpm/tube, respectively. In vehicle-treated cells, the result was 4628 ± 553 cpm/tube. Furthermore, if all the IP-metabolites, i.e. IP, IP2, and IP3 were summarized, SPP was without an effect, compared with control cells (data not shown). Our results thus suggested that the effect of SPP on [Ca2+]i was apparently mediated via a mechanism not involving the production of inositol phosphates.

Stimulatory effect of SPP on DNA synthesis in FRTL-5 cells
In Swiss 3T3 fibroblasts, SPP is a potent activator of DNA-synthesis and proliferation (5). In FRTL-5 cells, SPP activated the incorporation of 3H-thymidine in DNA in a time- and dose-dependent manner (Fig. 2Go). The maximal stimulation of 3H-thymidine incorporation occurred with 5 µM SPP, a dose 10-fold higher than the dose evoking maximal increase in [Ca2+]i. Usually at least a 48-h incubation with SPP was necessary to observe an enhanced incorporation of 3H-thymidine. The ED50 value for the SPP-evoked incorporation of 3H-thymidine was about 1 µM.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Stimulatory effect of SPP on the incorporation of 3H-thymidine in FRTL-5 cells. A, Cells grown first in 6H and then in 0H for 2 days were incubated with 3H-thymidine (0.4 µCi/ml) and either 5 µM SPP ({blacksquare}) or vehicle ({square}) for the times indicated. B, The cells were incubated with 3H-thymidine (0.4 µCi/ml) and increasing concentrations of SPP for 48 h. Each point gives the mean ± SD of triplicate dishes.

 
The effect of SPP may in part be dependent on a Ptx-sensitive G protein (14, 15). We investigated whether the effect of SPP on the incorporation of 3H-thymidine in FRTL-5 cells was mediated via a Ptx-sensitive pathway. Pretreatment of the cells with Ptx did not, however, inhibit the effect of SPP (Fig. 3Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Lack of an effect of Ptx on the SPP-evoked incorporation of 3H-thymidine in FRTL-5 cells. Cells grown first in 6H and then in 0H for 2 days were incubated with 3H-thymidine (0.4 µCi/ml) and either 5 µM SPP () or vehicle ({blacksquare}) for 48 h. Before an experiment, some of the cells were incubated with Ptx (50 ng/ml for 24 h; Ptx). Control cells (Control). Each bar gives the mean ± SD of triplicate dishes.

 
Activation of c-fos is of importance in the proliferation of thyroid cells (20, 45, 46). In Fig. 4AGo, we show that SPP stimulated the expression of a c-fos related protein in a time-dependent manner. Figure 4BGo shows the time-dependent expression of mRNA coding for c-fos mRNA in response to SPP.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. SPP stimulates the expression of c-fos in FRTL-5 cells. The cells were grown first in 6H and then in 0H for 2 days before an experiment. The cells were then stimulated with vehicle, or SPP (5 µM), and harvested as described in Materials and Methods. A, Time-dependent expression of a 62 kDa c-fos related protein. B, Expression of mRNA for c-fos in response to 5 µM SPP ({blacksquare}), or vehicle ({square}) using RT-PCR. The results are give as relative amounts of c-fos mRNA compared with mRNA for actin. Each experiment was repeated at least three times.

 
SPP activates a tyrosine kinase
We investigated whether SPP could stimulate DNA synthesis via activation of a tyrosine kinase. We observed that SPP in a time-dependent manner tyrosine-phosphorylated an approximately 66-kDa protein (Fig. 5Go). The densitometric data are given in Table 1Go. Further studies showed that the phosphorylation was abolished by genistein (Fig. 6Go). Pretreatment with Ptx did not inhibit the effect of SPP (Fig. 7Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. SPP-evoked tyrosine-phosphorylation of a 66 kDa protein in FRTL-5 cells. Cells grown first in 6H and then in 0H for 2 days were harvested as described in Materials and Methods, and stimulated with either 5 µM SPP, or vehicle for the times indicated. The experiment was repeated three times with identical results.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Densitometric quantitation of the pp66 phosphorylation

