| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Physiology and Biophysics, University of Miami School of Medicine, Miami, Florida 33136
Address all correspondence and requests for reprints to: G. Dahl, Department of Physiology and Biophysics (R-430), University of Miami School of Medicine, P.O. Box 016430, Miami, Florida 33101. E-mail: gdahl{at}mednet.med.miami.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-adrenergic receptors (10, 11), and
potassium channels, which have been proposed to be involved in the
pacing process of muscle activity (12). These effectors of uterine
contractile activity are all stimulatory. The absence or low abundance
of these factors during gestation is probably the basis for low
contractile activity of the myometrium before parturition. However,
inadvertent activation of any one of these effectors might result in
premature labor. It is tempting to hypothesize that the quiescent state
of the myometrium is also controlled by an inhibitory factor, thus
actively preventing premature labor. The blocking effects of such an
inhibitor might be repressed during parturition. In this way the
birthing process would be facilitated not only by an increase in the
expression of stimulatory factors, but also by a decrease in expression
of inhibitory factor(s) as well. The inhibitory effects of calcitonin gene-related peptide (CGRP) on smooth muscle contraction, including uterine smooth muscle, have been well characterized (13, 14, 15). Additionally, CGRP-containing nerve fibers are present in the human uterus, and CGRP inhibits spontaneous and evoked contractions in the human uterus and fallopian tubes (13, 16). CGRP is therefore a candidate for the proposed inhibitory regulator of myometrial contractility during gestation.
We investigated the inhibitory effect of CGRP on myometrial contractility during pregnancy and determined whether changes in the CGRP responsiveness correlated with changes in the CGRP receptor-signaling pathway. Recently, a novel protein called CGRP-receptor component protein (CGRP-RCP) has been shown to be required for CGRP receptor activation in the Xenopus oocyte expression system (17). Although the CGRP-RCP protein is the only requirement for the CGRP peptide to elicit a chloride current in oocytes expressing the cystic fibrosis transmembrane conductance regulator (CFTA) chloride channel, it is not clear whether CGRP-RCP is the actual receptor molecule for the CGRP peptide. It is a small protein and does not belong to the family of seven transmembrane segment containing G-protein-linked receptors. Therefore, the prospect has to be considered that CGRP-RCP is not the receptor per se but associates with a CGRP receptor autochthonous to oocytes and renders this receptor’s signaling pathway sensitive to activation by the peptide. Immunohistochemical studies indicate that in mammals the CGRP-RCP is located postsynaptically to CGRP-containing neurons in the cochlea and cerebellum (17, 18) and can be used as a marker for CGRP receptor localization. To characterize the role of CGRP in modulation of the contractile response of the myometrium, we determined the physiological response of the myometrium to CGRP throughout gestation by measuring the inhibitory effect of CGRP on the isometric tension produced by acetylcholine (ACh) application, and whether a correlation exists between CGRP-RCP expression and myometrial responsiveness to CGRP during gestation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Oocyte-cystic fibrosis transmembrane conductance regulator (CFTR)
assay
The CFTR complementary DNA (cDNA) was obtained in the plasmid
pACF23 (J. Riordan, Mayo Clinic, Scottsdale, AZ), which was linearized
and transcribed in vitro using the mMESSAGE mMACHINE
transcription kit (Ambion, Austin, TX). Xenopus oocytes were
coinjected with 50 ng synthetic messenger RNA (mRNA) for CFTR, and
either 50 ng mRNA isolated from mouse uterus or 50 ng synthetic mRNA
for CGRP-RCP. After 48 h, the oocytes were voltage clamped at -50
mV and tested as previously described (17).
RNA and protein extraction
Uteri from pregnant animals at various stages of gestation and
postpartum were excised and placed in Tri Reagent (Molecular Research
Center). Tissue samples were homogenized in Tri Reagent (100 mg
tissue/ml reagent) using a Polytron homogenizer (Brinkman Instruments,
Westbury, NY). Total RNA and protein were isolated according to the
manufacturers instructions (Molecular Research Center, Cincinnati,
OH).
