help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garcia, L.
Right arrow Articles by Sartor, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garcia, L.
Right arrow Articles by Sartor, P.
Endocrinology Vol. 138, No. 10 4191-4198
Copyright © 1997 by The Endocrine Society


ARTICLES

Regulation of Intracellular pH in Rat Lactotrophs: Involvement of Anionic Exchangers1

L. Garcia, E. Boué-Grabot, M. Garret and P. Sartor

Departement de Fisiologia, Facultad de Salud, Universidad del Valle (L.G.), AA 25 360 Cali, Columbia; and CNRS UMR 5543, Université Victor Segalen Bordeaux 2 (E.B.-G., M.G., P.S.), 33076 Bordeaux, France

Address all correspondence and requests for reprints to: Dr. P. Sartor, CNRS UMR 5543, Université Victor Segalen Bordeaux 2, 146 rue Léo Saignat, 33076 Bordeaux Cedex, France. E-mail: bdneuro{at}umr5543.u-bordeaux2.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Regulation of the intracellular pH (pHi) of normal rat lactotrophs was studied. As this cell type, cultured with 10% FCS, can achieve a relatively alkaline pHi (7.3–7.5), we investigated the presence of a mechanism based on Cl-/HCO3- exchange. Using the pHi-sensitive probe SNARF-1 (seminaphtorodafluor) in its permeant form, SNARF-1/AM, we studied pHi recovery after acidic loading in individual cells with a microspectrofluorometric approach. We showed the involvement of anionic exchange in lactotroph cell pHi regulation. Acute CO2-bicarbonate cell acidic loading combined with external Cl- depletion induces the activation of a Cl-/HCO3- exchange. This exchange is 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid sensitive and corresponds to the type 3 anionic exchanger (AE3). However, after nigericin acidification, Na+/H+ exchange can also participate in recovery. In addition, incubation experiments strongly suggest that a 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid-insensitive anionic exchanger (type 2 anionic exchanger or AE2) is present in rat lactotrophs. The presence and involvement of carbonic anhydrase in pHi regulation have been demonstrated. Finally, using Northern blot and reverse transcription-PCR techniques, messenger RNAs for both AE2 and AE3 were identified in anterior pituitary cell extracts. We concluded that in normal rat lactotrophs, pHi regulation is achieved by a complex system in which Cl-/HCO3- exchange has a pivotal role.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CHLORIDE IONS (Cl-) are involved in several important cellular functions, including cell excitability (1, 2), volume regulation (3), and intracellular pH (pHi) regulation (4). In pituitary cells, more particularly in lactotrophs, Cl- transport mediated by systems other than ion channels has not received enough attention. We and others have shown that in tumoral mammosomatotroph cell lines, pHi alkalinization is achieved through an Na+/H+ exchanger, working for acidic pHi around or below 7.2 (5, 6, 7). As normal lactotrophs cultured with FCS can have a substantially higher pHi than those for which Na+/H+ exchange has been described (8), we investigated the presence of anionic exchangers (AE; Cl-/HCO3-) in normal rat lactotrophs. Such a system, which could simultaneously participate in pHi and [Cl-]i regulation and be linked to cell metabolism, is described in this paper. In the present experiments, the Cl-/HCO3- cotransport induces an acid extrusion. Some of these results were presented at the 10th International Congress of Endocrinology (9).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
Primary anterior pituitary cell cultures were prepared using the technique previously described (10). Briefly, anterior lobes were separated from intermediate and posterior lobes of lactating Wistar female rat glands obtained after decapitation. Cells were dispersed according to the collagenase technique and plated on 30-mm glass coverslips treated with polyornithine and seeded on the bottom of 33-mm petri dishes. Cells were cultured with DMEM/F-12 (Seromed, Polylabo, Strasbourg, France) complemented with 10% FCS (Seromed) and gentamicin (0.05 mg/ml) for the first 24 h. Cells were used between the fourth and the seventh day. The medium was changed 24 h before the beginning of the experiments.

pHi measurements
pHi was estimated by the fluorescence technique proposed by Mariot et al. (8) using the fluorescent probe seminaphtorodafluor (SNARF-1, Molecular Probes Europe, Leiden, The Netherlands). Cells incubated for 30 min at 35 ± 1 C with the permeant form of the dye SNARF-1/AM were rinsed and transferred on their coverslips in a pierced petri dish. Recordings were made using the system described for intracellular Ca2+ measurement (11), which consisted of a Nikon epifluorescence microscope equipped for microspectrofluorometry (Nikon, Tokyo, Japan). Excitation wavelength was set at 514 (10-nm band width), and emission centered at 580 nm for the acidic form of the probe and at 640 for the alkaline form. The ratio F = 580/640 was recorded on line using an analog divider. As a linear relationship exists between ratio and pHi between pH 6.5–8.5 (8), we then deduced the pHi of individual cells. Ratio traces were obtained on a Gould paper chart recorder or on a Gould Windograf recorder (Gould, Ballainvilliers, France).