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Genistein inhibits the tyrosine phosphorylation evoked by SPP. Cells grown first in 6H and then in 0H for 2 days were harvested as described in Materials and Methods. Part of the cells were pretreated with genistein (30 µM for 30 min) before stimulation with 5 µM SPP for 15 min. The lower panel gives the densitometric data from three separate experiments. Relative density was determined by taking the basal phosphorylation at 15 min as 100%.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Lack of an effect of Ptx on the tyrosine phosphorylation evoked by SPP. Cells grown first in 6H and then in 0H for 2 days were harvested as described in Materials and Methods. Part of the cells had been incubated with Ptx (50 ng/ml) for 24 h. The cells were stimulated with 5 µM SPP for 15 min. The lower panel gives the densitometric data from three separate experiments. Relative density was determined by taking the basal phosphorylation at 15 min as 100%.

 
Pretreatment of the cells with genistein inhibited in part the SPP-evoked calcium entry but did not affect the mobilization of sequestered calcium (Fig. 8Go). Pretreatment with genistein did not affect the basal [Ca2+]i levels (110 ± 19 nM and 66 ± 11 nM in a calcium-containing buffer and a calcium-free buffer, respectively. In control cells, the corresponding values were 105 ± 21 nM and 60 ± 13 nM, respectively. Furthermore, in genistein-treated cells, the SPP-evoked incorporation of 3H-thymidine was decreased by 55% (data not shown). However, in control experiments genistein also significantly decreased both the PMA- and the TSH-evoked incorporation of 3H-thymidine (data not shown), rendering any conclusions on the importance of the SPP-evoked activation of the tyrosine kinase impossible to make.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 8. Effect of genistein on the SPP-evoked increase in [Ca2+]i. The cells were harvested and loaded with Fura 2 as described in Materials and Methods. Then the cells were stimulated with 1 µM SPP in a calcium-containing buffer (Ca buffer), or in a calcium-free buffer (Ca-free). Control cells ({blacksquare}), and cells treated with 30 µM genistein for 15 min (). Each bar gives the mean ± SD of three to five separate experiments.

 
We have recently shown that SPP activates Na+-H+ exchange in FRTL-5 cells (47). We next investigated whether this effect was mediated via activation of a tyrosine kinase. Pretreatment of the cells with 30 µM genistein for 15 min totally abolished the SPP-evoked activation of the Na+-H+ exchange (Fig. 9Go).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 9. Genistein inhibits the effect of SPP on Na+-H+ exchange in FRTL-5 cells. BCECF-loaded control cells (Control), or cells preincubated with 30 µM genistein for 15 min (Genistein) were acidified with nigericin (final concentration 1 µg/ml). Then vehicle ({blacksquare}) or 1 µM SPP () was added. The increase in pHi was measured after 1 min. Each bar is the mean ± SD of three to six separate determinations.

 
Lack of an effect of SPP per se on cellular cAMP in FRTL-5 cells
In airway smooth muscle cells, SPP inhibits the formation of cAMP (48). In FRTL-5 cells stimulated with 5 µM SPP, i.e. the dose stimulating maximal incorporation of 3H-thymidine, we could not detect any effects on cellular cAMP. However, this dose of SPP attenuated the TSH-evoked increase in cAMP (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of SPP on cellular cAMP in FRTL-5 cells

 
Effect of phosphatidic acid on [Ca2+]i and the incorporation of 3H-thymidine in FRTL-5 cells
The effect of SPP has been attributed, at least in part, to activation of phospholipase D and the production of phosphatidic acid (PA) (49). PA (final concentration 10 µg/ml) rapidly mobilized sequestered calcium. The increase in [Ca2+]i was 142 ± 7 nM in a calcium containing buffer, and 142 ± 19 nM in a calcium free buffer. However, no calcium entry was detected in response to PA. Furthermore, PA very modestly stimulated the incorporation of 3H-thymidine in FRTL-5 cells, and a significant effect was observed only after 48 h of incubation with 10 µg/ml (31072 ± 315 cpm/well, compared with 27123 ± 1137 cpm/well in control cells, P < 0.05). A higher dose of PA tested (30 µg/ml) did not further increase the incorporation of 3H-thymidine (data not shown). Longer incubations with PA were without an effect (data not shown). Furthermore, PA did not stimulate the expression of c-fos (data not shown). Thus, the effect of SPP was apparently not mediated via production of PA.