Polyadenylated (Poly A+) RNA was selected from total RNA using the PolyATract mRNA Isolation System (Promega, Madison, WI). Protein samples were resuspended in 0.1% SDS plus proteinase inhibitors (50 µg/ml lima bean trypsin Inhibitor, 2 µg/ml leupeptin, 16 µg/ml benzamidine, 2 µg/ml pepstatin A), and the protein content was determined using the Pierce MicroBCA kit (Pierce, Rockford, IL).
RT-PCR and cloning
RT reactions primed with the degenerate primer DRES-1
(TCYTCNACCATNARYTGNATYTCNAC) were performed on 200 ng of mouse uterine
mRNA. The resulting first strand cDNA was purified and used as template
for PCR using primers DRES-2
(CUACUACUACUATGNARYTTYTCNGCYTTNGTNARYTTRTG) and DRES-3
(CAUCAUCAUCAUGTNTTYCARYTNYTNACNGAYYTNAA). For PCR with degenerate
primers, the reaction was first cycled three times: 1 min at 94 C, 1
min at 37 C, a 2-min ramp to 72 C and then 1 min at 72 C. This was
followed by 25 cycles of PCR using standard conditions: 1 min at 94 C,
1 min at 65 C, and 1 min at 72 C. Degenerate primers DRES-2 and DRES-3
were synthesized with 5' tails containing uracil residues (19), as
described in the CloneAmp protocol (Gibco-BRL, Gaithersburg, MD). The
PCR amplimers were annealed into the plasmid pAmp-1, using the CloneAmp
System (GIBCO-BRL), and the sequence determined using the double-strand
DNA cycle sequencing system (GIBCO-BRL). The sequence obtained from
degenerate PCR amplimers was used to design primers specific for the
mouse CGRP-RCP: MRES-5B (5' TCATTGCTGTGAGGAATTCTTGGA 3') and MRES-6B
(5' GAGCAGCGGAAGGAGAGTGGGAAGAAC 3'). The standard single letter code
for nucleotides is used: N = any; Y = C or T; R = A or
G.
Rapid amplification of cDNA ends (RACE)
Cloning of CGRP-RCP from mouse uterus was performed using the
Marathon Race cDNA kit (Clontech, Palo Alto, CA). Briefly, 1 µg mRNA
from mouse uterus was used for RT, using a lock-dock oligo-dT primer
(Clontech). The resulting first-strand cDNA was then used as template
for second-strand cDNA synthesis, using standard conditions (Clontech).
The cDNA library was blunt-ended with T4 DNA polymerase, and Marathon
adaptors were ligated to the double-stranded cDNA. RACE was then
carried out on the uterine cDNA library using primer MRES-5B and
Marathon Adaptor Primer AP1 (3'-RACE), or MRES-6B and AP1 (5'-RACE).
The overlapping 5'- and 3'- RACE products were ligated into the plasmid
pCRII (Invitrogen, San Diego, CA), and the sequence was determined. To
generate a full-length cDNA clone, the 5' and 3' RACE products were
fused according to the manufacturer’s instructions, and the fusion
product was amplified by PCR using the adaptor primer AP2. The sequence
information obtained from 5'- and 3'-RACE was used to design primers
that flank the CGRP-RCP open reading frame (ORF). The upstream primer
(T7-M1) incorporated the T7 promoter at its 5' end. The primers had the
following sequences: T7-M1,
TAATACGACTCACTATAGGGAAGCTTAACATGGAAGTGAAGGATGCG; and MRES-17,
TGAGAGAATGGATCCGAACAACTTGGCCAGCTGCACAT.
In vitro transcription and translation
Mouse uterine mRNA was reverse-transcribed and used for PCR with
primers T7-M1 and MRES-17. The resulting PCR product was transcribed
in vitro using the Ambion mMESSAGE mMACHINE kit. The
synthetic mRNA was either injected into oocytes or was translated
in vitro in the presence of [35S]methionine
(1175 Ci/mM, NEN, Boston, MA) using the rabbit reticulocyte
lysate translation system (Promega). The translation product was
resolved by 15% SDS-PAGE, and then the gel was treated with Amplify
(Amersham, Arlington Heights, IL), dried, and exposed to x-ray
film.