In all cases, the temperature of the petri dishes during recording was kept at 36 ± 1 C. The medium was changed every 15–20 min. The medium was preheated when perifusion experiments used CO2-gassed medium. Lactotrophs were identified as previously described (10, 12). Using this protocol, approximately 90% of the recorded cells were lactotrophs (12). Moreover, our preliminary single cell reverse transcription-PCR (RT-PCR) experiments with PRL oligonucleotide primers showed that more than 90% of the recorded cells contained PRL messenger RNA (mRNA; our unpublished results).

Media
Medium composition was derived from the following Hanks’ balanced salt solution 138 mM NaCl, 4 mM KCl, 10 mM HEPES, 2 mM MgCl2, 2 mM CaCl2, 10 mM glucose, 0.13 mM NaHPO4, 0.2 mM KH2PO4, and 4 or 10 mM NaHCO3 buffered to pH 7.35 by air containing 5% CO2. Osmolality was adjusted to 310–320 mosmol/liter. All reagents were of analytical grade (Sigma, Saint Quentin Fallavier, France).

Two low chloride solutions were used in which NaCl was completely replaced by Na methane sulfonate. In free Cl- (0 Cl-) solutions, KCl, MgCl2, and CaCl2 were, respectively, substituted by potassium methane sulfonate, magnesium sulfate, and calcium gluconate, whereas they were not in 12-mM Cl- solutions. When low Cl-, low Na+ solutions were needed, NaCl was replaced by mannitol (137 mM). The main protocols used in our experiments were designed to enable the exchange of intracellular chloride for extracellular bicarbonate. When acute effects were studied, the medium surrounding the recorded cell was changed by local perifusion of the experimental medium.

In some instances, nigericin acidification was also induced to study acid charge recovery mechanisms (13).

Cytochemistry of carbonic anhydrase (CA)
The colorimetric technique of Dobyan et al. (14) derived from that proposed by Diddensträle (15) was performed. Briefly, cells grown on 10-mm glass coverslips in 24-well culture plates were fixed on day 5 or 6 of culture with Zamboni fixative. Coverslips bearing cells were then rinsed with a phosphate buffer (pH 7.5) containing 0.2% of Triton X-100. The cells were incubated for 5 min with a medium of the following composition: 17 ml of a solution containing 10 ml cobalt sulfate (0.2 M), 60 ml sulfuric acid (0.5 M), and 100 ml potassium phosphate (0.066 M) mixed with 40 ml of a sodium bicarbonate solution (0.22 M). The cells were then rinsed with phosphate buffer (pH 5.9) and treated for 3 min with the final solution obtained by filtration of ammonium sulfide (0.5%) in the presence of cobalt sulfide. The CA appeared as black staining in the cells. Cobalt sulfate, cobalt sulfide, and ammonium sulfide were obtained from Strem Chemical (Bischeim, France).

Northern blot analysis and PCR
Total RNA samples from rat anterior pituitaries were prepared using the Chomczynski and Sacchi method (16). For each of these samples, 5 µg (total RNA) were submitted to reverse transcription using Moloney murine leukemia virus SuperScript reverse transcriptase (Life Technologies, Cergy-Pontoise, France) in a 20-µl final volume. Then, a 1-µl aliquot was taken for the PCR reaction with AE primers deduced from the sequences of the rat anion exchanger mRNAs. In parallel, 5 µg total RNA were diluted in 20 µl TE (Tris-EDTA), and 1 µl of these dilutions was subjected to identical amplification. The following oligonucleotide primers from published sequences were used: for AE1 (17): sense, TCGTCCACATCTCTCTTACCTC; antisense, TCTGTCATGAGAGTTGCTGCAG; for AE2 (18): sense, CTCATATCACTCATCTTCCTCT; antisense, GACGCACTGCTGTTGTCTGGT; and for AE3 (18): sense, GATGCACTGCACTCTCAGTGT; antisense, CTGAGCTCGGCAGAACTTGAA. The DNA fragments were amplified using the following protocols: for AE1: denaturation for 30 s at 95 C, annealing for 30 s at 60 C, and extension for 45 s at 72 C for 35 cycles; for AE2: 30 s at 95 C, 30 s at 60 C, and 30 s at 72 C for 35 cycles; and for AE3: 30 s at 95 C, 30 s at 55 C, and 30 s at 72 C for 35 cycles.

For Northern blot analysis, polyadenylated RNA was isolated using a mRNA purification kit (Pharmacia). The polyadenylated RNA samples were separated in a 1.2% agarose gel containing 2.2 M formaldehyde and transferred to Hybond N membranes (Amersham, Les Ullis, France) in a solution of 20 x SSPE (sodium, sodium-phosphate, EDTA). Prehybridization and high stringency hybridization were carried out according to the manufacturer’s instructions. Synthesis of complementary DNA (cDNA) probes was performed by PCR, and labeling was performed using a random primers DNA labeling kit (BRL, Gaithersburg, MD) and a [32P]deoxy-CTP (3000 Ci/mmol; 10 mCi/ml; Amersham). Filters were then exposed to x-ray films for 4–8 days.