Lack of an effect of SPP on the release of arachidonic acid
In some cell types, sphingosine derivatives may activate phospholipase A2 and the release of arachidonic acid (7, 50). However, SPP did not stimulate the release of 3H-labeled arachidonic acid from FRTL-5 cells (160 ± 16 cpm, compared with 173 ± 17 cpm in control cells).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results in the present study show that SPP is a potent activator of calcium entry in FRTL-5 cells, whereas the mobilization of sequestered calcium by SPP was modest. Several sphingosine derivatives, including SPP, potently mobilizes sequestered calcium (4, 5, 6). Similar results have been obtained previously in FRTL-5 cells using SP and sphingosylphosphorylcholine (SPC) (7). Furthermore, Okajima et al. (29) recently showed that SPP increased [Ca2+]i in FRTL-5 cells, although the source of the Ca2+ was not further evaluated. Our present results suggest that SPP released sequestered calcium independently of an increase in inositol phosphates. This observation is in contrast to the observations made by Okajima et al. (29), who could show a clear effect of SPP on IP3 in their cells. Presently we have no explanation for the discrepancy in the results. A lack of an SPP-evoked increase in IP3 formation was also shown in skin fibroblasts (51) and in Swiss 3T3 fibroblasts (17). In these cells, as well as in HL60 leukemia cells, SPP also induced the formation of IP3, and this effect was attenuated by Ptx (15, 52), resulting in a potent attenuation of the SPP-evoked [Ca2+]i-response. Furthermore, the SPP-evoked increase in [Ca2+]i in HEK 292 cells was almost totally blocked by pretreatment with Ptx (53). Thus, these results strongly suggest that SPP may activate a receptor coupled to a Gi/Go protein. The partial inhibition of the SPP-evoked increase in [Ca2+]i that we observed in a calcium containing buffer in cells treated with Ptx suggests that some of the effects of SPP in FRTL-5 cells may be mediated via a Gi/Go protein. Similar results have also been seen in FRTL-5 cells by others (29). We have also shown recently that treatment with Ptx attenuated the SPC-evoked calcium entry in FRTL-5 cells (7). The PMA-evoked attenuation of the SPP-evoked calcium entry also suggests the involvement of a G protein, as activation of protein kinase C inhibits G protein-mediated signal transduction (43). Another possibility is that the decreased entry of calcium resulted from the PMA-evoked depolarization of the cells (44) and the concomitant decreased electrochemical gradient for calcium. The lack of an effect of either Ptx or PMA on the release of sequestered calcium suggests that some mechanisms other than those mediated via G proteins probably are involved. Thus, although a receptor-mediated event regulating SPP-evoked calcium fluxes is quite probable, it is important to note that the exact mechanism is presently unknown. Whether these fluxes are directly linked to the SPP-evoked release of sequestered endoplasmic calcium (see 18 , or to the recently cloned sphingolipid Ca2+ release-mediating protein (SCaMPER) from the endoplasmic reticulum (54) remains to be determined.

We also observed that SPP activated a tyrosine kinase(s), resulting in the phosphorylation of one or more 66-kDa proteins. Recent studies have suggested that tyrosine kinases are of importance in regulating calcium entry (55, 56) and that calcium entry can be blocked by the tyrosine kinase inhibitor genistein. Our results agree with these observations, as both the SPP-evoked the tyrosine phosphorylation of the 66-kDa protein and the SPP-evoked increase in [Ca2+]i was attenuated by genistein.

In addition to its action on [Ca2+]i, SPP is an activator of DNA synthesis in FRTL-5 cells. In Swiss 3T3 fibroblasts, in which SPP is a very potent mitogen (5), the mitogenic effect appears to be mediated via the MAP kinase pathway (14). This pathway seems to involve a Gi/Go protein, as the effect was sensitive to treatment with Ptx (14, 15). The results from our experiments suggest that the SPP-evoked DNA synthesis is not dependent on the activation of a Gi/Go protein, as the effect was insensitive to Ptx. In preliminary experiments, we observed that SPP phosphorylated MAP kinase p42 in our cells but that the effect was very modest and transient. Furthermore, the MAP kinase kinase inhibitor PD 098059 (57) did not inhibit the SPP-evoked incorporation of 3H-thymidine, although the effect of insulin, PMA, and serum was inhibited by this compound (Törnquist, K., unpublished observations). We also showed that genistein inhibited the SPP-evoked incorporation of 3H-thymidine. Genistein has recently been shown to inhibit tyrosine kinase-mediated mitogenic signals in FRTL-5 cells (58, 59). However, as genistein in control experiments inhibited the effects of both PMA and TSH on the incorporation of 3H-thymidine, any conclusions regarding the importance of a tyrosine kinase as a mediator of the SPP-evoked incorporation of 3H-thymidine is impossible to make.