Northern blot analysis
Uterine mRNA (2 µg) from embryonic day 6 through postnatal day
2 (E6-PN2) was analyzed by electrophoresis on a denaturing 1%
agarose/6% formaldehyde gel, transferred, and UV cross-linked onto
Nytran membranes (Schleicher & Schuell, Keene, NH). Membranes were
hybridized for 16 h with a 148-bp, 32P-labeled mouse
CGRP-RCP probe and washed as described (17). Membranes were exposed to
Kodak Biomax film (Eastman Kodak, Rochester, NY) with an intensifying
screen at -80 C. Membranes were subsequently stripped of CGRP-RCP
probe and rehybridized with a 32P-labeled glyceraldehyde
phosphate dehydrogenase (GAPDH) probe as an internal control for
loading and transfer of mRNAs. The hybridization signals were
quantified by scanning densitometry (Personal Densitometer SI,
Molecular Dynamics, Sunnyvale, CA) using the Imagequant program.
Probes for CGRP-RCP were synthesized by PCR on mouse CGRP-RCP cDNA
using primers MRES-5B and MRES-6B in the presence of
[32P]deoxycytidine triphosphate (3000 Ci/mmol, New
England Nuclear, Boston, MA), using the PCR radioactive labeling system
(Gibco-BRL). A random primed radioactive probe consisting of a 900-bp
fragment of GAPDH cDNA was used for normalization of RNA
concentration.
Western blot analysis
Seventy five micrograms protein isolated from the uteri of
animals (E6-PN2) was resolved by 15% SDS-PAGE and electrotransferred
to Immobilon-P membranes (Millipore, Bedford, MA). Following the rapid
immunodetection of blotted proteins protocol (Millipore Application
Note, RP562), membranes were air dried and then incubated for 2 h
with 1:500 dilution of CGRP-RCP polyclonal antibody R82, which was
raised against the peptide 188 with the sequence TDLKDQRPRESGKMRHSAG.
The membranes were next washed twice (10 sec) in 0.01 M
Tris-buffered saline plus 0.05% Tween-20 (TBS-T) and incubated with
1:10,000 dilution of goat antirabbit antibody conjugated to horseradish
peroxidase (Amersham) for 30 min and washed twice with TBS-T (10 sec).
The amount of CGRP-RCP in each lane was detected by chemiluminescence
using the enhanced chemiluminescence Western blotting detection system
(Amersham).
Immunoprecipitation
The in vitro translation product (5 µl) was diluted
in 200 µl NET-N (150 mM NaCl, 5 mM EDTA, 50
mM Tris, pH 8, 0.5% NP-40, 0.05 NaN3) plus
protease inhibitors plus phyenylmethylsulfonylfluoride, and 10 µl
antiserum (R82) was added. Protein G-Sepharose beads (GammaBind Plus
Sepharose, Pharmacia Biotech, Piscataway, NJ) were washed three times
with NET-N, and 30 µl of a 50% bead slurry was added to the diluted
in vitro translation and antibody mixture, and was incubated
for 1 h at 4 C (with rotation). Immune complexes bound to beads
were washed three times and resuspended in SDS-Laemmli sample buffer,
boiled, spun, and supernatants were analyzed by SDS-PAGE.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). The
inhibitory effect of CGRP on myometrial contractility developed rapidly
(within 1 min) and could be washed out.
|
). The sensitivity of the
myometrium to the inhibitory effect of CGRP recovered within 1 day
postpartum. At day PN2, ACh-induced contractions were inhibited by 30%
(Fig. 1a).
In addition to the nadir at parturition, a sharp decline was observed
at embryonic day 12 (E12), when the level of inhibition diminished to
15%. A detailed quantitative analysis of the CGRP inhibition of
ACh-induced contractions during the course of pregnancy and postpartum
is presented in Fig. 7c, in which it is compared with CGRP-RCP protein
levels.
|
)
Isolation of mouse CGRP-RCP cDNA
The uterine CGRP receptor was characterized using an oocyte
expression assay in which the CFTR was used as a sensor for
intracellular cAMP levels (21). It was previously determined that mRNA
isolated from tissue containing CGRP receptors (cerebellum) coinjected
into oocytes with synthetic mRNA for CFTR conferred CGRP responsiveness
(17). The protein mediating this CGRP responsiveness has been
identified in guinea pig as the CGRP-RCP (17). Using the oocyte-CFTR
expression assay, we found that uterine mRNA also induces CGRP
responsiveness in oocytes, implicating the CGRP-RCP in uterine CGRP
signal transduction.