Statistical analysis
The statistical difference between control and test groups was assessed by ANOVA and Fisher’s least significant posttest (19). Results were expressed as the mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Acute pHi responses to CO2-bicarbonate (CO2-bic) exposure
We examined pHi transient changes in response to external addition of CO2-bic. The cells were initially bathed in normal external medium (pHe 7.3) with no bicarbonate. They displayed a mean basal pHi estimated at 7.48 (7.48 ± 0.09; n = 7). Acute exposure to the CO2-bic-containing medium induced a fast and transient acidification (-0.23 ± 0.05 pH unit; n = 7) due to passive entry of CO2 into the cell, with subsequent hydration to form carbonic acid and dissociate in H+ and HCO3-. The initial acidification was followed by a slow pHi recovery to a new steady state level of pHi. This alkalinization was maintained during application of the CO2-bic solution. A pronounced alkalinization of pHi was observed due to outflow of CO2 ({Delta} alkalinization = +0.37 ± 0.06 pH unit) at the end of exposure to CO2-bic followed by a return to the CO2-bic-deprived medium. The return to the basal level was very slow, as shown in Fig. 1AGo.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Acute effects of chloride and CO2-bic (Bic) gradient changes on lactotroph pHi. External medium (EM) contained 149 mM Cl-, 0 mM Na+-bic, and 10 mM HEPES. Temperature was set at 36 ± 1 C. A, After the initial acidification due to the application of CO2-bic-enriched EM, pHi tended to recover by the activation of alkalinization (7 cells of 8). B, Effects of Cl- and CO2-bic gradient changes on pHi. Thirty-six cells of 45 displayed alkalinization after the initial acidification. In both experiments, a change in the EM in the immediate vicinity of the recorded cells was obtained by pressure injection of the tested medium contained in a micropipette.

 
Regulation of pHi after nigericin acidification
A second way to demonstrate the importance of bicarbonate in pHi regulation was tested using nigericin acidification, as proposed by Frelin et al. (13). When acidification was induced by nigericin (10 µM) in the presence of 5 mM KCl, recovery for every cell was no longer possible when bicarbonate was withdrawn from the external medium (13 of 32 cells). Conversely, recovery occurred in the presence of bicarbonate (17 of 19 cells). It thus appeared that bicarbonate was involved in pHi regulation. Likewise, it appeared that a mechanism independent of Cl-bic exchange (Na+/H+) was also involved in pHi regulation. This aspect is studied below.

Role of Cl- in pHi recovery
To study chloride ion participation in pHi recovery, we decreased external chloride during CO2-bic exposure. We showed that the application of a chloride-free, CO2-HCO3--containing solution stimulated pHi recovery from acidification (Fig. 1BGo). The amplitude of alkalinization increased up to +0.50 ± 0.03 (n = 10 cells; this value corresponds to pHi 5 in Fig. 2Go). Basal pHi was 7.38 ± 0.05 (n = 10 cells).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Effect of DIDS (100 µM) on alkalinization. External medium (EM) is defined in Fig. 1Go. The mean basal pHi was 7.38 ± 0.03 (n = 10). A and B, Injection of 0 Cl- and 10 mM bicarbonate, either alone or supplemented with 100 mM DIDS. The injections were alternatively reversed. Inset, Quantitative study of the responses. {Delta}pHi1 = -0.29 ± 0.02; {Delta}pHi2 = -0.05 ± 0.02; {Delta}pHi3 = -0.33 ± 0.02; {Delta}pHi4 = +0.100 ± 0.01; {Delta}pHi5 = +0.507 ± 0.03 U pHi.

 
Specificity of the anionic exchanger
In additional experiments, we applied an AE inhibitor, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS; 100 µM). In fact, DIDS was able to block pHi recovery during and after CO2-HCO3- acute exposure in chloride-free solutions (Fig. 2Go). The action of DIDS was reversible, as shown in Fig. 2BGo. The mean pHi unit changes in response to acid loading and the efficiency of the inhibitory effect of DIDS are illustrated in Fig. 2BGo.

Cooperation between Na+/H+ and Cl-/HCO3-
To investigate the possible involvement of the Na+/H+ cotransporter in pHi regulation of lactotrophs, we examined the effect of the substitute for amiloride, 5-(N-ethyl-N-isopropyl (EIPA). This molecule was described as a specific blocker of the Na+/H+ exchange (20, 21), and we tested its effect on basal pHi and on pHi recovery after nigericin acidification in both the absence and presence of bicarbonate.

Under these conditions, when EIPA (50 µM) was acutely injected into lactotrophs, it always induced acidification (pHi 7.34 ± 0.05 in control and 7.16 ± 0.045 after EIPA; n = 10; P < 0.05; Fig. 3Go, A1 and A2). After acidification induced by nigericin (10 µM), 8 cells of 16 did not recover (Fig. 3BGo1). Among the 8 remaining cells, EIPA totally blocked recovery after acidification (Fig. 3Go, B2 and B3). On the contrary, the acute injection of bicarbonate (10 mM in the bathing medium) started the alkalinization recovery process (Fig. 3CGo) for cells unable to regain their basal pHi and increased the recovery rate for all cells. We found that for 7 cells with a recovery rate of 0.09 ± 0.01 pHi U/min in the absence of bicarbonate, the rate increased to a level of 0.16 ± 0.02 pHi U/min when bicarbonate was added (P < 0.05). These results clearly demonstrated the possibility of cooperation between Na+/H+ and the pHi-regulating system involving bicarbonate.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. pHi recovery after nigericin acidification for cells bathing in different external media (EM). A, In an external bicarbonate-free medium, acute acidification is induced by ethylisopropylamiloride (EIPA; 50 µM) on basal pHi. B, In the absence of exogenous bicarbonate in the EM, recovery is different according to the cells. 1, Absence of recovery; 2 and 3, relatively slow or fast alkalinization is blocked by EIPA. C, In the absence of recovery, the injection of CO2-bic (10 mM) promotes rapid alkalinization.