One mechanism of action described for SPP is to stimulate phospholipase D and the production of phosphatidic acid (49). We cannot exclude the possibility that SPP may activate PLD and the production of PA in FRTL-5 cells. However, the weak effect of PA on both [Ca2+]i and on the incorporation of 3H-thymidine suggested that a possible SPP-evoked activation of PLD is of little importance for the SPP-evoked effects reported in the present study. Furthermore, SPP could stimulate the incorporation of 3H-thymidine via activation PKC, or via activation of adenylate cyclase and the production of cAMP. However, no reports are available showing an effect of SPP on PKC (see 60 . We could not observe an effect of SPP per se on cAMP, although SPP attenuated the TSH-evoked increase in cAMP, an effect also shown by others in FRTL-5 cells (29). A recent study in airway smooth muscle cells also showed that SPP in fact decreased the production of cAMP (48).

An Na+-H+ exchange mechanism exists in most cell types. This mechanism participates in a multitude of cellular events (61). Na+-H+ exchange has also been suggested to participate in the regulation of proliferation (62) (but see 63 . In FRTL-5 cells, this antiport may participate in the uptake of I- (64). Furthermore, mitogens like TSH, IGF-1, ATP, and phorbol myristyl acetate activate this exchange mechanism (41, 65, 66). We have recently observed that SPP is a potent activator of Na+-H+ exchange in FRTL-5 cells (47). Thus, it is possible that the SPP-evoked activation of Na+-H+ exchange may be part of the events initializing DNA synthesis. Furthermore, the SPP-evoked activation of Na+-H+ exchange was inhibited by genistein. Thus, the tyrosine kinase activated by SPP participates apparently in regulating both calcium entry and activation of Na+-H+ exchange. In conclusion, the results obtained in the present study show that SPP is a potent modulator of cellular events important for the regulation of proliferation in FRTL-5 cells. Although it is not yet known whether growth factors, like platelet-derived growth factor, can induce the synthesis of SPP in thyroid cells, the present study adds a new lipid derivative to the list of compounds modulating thyroid cell function.


    Acknowledgments
 
We wish to thank Ms. Satu Määttänen for excellent technical assistance.


    Footnotes
 
1 This study was supported by the Sigrid Juselius Foundation, the Liv och Hälsa Foundation, the Academy of Finland, and the Novo Nordisk Foundation, which is gratefully acknowledged. Back