To facilitate studies of CGRP-RCP expression in mouse uterus, the mouse
CGRP-RCP homolog was isolated using degenerate RT-PCR. Mouse uterine
mRNA was reverse transcribed using the down-stream degenerate primer
DRES-1, and the resulting first-strand cDNA was used as template for
PCR using primers DRES-2 and DRES-3 (Fig. 2). The resulting PCR amplimer was cloned
and sequenced and used to design primers for 5'- and 3'-RACE to obtain
the full-length mouse CGRP-RCP cDNA. The 1.4-kb cDNA of the mouse
CGRP-RCP contains a 444-bp ORF preceded by a Kozak translation
initiation consensus sequence (22) (Fig. 2). The 148-amino acid protein
encoded by the ORF is largely hydrophilic and highly conserved between
mouse and guinea pig (Fig. 3). The
in vitro transcribed RNA produced a 20-kDa protein when
translated in vitro (Fig. 4),
in agreement with the 148-amino acid ORF.
|
|
|
). This also verified that the short ORF was sufficient to
confer function. The resulting PCR product was used as template for
in vitro transcription. Oocytes were coinjected with 50 ng
each synthetic mRNA for CFTR and CGRP-RCP. Oocytes were voltage clamped
at -50 mV and incubated with 100 nM CGRP. Oocytes
expressing the protein encoded by the CGRP-RCP ORF produced an inward
current when incubated with CGRP (Fig. 5a). The response was specific for CGRP,
because other peptides tested, such as calcitonin, amylin, and
neuropeptide Y produced no response (data not shown). Coinjection of an
antisense oligonucleotide made to the cloned mouse CGRP-RCP (MRES-6B,
Fig. 2), attenuated receptor activity in oocytes injected with uterine
mRNA to a level at the detection threshold (Fig. 5b) indicating that
the CGRP-RCP in uterine mRNA mediated CGRP responsiveness.
|
, a prominent band of 1.8 kb was
detected by hybridization at all stages. The blot was then stripped and
reprobed for GAPDH expression. CGRP-RCP mRNA was quantified by
densitometric scanning of three Northern blots and normalized to GAPDH
mRNA level for each time point. Expression of CGRP-RCP mRNA did not
vary significantly throughout gestation and postpartum (Fig. 6b).
|
). The antibody reacted
with two proteins, one of the same size as the in vitro
translation product and the other of slightly higher molecular weight.
At present it is not clear whether the larger protein is related to
CGRP-RCP, possibly as a result of posttranslational modification or
alternative RNA splicing. The intron-exon organization of the mouse
CGRP-RCP gene suggests the existence of at least two splice variants of
CGRP-RCP (M. Naghashpour, M. I. Rosenblatt, G. P. Dahl, and
I. M. Dickerson, unpublished observations). Furthermore, the RACE
procedure yielded a second CGRP-RCP species that had an 87-base
insertion at the amino terminal end (not shown). With the choice of
different primers (T7-M1 or T7-M2), the insert was excluded or included
in RT-PCR products and this yielded one or two in vitro
translation products with the predicted size difference, and both
were recognized by antibody R82 as expected (cf. Figs. 4 and 8a). A relationship between the two sizes
is further suggested by the parallel regulation of both proteins.
|
).
Levels of immunoreactive CGRP-RCP protein fluctuated during the course
of pregnancy with low points at E12-E13 and parturition, despite
relatively constant mRNA levels (Fig. 6). Immunoreactive CGRP-RCP
protein levels recovered rapidly postpartum. The decline of
immunoreactive CGRP-RCP protein at parturition (Fig. 7b) correlated
with the decline of the inhibitory effect of CGRP on ACh-induced
contractions of myometrium, observed at this time point in the force
experiments (Fig. 7c). A less pronounced decline in immunoreactive
CGRP-RCP protein was found at approximately a time (E12-E13) when
inhibition of myometrial contraction was also diminished.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The loss of CGRP-mediated inhibition of uterine contractility at birth
coincides with the up-regulation of stimulatory factors of contraction.