 
The acute effect of EIPA was confirmed in incubation experiments in which lactotrophs in the presence of 50 µM EIPA were significantly acidified compared with the control cells in normal external medium (140 mM Cl-) without bicarbonate [pHi 7.39 ± 0.02 (n = 20) in controls vs. 7.28 ± 0.02 (n = 30); P < 0.01].

Involvement of CA
CA is the main cellular enzyme regulating the intracellular equilibrium (CO2 + H2O {iff} H2CO3 {iff} H+ + HCO3-), so CA must be found in cells where bicarbonate homeostasis has specific regulation mechanisms. The first demonstration of the role of this enzyme is its inhibition by acetazolamide (22). In fact, when lactotrophs were incubated for 4 h in the presence of 0.1 mM acetazolamide, they were then unable to develop alkalinization, and only a slight and slow acidification induced by CO2 was observed (Fig. 4AGo) This slow acidification should correspond to the decrease in CO2 entry in the absence of CA. Conversely, the same cells treated with acetazolamide and left 24 h to recover in normal medium were able to respond by alkanization after acid loading (Fig. 4BGo). We then tested the effect of acetazolamide on steady state pHi. When lactotrophs were incubated in the presence of the AC blocker (0.1 mM) for 15–20 min, pHi dropped by about 0.2 pHi units [7.19 ± 0.023 (n = 25) vs. 7.37 ± 0.038 (n = 20) in control conditions; Fig. 4CGo]. We thus suggest that Cl-/HCO3- exchanger(s) can monitor pHi, at least for values above 7.2.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4. Involvement of CA. A, Before monitoring pHi, cells were incubated in the presence of acetazolamide (100 µM) for 4 h. Transient exposure to CO2-bic in Cl--free external solution induced only a slight and slow acidification (all 10 cells). B, Cells treated for 4 h with acetazolamide were left to recover for 24 h. The same exposure as in A induced cell alkalinization (6 of 7 cells). C, Under basal conditions, a 20-min incubation of lactotrophs with acetazolamide was followed by acidification [pHi 7.19 ± 0.023 (n = 25 cells; C2) vs. 7.37 ± 0.038 in control cells (n = 20 cells; C1)]. *, P < 0.05 vs. control.

 
To pursue investigations on CA, we used the cytochemical characterization developed by Dobyan et al. (14). With this staining procedure, cells possessing CA turned black (Fig. 5Go). Controls were made to check that in the absence of the substrate (bicarbonate; Fig. 5BGo1) or in the presence of acetazolamide (Fig. 5CGo1), the black staining did not develop as it did in untreated cells (Fig. 5AGo1). This technique is not quantitative, and the difference in staining intensity between cells more likely reflects morphological variations than changes in the CA content.



View larger version (125K):
[in this window]
[in a new window]
 
Figure 5. Cytochemistry of CA (magnification, x200). A1, In the presence of the substrate (bicarbonate), the existence of CA is shown by black staining. B1, Control incubated without bicarbonate. C1, Control incubated in the presence of acetazolamide (10 µM). A2, B2, and C2, Micrographs of the same areas as in A1, B1, and C1, respectively, in phase contrast.

 
These results constitute convincing evidence for the presence of a Cl-/HCO3- exchanger in rat lactotrophs. However, acute and sustained effects must be compared. This is why we undertook a series of experiments in which pHi was measured 10–20 min after the beginning of incubation under different conditions.

Incubation experiments (steady state pHi shifts)
Effect of DIDS.
As with acute effects, a new steady state pHi was obtained by relatively long incubation (15 min) with bicarbonate-containing solutions in a chloride-free medium (Fig. 6Go). When incubated in a 0 Cl-, 10 mM CO2-bic bathing solution (Fig. 6AGo), cells exhibited the previously observed alkalinization (pHi 7.87 ± 0.023 compared with controls: pHi 7.38 ± 0.025; n = 20 cells). The histogram of the alkalinized cells was characterized by a monomodal curve (Fig. 6BGo1).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Effects of DIDS (100 µM) in incubation experiments. A, Effect of DIDS after Cl- and bicarbonate gradients change. 1, Control (150 Cl--0 bicarbonate; pHi 7.38 ± 0.025; n = 20 cells). 2, Incubation in an external medium (EM) containing 0 Cl- and 10 mM bicarbonate (pHi 7.87 ± 0.023; n = 20 cells). 3, DIDS (100 µM) was added to the EM used in 2 (pHi 7.68 ± 0.03; n = 29 cells). B, Population histogram. B1, Alkalinized cells. B2, Cells treated with DIDS showing a bimodal distribution.