Received December 17, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hannun YA, Bell RM 1989 Functions of sphingolipids and sphingolipid breakdown products in cellular regulation. Science 243:500–506[Abstract/Free Full Text]
  2. Breittmayer J-P, Bernard A, Aussel C 1994 Regulation by sphingomyelinase and sphingosine of Ca2+ signals elicited by CD3 monoclonal antibody, thapsigargin, or ionomycin in the Jurkat T cell line. J Biol Chem 269:5054–5058[Abstract/Free Full Text]
  3. Hudson PL, Pedersen WA, Saltsman WS, Liscovitch M, MacLaughlin DT, Donahoe PK, Blusztajn JK 1994 Modulation by sphingolipids of calcium signals evoked by epidermal growth factor. J Biol Chem 269:21885–21890[Abstract/Free Full Text]
  4. Ghosh T, Bian J, Gill DL 1990 Intracellular calcium release mediated by sphingosine derivatives generated in cells. Science 248:1653–1656[Abstract/Free Full Text]
  5. Zhang H, Desai NN, Olivera A, Seki T, Brooker G, Spiegel S 1991 Sphingosine-1-phosphate, a novel lipid, involved in cellular proliferation. J Cell Biol 114:155–167[Abstract/Free Full Text]
  6. Yule DI, Wu D, Essington TE, Shayman JA, Williams JA 1993 Sphingosine metabolism induces Ca2+ oscillations in rat pancreatic acinar cells. J Biol Chem 268:12353–12358[Abstract/Free Full Text]
  7. Törnquist K, Ekokoski E 1994 Effect of sphingosine derivatives on calcium fluxes in thyroid FRTL-5 cells. Biochem J 299:213–218
  8. McDonough PM, Yasui K, Betto R, Salvati G, Glembotski CC, Palade PT, Sabbadini RA 1994 Control of cardiac Ca2+ levels. Inhibitory actions of sphingosine on Ca2+ transients and L-type Ca2+ channel conductance. Circ Res 75:981–989[Abstract/Free Full Text]
  9. Törnquist K, Pasternack M, Kaila K 1995 Sphingosine derivatives inhibit depolarization-evoked calcium entry in GH4C1 pituitary cells. Endocrinology 136:4894–4902[Abstract]
  10. Zangh H, Buckley NE, Gibson K, Spiegel S 1990 Sphingosine stimulates cellular proliferation via a protein kinase C-independent pathway. J Biol Chem 265:76–81[Abstract/Free Full Text]
  11. Desai NN, Carlson RO, Mattie ME, Olivera N, Buckley NE, Seki T, Brooker G, Spiegel S 1993 Signaling pathways for sphingosylphosphorylcholine-mediated mitogenesis in Swiss 3T3 fibroblasts. J Cell Biol 121:1385–1395[Abstract/Free Full Text]
  12. Olivera A, Spiegel S 1993 Sphingosine-1-phosphate as second messenger in cell proliferation induced by PDGF and FCS mitogens. Nature 365:557–560[CrossRef][Medline]
  13. Su Y, Rosenthal D, Smulson M, Spiegel S 1994 Sphingosine 1-phosphate, a novel signaling molecule, stimulates DNA binding activity of AP-1 in quiescent Swiss 3T3 fibroblasts. J Biol Chem 269:16512–16517[Abstract/Free Full Text]
  14. Wu J, Spiegel S, Sturgill TW 1995 Sphingosine 1-phosphate rapidly activates the mitogen-activated protein kinase pathway by a G-protein-dependent mechanism. J Biol Chem 270:11484–11488[Abstract/Free Full Text]
  15. Goodemote KA, Mattie ME, Berger A, Spiegel S 1995 Involvement of a pertussis toxin-sensitive G protein in the mitogenic signaling pathway of sphingosine 1-phosphate. J Biol Chem 270:10272–10277[Abstract/Free Full Text]
  16. Zhang H, Desai NN, Murphey JM, Spiegel S 1990 Increase in phosphatidic acid levels accompany sphingosine-stimulated proliferation of quiscent Swiss 3T3 cells. J Biol Chem 265:21309–21316[Abstract/Free Full Text]
  17. Mattie M, Brooker G, Spiegel S 1994 Sphingosine-1-phosphate, a putative second messenger, mobilizes calcium from internal stores via an inositol trisphosphate-independent pathway. J Biol Chem 269:3181–3188[Abstract/Free Full Text]
  18. Ghosh TK, Bian J, Gill DL 1994 Sphingosine 1-phosphate generated in the endoplasmic reticulum membrane activates release of stored calcium. J Biol Chem 269:22628–22635[Abstract/Free Full Text]
  19. Vassart G, Dumont JE 1992 The thyrotropin receptor and the regulation of thyrocyte function and growth. Endocr Rev 13:596–611[CrossRef][Medline]
  20. Dumont JE, Maenhaut C, Pirson I, Baptist M, Roger PP 1991 Growth factors controlling the thyroid gland. Bailieres Clin Endocrinol Metab 5:727–754[Medline]
  21. Takada K, Amino N, Tada H, Miyai K 1990 Relationship between proliferation and cell cycle-dependent Ca2+ influx induced by a combination of thyrotropin and insulin-like growth factor-1 in rat thyroid cells. J Clin Invest 86:1548–1555
  22. Pang XP, Hershman JM 1990 Differential effects of growth factors on 3H-thymidine incorporation and 125I-iodine uptake in FRTL-5 rat thyroid cells. Proc Soc Exp Biol Med 194:240–244[Abstract]