These factors are hormonally controlled and include gap junctions
between adjacent uterine smooth muscle cells (4, 5, 6, 7, 8, 9, 23), oxytocin
receptors (1, 2, 3), -adrenergic receptors (10, 11), and potassium
channels (12). It appears that the effects by this battery of
stimulatory factors are antagonized by CGRP during pregnancy, thus
preventing premature labor by inhibiting the effects of untimely
activation of any one of these factors. On the other hand, withdrawal
of the inhibitory effect of CGRP at term warrants full activation of
the myometrium by the various stimulatory factors.
The implications of the transient decline of the inhibitory effect of CGRP at E12 are presently not clear. One can envisage at least two scenarios in which increased contractile activity during pregnancy could be advantageous. Contractions may facilitate turning of the embryos. This physiological process, however, starts at embryonic day 9 (24), and thus the decline in CGRP responsiveness at E12 may be too late to be involved in the turning process. Alternatively, this period could be an equivalent to the critical period in humans in the first trimester, when most abortions of defective embryos occur. However, because mice resorb (24) rather than abort defective embryos, it is not clear whether these phenomena are related, although a need for increased myometrial contractility for a resorptive process cannot be excluded.
The loss of inhibitory capacity of CGRP on myometrial contractility appears to originate at the receptor level. This is indicated by the observation that forskolin blunted the contractile response of myometrium to ACh at all stages of gestation. Forskolin bypasses receptor-mediated relaxation by direct activation of adenylyl cyclase, thus causing an increase in intracellular cAMP. Elevated cAMP can inhibit uterine contractility in various ways: by increasing calcium uptake by sarcoplasmic reticulum, by increasing calcium efflux from the cell (25), or by phosphorylation of myosin light-chain kinase by protein kinase A (26). Although the inhibitory effect of CGRP was greatly diminished for myometrial strips from E12 and parturient animals, application of forskolin abated the ACh-induced contractions at all time points. This indicated that the smooth muscle cells were still capable of responding to other inhibitory agents during these stages despite losing the response to CGRP. In addition, the myometrial response to ACh is independent of the stage of pregnancy and is also unaffected by steroid hormone treatment (20). Thus, the variation in responses of myometrium to CGRP during gestation may involve a down-regulation of CGRP receptors and/or other components of the early signaling pathway (before activation of adenylyl cyclase).
Alternate mechanisms for relaxation of uterine smooth muscle by CGRP, however, have also been proposed. These include activation of a potassium channel (15) and relaxation by nitric oxide (27). Whether these alternate mechanisms coexist and work synergistically for myometrial relaxation is unknown, because forskolin tests only cAMP-mediated relaxation. Notwithstanding, the ability of myometrial mRNA to confer CGRP responsiveness to oocytes coexpressing CFTR suggests that the cAMP pathway is an important contributor to relaxation of uterine smooth muscle. Furthermore, it has been suggested that the action of CGRP is on receptors on myometrial smooth muscle cells (15). However, in addition to or instead of such a direct effect of CGRP on the muscle cells, one may also consider an indirect effect involving an interneuron releasing the actual relaxing factor. The latter could be either a known transmitter like adrenaline or an as yet unidentified substance.
The proteins that mediate CGRP responsiveness (a CGRP receptor complex) have not been conclusively identified. We have previously determined that a protein (CGRP-RCP) from guinea pig, which does not belong to the family of seven transmembrane segment-containing proteins, confers CGRP responsiveness to oocytes expressing this exogenous protein. This is indicated by the activation of the reporter protein CFTR by CGRP in oocytes coexpressing CFTR and CGRP-RCP (17). In this study, we showed that the mouse homolog of this protein can serve the same function, i.e. it also confers CGRP responsiveness to oocytes. This response was sequence specific because when an antisense oligonucleotide made against the mouse CGRP-RCP was coinjected with uterine mRNA, it eliminated the mRNA-induced CGRP response.