 
We then examined the effect of the application of DIDS together with a low Cl-, high bicarbonate medium. The addition of DIDS did not provide a full blockade of the induced alkalinization (Fig. 6AGo; pHi 7.68 ± 0.03; n = 29 cells). A scattering of individual values indicated a heterogeneity within the analyzed cells and is represented in a bimodal curve probably corresponding to two populations, separated according to their sensitivity to DIDS (Fig. 6BGo2). In fact, alkalinized cells fitted into a Gaussian distribution (>68% of the cells were within the mean pHi ±1 SD limits). On the contrary, DIDS-treated cells did not fit a Gaussian curve. We separated two populations above and below the mean pHi (7.68), and each of them fitted a Gaussian curve.

Effects of dinitrophenol (DNP).
To determine whether the exchanger was ATP dependent, we tested the effect of DNP (0.5 mM) on the alkalinization inducible by Cl-/HCO3- gradient changes (Fig. 7Go). We found that lowering ATP with DNP resulted in the inhibition of cellular alkalose. The mean pHi also dropped to 7.35 ± 0.045 (n = 15) after 15–20 min of incubation with 0 Cl- and 10 mM bicarbonate compared with 7.35 ± 0.041 for cells bathing in 150 mM Cl- and 0 bicarbonate (n = 12). When DNP was omitted, pHi rose to 8.00 ± 0.033 (n = 16).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 7. Effect of DNP (500 µM) in incubation experiments. The alkalinization induced by external medium (EM; 0 Cl--10 mM bicarbonate) in 2 (pHi 8 ± 0.033; n = 16), compared with that in control medium in 1 (150 Cl--0 bicarbonate; pHi 7.35 ± 0.041; n = 15 cells), is blocked by DNP (pHi 7.35 ± 0.045; n = 15 cells). *, Significantly different from the control (P < 5%).

 
Na+ dependence.
Finally, we examined the possible Na+ dependence of the exchanger by incubating the cells in a 0 Cl-, 10 mM bicarbonate external medium to which amiloride (100 µM) was added. Under these conditions, the presence of amiloride failed to inhibit alkalinization (pHi 7.86 ± 0.02; n = 20 cells). However, this is not surprising, because Na+/H+, blocked by amiloride, is not activated for alkaline pHi. We also studied the effect of extracellular Na+ on the pHi response. Lowering Na+ to 10 mM had an equivocal effect on the induced alkalinization (pHi 7.67 ± 0.05; n = 25) for cells bathing in 0 Cl-, 10 mM Na+, and 10 mM bicarbonate, and 7.33 for control cells bathing in a normal NaCl, 0 bicarbonate medium. The intermediary value obtained for pHi of cells bathing in 0 Cl-, low Na+ medium (7.67) indicates the presence of cells with a pHi under 7.5 (6 cells of 25), in which alkalinization was apparently inhibited, and cells in which alkalinization was not at all or not entirely blocked.

These observations led us to determine the nature of the exchanger present in the lactotrophs. We used the PCR and Northern blot techniques to identify the nature of mRNA present in the anterior pituitary lobe. This approach has its limits due to the heterogeneity of the gland cell types. However, it will at least confirm the presence of the exchanger(s) in the anterior pituitary in vivo.

Northern blot and PCR analyses of anionic exchanger(s) in the pituitary
To examine the expression of anion exchangers, Northern blots with polyadenylated RNAs from rat tissues were hybridized with probes derived from AE2 (Fig. 8AGoa), AE3 (Fig. 8AGob), and AE1 (not shown) cDNA sequences (17, 18). A mRNA of approximately 4.4 kilobases was detected in all tissues examined with the AE2-specific probe. The pituitary displayed a level of expression equivalent to those found in brain, cerebellum, and retina tissue, whereas a weak signal was detected in heart tissue and in the {alpha}T3 cell line. Northern hybridization with an AE3 probe revealed a strong signal with heart and brain mRNAs, as previously observed (17), as well as pituitary mRNAs. A faint signal was obtained with retina mRNA. No signal was obtained in any of the tissues tested with the AE1-specific probe (not shown). This indicates a low or very low level of expression of this mRNA, which is mainly expressed in kidney and spleen tissue (18).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 8. Northern blot (A) and RT-PCR (B) analysis of AE1–3 RNAs. A, Polyadenylated RNAs were extracted from brain (lane 1), cerebellum (lane 2), retina (lane 3), antepituitary (lane 4), an {alpha}T3 cell line (lane 5), and heart (lane 6). RNAs were loaded on the gel, electrophoresed, transfered, and subjected to RNA hybridization analysis. Northern blot membranes were hybridized, stripped, and reprobed with successive probes derived from AE2 and AE3 cDNA sequences. A, A glyceraldehyde-3-phosphate dehydrogenase (G3PDH) probe was used to control the variation in sample loading. B, PCR amplification products of AE1, AE2, and AE3 sequences were resolved by electrophoresis in 2% agarose. Lanes 0 correspond to the control, where no template was added; lanes 1 correspond to the control with RNA as template; and lanes 3 correspond to pituitary cDNA amplification. The estimated sizes for each band shown on the right were determined using a RNA (A) or DNA (B) ladder.