  23. Burch RM, Luini A, Mais DE, Corda D, Vanderhoek JY, Kohn LD, Axelrod J 1986 Alpha1-adrenergic stimulation of arachidonic acid release and metabolism in a rat thyroid cell line. Mediation of cell replication by prostaglandin E2. J Biol Chem 261:11236–11241[Abstract/Free Full Text]
  24. Törnquist K, Ekokoski E, Dugué B 1996 ATP functions as a comitogen in thyroid FRTL-5 cells. J Cell Physiol 166:241–248[CrossRef][Medline]
  25. Brenner-Gati L, Berg KA, Gershengorn MC 1988 Thyroid-stimulating hormone and insulin-like growth factor-1 synergize to elevate 1,2-diacylglycerol in rat thyroid cells. Stimulation of DNA synthesis via interaction between lipid and adenylyl cyclase signal transduction systems. J Clin Invest 82:1144–1148
  26. Weiss SJ, Philp NJ, Grollman EF 1984 Effect of thyrotropin on iodide efflux in FRTL-5 cells mediated by Ca. Endocrinology 114:1108–1113[Abstract]
  27. Corda D, Marocci R, Kohn LD, Axelrod J, Luini A 1985 Association of the changes in cytosolic Ca and iodide efflux induced by thyrotropin and by the stimulation of alpha 1-adrenergic receptors in cultured rat thyroid cells. J Biol Chem 260:9230–9236[Abstract/Free Full Text]
  28. Berman MI, Thomas Jr CG, Nayfeh SN 1987 Stimulation of inositol phosphate formation in FRTL-5 rat thyroid cells by catecholamines and its relationship to changes in 45Ca2+ efflux and cyclic AMP accumulation. Mol Cell Endocrinol 54:151–163[CrossRef][Medline]
  29. Okajima F, Tomura H, Sho K, Kimura T, Sato K, Im D-S, Akbar M, Kondo Y 1997 Sphingosine 1-phosphate stimulates hydrogen peroxide generation through activation of phospholipase C-Ca2+ system in FRTL-5 thyroid cells: possible involvement of guanosine triphosphate-binding proteins in the lipid signaling. Endocrinology 138:220–229[Abstract/Free Full Text]
  30. Törnquist K, Saarinen P, Heiskanen M Sphingosine 1-phosphate mobilizes sequestered calcium, stimulates DNA synthesis, and activates Na-H exchange in thyroid FRTL-5 cells. Program of the 10th International Congress of Endocrinology, San Francisco, CA, 1996 (Abstract P2–144)
  31. Ambesi-Impiombato FS, Parks LAM, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 77:3455–3459[Abstract/Free Full Text]
  32. Gryenkiewicz G, Poenia M, Tsien RY 1985 A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260:3440–3450[Abstract/Free Full Text]
  33. Sho K, Okajima F, Majid MA, Kondo Y 1991 Reciprocal modulation of thyrotropin actions by P1-purinergic agonists in FRTL-5 thyroid cells. Inhibition of cAMP pathway and stimulation of phospholipase C-Ca2+ pathway. J Biol Chem 266:12180–12184[Abstract/Free Full Text]
  34. Oldham KG 1990 Polyphosphoinositide turnover. In: Hume EC (ed) Receptor-Effector Coupling. A Practical Approach. Oxford University Press, Oxford, New York, Tokyo, pp 99–117
  35. Valente WA, Vitti P, Kohn LD, Brandi M, Toccafondi R, Tramontano D, Azou SM, Ambesi-Impiombato FS 1983 The relationship of growth and adenylate cyclase activity in cultured thyroid cells: separate bioeffects of thyrotropin. Endocrinology 112:71–79[Medline]
  36. Di Girolamo M, A’Arcangelo D, Bizzarri C, Corda D 1991 Muscarinic regulation of phospholipase A2 and iodide fluxes in FRTL-5 thyroid cells. Acta Endocrinol (Copenh) 125:192–200[Medline]
  37. Okajima F, Sato K, Nazarea M, Sho K, Kondo Y 1989 A permissive role of pertussis toxin substrate G-protein in P2-purinergic stimulation of phosphoinositide turnover and arachidonate release in FRTL-5 cells. Cooperative mechanism of signal transduction systems. J Biol Chem 164:13029–13037
  38. Frandsen EK, Krishna G 1976 A simple ultrasensitive method for the assay of cyclic AMP and cyclic GMP in tissues. Life Sci 18:529–542[CrossRef][Medline]
  39. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acidic guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  40. Curran T, Gordon MB, Rubino KL, Sambucetti LC 1987 Isolation and characterization of the c-fos (rat) cDNA and analysis of post-translational modification in vitro. Oncogene 2:79–84[Medline]
  41. Törnquist K, Alinen S 1992 Characterization of Na+/H+ exchange in FRTL-5 thyroid cells. Evidence for dependence on activation of protein kinase C. Biochim Biophys Acta 1106:221–226[Medline]
  42. Törnquist K 1993 ATP-induced entry of calcium in thyroid FRTL-5 cells. Studies with phorbol myristate acetate and thapsigargin. Mol Cell Endocrinol 93:17–21[CrossRef][Medline]
  43. Nishizuka Y 1992 Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607–614[Abstract/Free Full Text]