It is not yet clear whether CGRP-RCP is a receptor molecule by itself, or whether it associates with other cellular proteins to form a receptor complex that can be activated by CGRP. Recently, two orphan seven transmembrane-spanning receptors (RDC1 and CGRP1) have been described as putative CGRP receptors (28, 29). Pharmacologically, two types of CGRP receptors can be discriminated (30, 31). Both RDC1 and CGRP1 have been suggested to represent CGRP receptor type 1. Thus, the possibility for additional CGRP receptors exists. The CGRP-RCP has been identified in cells innervated by CGRP-containing neurons in cochlea and cerebellum (17, 18). Combined with the ability of CGRP-RCP to confer CGRP responsiveness to oocytes, these data suggest that CGRP-RCP can be used as a marker for the CGRP receptor complex, whether CGRP-RCP works alone or is associated with another protein such as RDC1 or CGRP1.
The notion that CGRP-RCP is an essential component of the CGRP signaling mechanism is further strengthened by the observation of a correlation between the levels of the immunoreactive form of this protein in uterus with the inhibitory potency of CGRP peptide on myometrial contractility. At term, when the inhibitory effect of CGRP on myometrial contractility was significantly diminished, a corresponding decline in CGRP-RCP protein level was observed.
In contrast to the changes in the levels of immunoreactive protein and the inhibitory activity of CGRP, no concomitant changes in mRNA levels for CGRP-RCP were found for the decline occurring at birth. The mRNA levels remained mostly uniform during the course of pregnancy, as revealed by Northern blot analysis. These results suggest that the CGRP-RCP protein expression was regulated independently of transcription during the course of pregnancy. Whether a change in translatability of the mRNA for CGRP-RCP or a change in protein stability are responsible for the decline in CGRP-RCP protein levels remains to be determined.
In conclusion, myometrial contractility is tightly controlled by both stimulatory and inhibitory factors, which appear to be reciprocally regulated during pregnancy. CGRP and its receptor-signaling complex probably play a key role in this control of myometrial activity. CGRP-mediated inhibition declines at term to give way to a series of stimulatory factors that allow vigorous contractions of the myometrium for the birthing process.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received April 16, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. Siaut, C. Zaros, E. Levivier, M.-L. Ferri, M. Court, M. Werner, I. Callebaut, P. Thuriaux, A. Sentenac, and C. Conesa An Rpb4/Rpb7-Like Complex in Yeast RNA Polymerase III Contains the Orthologue of Mammalian CGRP-RCP Mol. Cell. Biol., January 1, 2003; 23(1): 195 - 205. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Naghashpour and G. Dahl Relaxation of Myometrium by Calcitonin Gene-Related Peptide Is Independent of Nitric Oxide Synthase Activity in Mouse Uterus Biol Reprod, November 1, 2000; 63(5): 1421 - 1427. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. I. Rosenblatt, G. P. Dahl, and I. M. Dickerson Characterization and Localization of the Rabbit Ocular Calcitonin Gene-Related Peptide (CGRP)-Receptor Component Protein (RCP) Invest. Ophthalmol. Vis. Sci., April 1, 2000; 41(5): 1159 - 1167. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Naghashpour and G. Dahl Sensitivity of myometrium to CGRP varies during mouse estrous cycle and in response to progesterone Am J Physiol Cell Physiol, March 1, 2000; 278(3): C561 - C569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Ferri, G. Peyroche, M. Siaut, O. Lefebvre, C. Carles, C. Conesa, and A. Sentenac A Novel Subunit of Yeast RNA Polymerase III Interacts with the TFIIB-Related Domain of TFIIIB70 Mol. Cell. Biol., January 15, 2000; 20(2): 488 - 495. [Abstract] [Full Text]
|
|
|
|
 |
|
 W. Balkan, E. L. Oates, G. A. Howard, and B. A. Roos Testes Exhibit Elevated Expression of Calcitonin Gene-Related Peptide Receptor Component Protein Endocrinology, March 1, 1999; 140(3): 1459 - 1469. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. N. Evans, M. I. Rosenblatt, L. O. Mnayer, K. R. Oliver, and I. M. Dickerson CGRP-RCP, a Novel Protein Required for Signal Transduction at Calcitonin Gene-related Peptide and Adrenomedullin Receptors J. Biol. Chem., September 29, 2000; 275(40): 31438 - 31443. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