 
A RT-PCR experiment with specific primers for the three anion exchangers was performed. A very faint band was obtained with specific primers for AE1, indicating a very low or nonsignificant level of expression in the pituitary. On the contrary, a strong signal was observed with AE2- or AE3-specific primers (Fig. 8BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we report on the existence of Cl-/HCO3- exchanger(s) in normal rat lactotrophs. The importance of chloride ions is demonstrated by increased pHi recovery after removing extracellular chloride. The Cl-/HCO3- exchange is activated for acidic pHi and promotes the pHi regulation of cells exposed to acid loading. In some cells it may cooperate with the Na+/H+ exchanger. This, or one of these anionic exchangers, is DIDS sensitive and could then be ascribed to the AE3 subtypes. Its blockade by acetazolamide together with the presence of CA in lactotrophs show that the Cl-/HCO3- exchangers can play an important physiological role. In incubation experiments the induced alkalinization was not inhibited in all the cells by DIDS, suggesting that in addition to the AE3 exchanger, another mechanism regulates pHi in pituitary cells. Finally, the demonstration that mRNAs for AE3 as well as those for AE2 are present in the anterior pituitary cells confirms the validity of our proposal. However, complementary experiments with single cell PCR will be necessary to verify that the same cell may contain both mRNAs.

In the literature, the only mechanism for pHi regulation in lactotrophs is mainly described in studies reported in the mammosomatotroph tumoral cells line (GH3). Hallam and Tashjian (5) and Törnquist and Tashjian (6) demonstrated that nigericin-acidified GH4/C1 cells were able to develop a Na+/H+ cotransport that alkalinized the cytosol. In normal bovine lactotrophs, Zorec et al. (23) suggested that Na+/H+ exchange might be present, because recovery from acid load was Na+ sensitive. In our laboratory, we have shown that the Na+/H+ exchanger was activated during the secretion-coupling sequence induced by TRH in GH3 cells (7). Thus, the presence of a Cl-/HCO3- exchanger and its ability to regulate pHi in normal lactotrophs might be regarded as a significant difference between normal and tumoral lactotrophs. However, the absence of Cl-/HCO3- in GH3 remains to be demonstrated. We tested the changes in both Cl- and HCO3- gradients in GH3 cells without inducing any alkalinization (not shown). The presence of Na+/H+ in normal lactotrophs together with Cl-/HCO3- must be regarded as the need for maximal security in the regulation of pHi.

The technique used to demonstrate the presence of AE in rat lactotrophs was reported by Boron and de Weer in the squid giant axon (24). Our results can be compared with those reported in this pioneering work as well as with those on snail neurons reported by Thomas (25). The mechanisms are similar to those proposed by these researchers. At the beginning of the exposure to CO2, an acidification is produced by CO2 influx. An influx of HCO3- and an efflux of Cl- develop simultaneously, corresponding to the activation of the anionic exchanger, resulting in a slow alkalinization. It is blocked by DIDS. Upon the removal of CO2, the intracellular excess of HCO3- combines with H+ to give H2O and CO2, which diffuses rapidly out of the cell across the membrane, inducing a fast alkalinization. Russel and Boron (26) have also proposed such a mechanism. However, the observed overshoot results in an increased pHi. The proposal of a simultaneous proton pumping out of the cell can explain this overshoot, as discussed by Boron and de Weer (24).

The participation of chloride ions is demonstrated by facilitating pHi recovery after removing extracellular chloride, thus inducing an increase in the driving force for this ion.

In the literature, the Cl-/CHO3- exchangers involved in cellular alkaloses (bicarbonate influx) are Na+ dependent (27, 28, 29, 30, 31), whereas Cl-/HCO3- antiporters allowing an acidic recovery from alkalose (bicarbonate efflux) are Na+ independent (29, 30, 31, 32, 33). However, Na+-independent Cl-/HCO3- exchangers have also been shown to promote intracellular alkalinization (26, 34, 35). Our findings are in agreement with the latter mechanism. The observation that DIDS and Na+ removal were not able to inhibit alkalosis in all cells bathing in Cl--free containing bicarbonate medium indicates that isoforms AE2 and AE3 should both be present in normal rat lactotrophs, and both could be either Na+ dependent or independent.

The relationship among physiological involvement, pharmacology (DIDS sensitivity and Na+ dependence), and typology (AE2 and AE3) of the anionic exchangers is not obvious. Using RT-PCR and Northern blot analyses, we demonstrated the presence of both AE2 and AE3 in anterior pituitary extracts. Taking into account the heterogeneity of the gland, we are not sure that both AE2 and AE3 are present in lactotrophs, but we believe that this is likely. Further AE characterization by single cell PCR experiments will be useful in understanding this point. Nevertheless, the present results, as indicated either by acute application and incubation experiments with DIDS or Northern blot analyses, clearly suggest that AE3 is quantitatively more important than AE2.

Until now, we have discussed the presence of AE in relation to pHi regulation. However, as emphasized by Alvarez-Leefmann (36), the transport of HCO3- and Cl- can also be considered important in the field of Cl- homeostasis. In a recent report, we demonstrated that the mean intracellular Cl- concentration of rat lactotrophs was around 60 mM (37). Such a concentration, higher than that from a passive distribution across the membrane, strengthens our argument for the proposed existence of mechanisms such as exchangers in these cells.