  44. Törnquist K 1993 Modulatory effect of protein kinase C on thapsigargin-induced calcium entry in thyroid FRTL-5 cells. Biochem J 290:443–447
  45. Tramontano D, Chin WW, Moses AC, Ingbar SH 1986 Thyrotropin and dibutyryl cyclic AMP increases levels of c-myc and c-fos mRNAs in cultured rat thyroid cells. J Biol Chem 261:3919–3922[Abstract/Free Full Text]
  46. Isozaki O, Kohn LD 1987 Control of c-fos and c-myc proto-oncogene induction in rat thyroid cells in culture. Mol Endocrinol 1:839–848[Abstract]
  47. Törnquist K 1997 Sphingosine 1-phosphate activates Na+-H+ exchange in thyroid FRTL-5 cells. Am J Physiol 272:C1052–C1057
  48. Payne S, Payne NJ 1996 The differential regulation of cyclic AMP by sphingomyelin-derived lipids and the modulation of sphingolipid-stimulated extracellular kinase-2 in airway smooth muscle. Biochem J 315:917–923
  49. Desai NN, Zhang H, Olivera A, Mattie ME, Spiegel S 1992 Sphingosine-1-phosphate, a metabolite of Spingosine, increases phosphatidic acid levels by phospholipase D activation. J Biol Chem 267:23122–23128[Abstract/Free Full Text]
  50. Desai NN, Spiegel S 1991 Sphingosylphosphorylcholine is a potent mitogen for a variety of cell lines. Biochem Biophys Res Commun 181:361–366[CrossRef][Medline]
  51. Chao CP, Laulederkind SF, Ballou LR 1994 Sphingosine-mediated phosphatidylinositol metabolism and calcium mobilization. J Biol Chem 269:5849–5856[Abstract/Free Full Text]
  52. Okajima F, Tomura H, Sho K, Nochi H, Tamato K, Kondo Y 1996 Involvement of pertussis toxin-sensitive GTP-binding proteins in sphingosine 1-phosphate-induced activation of phospholipase C-Ca2+ system in HL60 leukemia cells. FEBS Lett 379:260–264[CrossRef][Medline]
  53. van Koppen CJ, Meyer zu Heringdorf D, Laser KT, Fhang C, Jakobs KH, Bünemann M, Pott L 1996 Activation of a high affinity Gi protein-coupled plasma membrane receptor by sphingosine-1-phosphate. J Biol Chem 271:1082–1087
  54. Mao C, Kim SH, Almenoff JS, Rudner XL, Kearney DM, Kindman LA 1996 Molecular cloning and characterization of SCaMPER, a sphingolipid Ca2+ release-mediating protein from endoplasmic reticulum. Proc Natl Acad Sci USA 93:1993–1996[Abstract/Free Full Text]
  55. Lee K-M, Toscas K, Villereal ML 1993 Inhibition of bradykinin- and thapsigargin-induced Ca2+ entry by tyrosine kinase inhibitors. J Biol Chem 268:9945–9948[Abstract/Free Full Text]
  56. Sargeant P, Farndale RW, Sage SO 1993 ADP- and thapsigargin-evoked Ca2+ entry and protein-tyrosine phosphorylation are inhibited by the tyrosine kinase inhibitors genistein and methyl-2,5-dihydroxycinnamate in Fura-2-loaded human platelets. J Biol Chem 268:18151–18156[Abstract/Free Full Text]
  57. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR 1995 A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92:7686–7689[Abstract/Free Full Text]
  58. Takano T, Takada K, Tada H, Nishiyama S, Amino N 1993 Genistein, a tyrosine kinase inhibitor, blocks the cell cycle progression but not Ca2+ influx induced by Bay k 8644 in FRTL-5 cells. Biochem Biophys Res Commun 190:801–807[CrossRef][Medline]
  59. Takano T, Takada K, Tada H, Nishiyama S, Amino N 1994 Genistein but not staurosporin can inhibit the mitogenic signal evoked by lithium in rat thyroid cells (FRTL-5). J Endocrinol 143:221–226[Abstract]
  60. Spiegel S, Milstein S 1995 Sphingolipid metabolites: members of a new class of lipid second messengers. J Membr Biol 146:225–237[Medline]
  61. Grinstein S, Rothstein A 1986 Mechanism of regulation of the Na+/H+ exchanger. J Membr Biol 90:1–12[CrossRef][Medline]
  62. Grinstein S, Rotin D, Mason MJ 1989 Na/H exchange and growth factor-induced cytosolic pH changes. Role in cellular proliferation. Biochim Biophys Acta 988:73–97[Medline]
  63. Ganz MB, Boyarsky G, Sterzel RB, Boron WF 1989 Arginine vasopressin enhances pHi regulation in the presence of HCO3- by stimulating three acid-base transport systems. Nature 337:648–651[CrossRef][Medline]
  64. Marcocci C, Grollman EF 1988 Sodium/proton exchange in the maintenance of intracellular pH in FRTL-5 thyroid cells. Endocrinology 123:1705–1711[Abstract]
  65. Woods DJ, Soden J, Tomlinson S, Bidey SP 1990 Transmembrane Na/H exchange in the rat thyroid cell strain FRTL-5: a possible role in insulin-like growth factor-I mediated proliferation. J Mol Endocrinol 4:177–185[Abstract]
  66. Takasu N, Komiya I, Nagasawa Y, Asawa T, Shimizu Y, Yamada T 1991 Interrelationship between insulin-like growth factor I-induced activation of the Na+/H+-antiporter and intracellular Ca2+-mobilization in thyroid cells. Biochem Biophys Res Commun 177:113–119[CrossRef][Medline]



This article has been cited by other articles:


Home page
FASEB J.Home page
H. M. ROSENFELDT, Y. AMRANI, K. R. WATTERSON, K. S. MURTHY, R. A. PANETTIERI JR, and S. SPIEGEL
Sphingosine-1-phosphate stimulates contraction of human airway smooth muscle cells
FASEB J, October 1, 2003; 17(13): 1789 - 1799.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. T. Windh, M.-J. Lee, T. Hla, S. An, A. J. Barr, and D. R. Manning
Differential Coupling of the Sphingosine 1-Phosphate Receptors Edg-1, Edg-3, and H218/Edg-5 to the Gi, Gq, and G12 Families of Heterotrimeric G Proteins
J. Biol. Chem., September 24, 1999; 274(39): 27351 - 27358.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. An, T. Bleu, and Y. Zheng
Transduction of Intracellular Calcium Signals through G Protein-Mediated Activation of Phospholipase C by Recombinant Sphingosine 1-Phosphate Receptors
Mol. Pharmacol., May 1, 1999; 55(5): 787 - 794.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Tornquist, A.-M. Malm, M. Pasternack, R. Kronqvist, S. Bjorklund, R. Tuominen, and J. P. Slotte
Tumor Necrosis Factor-alpha , Sphingomyelinase, and Ceramide Inhibit Store-operated Calcium Entry in Thyroid FRTL-5 Cells
J. Biol. Chem., April 2, 1999; 274(14): 9370 - 9377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Törnquist, K.