The data reported in this paper demonstrated the presence of bicarbonate-chloride transporter(s) and suggest that in addition to chloride channels (10, 12, 38, 39) and intracellular stores (40), AE could participate to cellular Cl- homeostasis in normal rat lactotrophs.


    Acknowledgments
 
We thank Dr. J. L. Gallis for a very fruitful discussion. We are also much indebted to G. Gaurier, D. Varoqueaux, and J. M. Calvinhac for their technical assistance.


    Footnotes
 
1 This work was supported by a fellowship (to L.G.) from the Instituto Colombiano de Ciencia y Tecnologia Colciencias and the Universidad del Valle (Columbia). Back

Received March 14, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dulhunty AF 1978 The dependence of membrane potential on extracellular chloride concentration in mammalian skeletal muscle fibres. J Physiol 276:67–82
  2. Korn SJ, Bolden A, Horn R 1991 Control of action potentials and Ca2+ influx by the Ca2+-dependent chloride current in mouse pituitary cells. J Physiol 439:423–437[Abstract/Free Full Text]
  3. Cala PM 1990 Principles of cell volume regulation. Ion flux pathways and the role of anions. In: Alvarez-Leefmans FJ, Russel JM (eds) Chloride Channels and Carriers in Nerve, Muscle, and Glial Cells. Plenum Press, New York, pp 67–83
  4. Russel JM, Boron WF 1990 Chloride transport in the squid giant axon. In: Alvarez-Leefmans FJ, Russel JM (eds) Chloride Channels and Carriers in Nerve, Muscle, and Glial Cells. Plenum Press, New York, pp 85–107
  5. Hallam TJ, Tashjian Jr AH 1987 Thyrotropin-releasing hormone activates Na+/H+ exchange in rat pituitary cells. Biochem J 242:411–416[Medline]
  6. Törnquist K, Tashjian Jr AH 1990 Importance of transients in cytosolic free calcium concentrations on activation of Na+/H+ exchange in GH4/C1 pituitary cells. Endocrinology 128:242–250[Abstract/Free Full Text]
  7. Mariot P, Dufy B, Audy MC, Sartor P 1993 Biphasic changes in intracellular pH induced by thyrotropin-releasing hormone in pituitary cells. Endocrinology 132:846–854[Abstract/Free Full Text]
  8. Mariot P, Sartor P, Audin J, Dufy B 1991 Intracellular pH in individual pituitary cells: measurements with a dual emission pH indicator. Life Sci 48:245–252[CrossRef][Medline]
  9. Garcia L, Boué-Grabot E, Garret M, Dufy B, Sartor P Intracellular chloride concentrations in rat lactotrophs. II. Evidence for the involvement of anionic exchangers. 10th International Congress of Endocrinology, San Francisco CA, 1996, p 309 (Abstract P1, 698)
  10. Sartor P, Dufy-Barbe L, Corcuff JB, Taupignon A, Dufy B 1990 Electrophysiological response to thyrotropin-releasing hormone of rat lactotrophs in primary culture. Am J Physiol 258:E311–E319
  11. Mollard P, Guérineau N, Audin J, Dufy B 1989 Measurement of Ca2+ transients using simultaneous dual-emission microspectro-fluorimetry and electrophysiology in individual pituitary cells. Biochem Biophys Res Commun 164:1045–1052[CrossRef][Medline]
  12. Fahmi M, Garcia L, Taupignon A, Dufy B, Sartor P 1995 Recording of a large conductance chloride channel in normal rat lactotrophs. Am J Physiol 269:E969–E976
  13. Frelin C, Vigne P, Ladoux A, Lazdunski M 1988 The regulation of the intracellular pH in cells from vertebrates. Eur J Biochem 174:3–14[Medline]
  14. Dobyan DC, Magill LS, Friedman PA, Hebert SC, Bulger RE 1982 Carbonic anhydrase histochemistry in rabbit and mouse kidneys. Anat Rec 204:185–197[CrossRef][Medline]
  15. Diddersträle Y 1976 Intracellular localization of carbonic anhydrase in the frog nephron. Acta Physiol Scand 98:465–469[Medline]
  16. Chomczynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  17. Kudriki KE, Schull GE 1989 Primary structure of the rat kikney band 3 anion exchange protein deduced from a cDNA. J Biol Chem 264:8185–8192[Abstract/Free Full Text]
  18. Kudriki KE, Newman PR, Schull GE 1990 cDNA cloning and tissue distribution of mRNAs for two proteins that are related to the band 3Cl-/HCO3- exchanger. J Biol Chem 265:462–471[Abstract/Free Full Text]
  19. Snedecor GW, Cochran WG 1967 Statistical Methods. Iowa State University Press, Ames, pp 271–275
  20. Frelin C, Barbry P, Vigne P, Chassande O, Cragoe Jr EJ, Lazdunski M 1988 Amiloride and its analogs as tools to inhibit Na+ transport via the Na+ channel, the Na+/H+ antiport and the Na+/Ca2+ exchangers. Biochimie 70:1285–1290[Medline]
  21. Gupta S, Cragoe Jr EJ, Deth RC 1989 Influence of atrial natriuretic factor on 5-(N-ethyl-N-isopropyl) amiloride-sensitive 22Na+ uptake in rabbit aorta. J Pharmacol Exp Ther 248:991–996[Abstract/Free Full Text]
  22. Zeidel ML, Silva P, Seifter JL 1986 Intracellular pH regulation in rabbit renal medullary collecting duct cells. Role of chloride-bicarbonate exchange. J Clin Invest 77:1682–1688
  23. Zorec R, Hoyland J, Mason WT 1993 Simultaneous measurements of cytosolic pH and calcium interactions in bovine lactotrophs using optical probes and four-wavelength quantitative video microscopy. Pflugers Arch 423:41–50[CrossRef][Medline]
  24. Boron WF, De Weer P 1976 Intracellular pH transients in squid giant axons caused by CO2, NH3, and metabolic inhibitors. J Gen Physiol 67:91–112[Abstract/Free Full Text]
  25. Thomas RC 1984 Experimental displacement of intracellular pH and the mechanism of its subsequent recovery. J Physiol 354:3P–22P
  26. Russel JM, Boron WF 1976 Role of chloride transport in regulation of intracellular pH. Nature 264:73–74[CrossRef][Medline]
  27. L’Allemain G, Paris S, Pouyssegur J 1985 Role of a Na2+-dependent Cl-/HCO3- exchange in regulation of intracellular pH in fibroblasts. J Biol Chem 260:4877–4883[Abstract/Free Full Text]
  28. Krammoft B, Hoffmann EK, Simonsen LO 1994 pHi regulation in Ehrlich mouse ascites tumor cells: role of sodium-dependent and sodium-independent chloride-bicarbonate exchange. J Membr Biol 138:121–132[Medline]
  29. Redon J, Battle D 1994 Regulation of intracellular pH in the spontaneously hypertensive rat. Role of bicarbonate-dependent transporters. Hypertension 23:503–512[Abstract/Free Full Text]
  30. Fanous K, Nazaret C, Senn N, Decoopman-Morin E, Allard M, Garay RP 1993 Opposite effects of cell growth factors and cicletanine sulfate on the sodium-independent [Cl-/HCO3-] exchange in cultured vascular smooth muscle. Am J Hypertens 6:674–679[Medline]
  31. Ludt J, Sandvig K, Olsnes S 1993 Rapid increase in pH set-point of the Na(+)-independent chloride/bicarbonate antiporter in vero cells exposed to heat shock source. J Membr Biol 134:143–153[Medline]
  32. Xu P, Spitzer KW 1994 Na-independent Cl-/HCO3- exchange mediates recovery of pHi from alkalosis in guinea pig ventricular myocytes. Am J Physiol 267:H85–H91
  33. Tobey NA, Reddy SP, Keku TO, Cragoe Jr EJ, Orlando RC 1993 Mechanism of HCl- induced lowering of intracellular pH in rabbit esophageal epithelial cells. Gastroenterology 105:1035–1044[Medline]
  34. Grubman SA, Perrone RD, Lee DW, Murray SL, Rogers LC, Wolkoff LI, Mulberg AE, Cherington V, Jefferson DM 1994 Regulation of intracellular pH by immortalized human intrahepatic biliary epithelial cell lines. Am J Physiol 266:G1060–G1070
  35. Weill AE, Tisher CC, Conde MF, Weiner ID 1994 Mechanisms of bicarbonate transport by cultured rabbit inner medullary collecting direct cells. Am J Physiol 266:F466–F476
  36. Alvarez-Leefmans FJ 1990 Intracellular Cl- regulation and synaptic inhibition in vertebrate and invertebrate neurons. In: Alvarez-Leefmans FJ, Russel JM (eds) Chloride Channels and Carriers in Nerve, Muscle, and Glial Cells. Plenum Press, New York, pp 109–158
  37. Garcia L, Fahmi M, Prevarskaya N, Dufy B, Sartor P 1997 Modulation of voltage-dependent Ca2+ conductance by changing chloride ion concentration in rat lactotrophs. Am J Physiol 272:C1178–C1185
  38. Sartor P, Dufy-Barbe L, Vacher P, Dufy B 1992 Calcium-activated chloride conductance of lactotrophs: comparison of activation in normal and tumoral cells during thyrotropin releasing hormone stimulation. J Membr Biol 126:39–49[Medline]
  39. Lorsignol A, Taupignon A, Dufy B 1994 Short applications of gamma-aminobutyric acid increase intracellular calcium concentrations in single identified rat lactotrophs. Neuroendocrinology 60:389–399[Medline]
  40. Garcia L, Rigoulet M, Georgescauld D, Dufy B, Sartor P 1997 Regulation of intracellular chloride concentration in rat lactotrophs: possible role of mitochondria. FEBS Lett 400:113–118[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. A. Shimoda, T. Luke, J. T. Sylvester, H.-W. Shih, A. Jain, and E. R. Swenson
Inhibition of hypoxia-induced calcium responses in pulmonary arterial smooth muscle by acetazolamide is independent of carbonic anhydrase inhibition
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L1002 - L1012.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garcia, L.
Right arrow Articles by Sartor, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garcia, L.
Right arrow Articles by Sartor, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals