help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katz, D.
Right arrow Articles by Cooney, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katz, D.
Right arrow Articles by Cooney, A. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Endocrinology Vol. 138, No. 10 4364-4372
Copyright © 1997 by The Endocrine Society


ARTICLES

Characterization of Germ Cell-Specific Expression of the Orphan Nuclear Receptor, Germ Cell Nuclear Factor1

Deborah Katz, Craig Niederberger, Gayle R. Slaughter and Austin J. Cooney

Department of Cell Biology (D.K., G.R.S., A.J.C.), Baylor College of Medicine, Houston, Texas 77030; and Department of Urology (C.N.), University of Illinois at Chicago, Chicago, Illinois 60612

Address all correspondence and requests for reprints to: Austin J. Cooney, Baylor College of Medicine, Department of Cell Biology, 1 Baylor Plaza, Houston, Texas 77030. E-mail: acooney{at}bcm.tmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GAMETOGENESIS has several features in common in the male and the female and also diverges in many aspects. The gonadotropic hormones are required for both oogenesis and optimal spermatogenesis. In both sexes, haploid germ cells are produced by the reduction divisions of meiosis. Apart from the basic manipulations of the chromatin, spermatogenesis and oogenesis differ in the timing of the events of meiosis, the structure of fertilization-competent gametes, and the role of each of these gametes in the developing zygote. Even with this knowledge, our understanding of gametogenesis is far from complete. In this paper, we examine the expression of a factor that is present in both the developing oocyte and spermatid and consider its potential roles in gametogenesis.

Germ cell nuclear factor (GCNF) is an orphan member of the nuclear receptor superfamily of transcription factors (1, 2). It has regions, including the zinc finger DNA-binding domain (DBD), that are significantly homologous to the classical members of this superfamily (3), the receptors for the steroid, retinoic acid, and thyroid hormones. Many members of this superfamily have important roles in reproduction. The estrogen (4) and progesterone (5) receptors have been shown, by germline mutation in the mouse, to be required for normal ovarian and uterine development. The androgen receptor is required for male sexual development, as seen in humans who are phenotypically female but genotypically male because of mutations or deletions of the androgen receptor gene (6). Additionally, retinoids are critical for spermatogenesis by transmitting signals through the retinoic acid receptor (RAR) and retinoid X receptor (RXR) receptors. Mutation of the RXRß receptor in the germline of male mice leads to significant abnormalities in mature spermatozoa (7), whereas mutation of RAR{alpha} leads to testis degeneration (8). Even members of the nuclear receptor superfamily that do not have known hormonal ligands have been implicated in reproductive development. For example, mice with mutant SF-1 alleles lack gonads entirely (9). GCNF also may play a role in reproduction because, in the adult mouse, it is expressed predominantly in the germ cells (1, 2). Northern analysis showed that two messages in testis RNA hybridized to the GCNF probe, whereas the more sensitive ribonuclease protection assay detected messenger RNA (mRNA) in the ovary. Overexpression of the Northern also showed a very low level of expression in the kidney and liver (1). Upon in situ hybridization of the gonads, it became clear that GCNF is expressed exclusively in the oocyte and spermatogenic cells.

Many questions exist about GCNF function. It is classified as an orphan receptor, because no ligand has been identified. Therefore, it is important to know if there is an activating ligand or if GCNF is activated by other signaling networks. As a transcription factor, it is relevant to know which genes GCNF activates and where they lie in signaling pathways for the development or function of specific cells. Finally, the nature of the two messages is of interest in determining whether there is more than one isoform of GCNF or whether the GCNF mRNA is subject to posttranscriptional regulation.

To begin to address these questions, we first characterized more specifically when GCNF is expressed in the germ cells. In this paper, we show that in the male, GCNF expression is postmeiotic, occurring in the round spermatids. In the female, expression occurs before the completion of meiosis, correlating with the start of oocyte growth. Furthermore, we have analyzed the expression of the two messages of GCNF. The larger message contains the entire cloned mRNA, whereas the smaller is missing the extreme 3' untranslated region. Additionally, we show that the expression of GCNF is conserved between the rat and mouse.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Adult and age-specific ICR mice were obtained from Harlan Sprague-Dawley, Inc. (Indianapolis, IN). Mice that were too young to be weaned were shipped with their mothers. Mature hypogonadal (hpg) mice were obtained from Jackson Laboratories (Bar Harbor, ME). Mice were killed by cervical dislocation the day they arrived. Rats were obtained from the in-house breeding colony and were killed by asphyxiation.

In situ analysis
In situ hybridization on testis and ovary sections was performed as described previously (1). Ovaries and testis tissues were fixed overnight in 4% paraformaldehyde and dehydrated step-wise to 70% ethanol. Seven micron sections were made from wax-embedded preparations. For probes of the entire complementary DNA (cDNA) sequence, 35S-labeled antisense RNA probes were transcribed from the T7 promoter of pBluescript containing the GCNF cDNA and cut with BamHI restriction enzyme. Antisense riboprobes of the isolated DBD were transcribed from a PCR fragment engineered to contain a T7 promoter. Specifically, the cDNA was used as a template in a PCR protocol with the 5' primer: ACCGCGCTACGGGCTTGC (bp 442–459); and 3' primer: GGATCCTAATACGACTCACTATAGGGAGGTGGTCCAATGCTCTTGTT (bp 666–683). Similarly, the 3'UT probe was transcribed from a PCR product of the cDNA with the 5' primer: GATGCTGCTGTCAAGTTTTCA (bp 2341–2361); and the 3' primer: GGATCCTAATACGACTCACTATAGGGAGGCTCTACCTTTTGAGGGAAAC (bp 2583–2602).

Quantitation of in situ signal
The in situ hybridizations were stained with hemotoxylin and the histology analyzed to determine specific cell associations within each tubule. These were classified according to the stages defined in Russell et al. (10). The actual number of silver grains in the spermatids during each of the 12 stages was quantitated by computer-aided analysis, as described previously (11). Briefly, a bandwidth filter was implemented in the Interactive Data Language (IDL, Research Systems, Inc., Boulder, CO) to analyze 24-bit color images captured from light microscopy of the in situ hybridized sections. The bandwidth filter was tuned to exclude all but the pixels corresponding to the darkened radioisotope reacted silver grains. The IDL program then automatically calculated the ratio of grain area per identified seminiferous tubular area. The measurements were replicated for spermatogenic stage, and the resulting means and standard errors for multiple tubules analyzed within one mouse are denoted in the accompanying figures. Using the computer filter, silver grains in premeiotic and meiotic germ cells were compared with slide background (data not shown) and found to be not significantly different from background.

Northern analysis
Total RNA was prepared from rat and mouse testis using guanidium isothiocyanate/phenol chloroform extraction (Stratagene, La Jolla, CA). Approximately 10 µg of RNA was loaded onto a formaldehyde gel and electrophoresed overnight. After removing the formaldehyde, the RNA was blotted onto Zetaprobe membrane (BioRad, Hercules, CA) in 20x SSC (3 M NaCl, 0.3 M Na3 citrate, pH 7.0). Hybridization was done at 60 C overnight in Church buffer (500 mM Na2HPO4, pH 7.2; 1 mM EDTA, 7% SDS, 100 ug/ml single-stranded DNA) and washes performed at room temperature and 55 C with 40 mM Na2HPO4 (pH 7.2), 1% SDS. The probe of full-length GCNF was made by random priming (Boehringer Mannheim Biochemicals, Indianapolis, IN) with {alpha}32PdeoxyCTP and {alpha}32PdeoxyATP incorporation into the entire cDNA, whereas those for the isolated DBD and 3'UT were made by Klenow labeling of PCR products using specific primers. These specific primers for PCR and labeling were the same as those described above for in situ hybridization, except that the 3' primers lacked the T7 promoter sequences (GGATCCTAATACGACTCACTATAGGGAGG). The Northern blot mRNA levels were quantitated by densitometry using a BioImage gel scanner and Intelligent Quantifier Electrophoresis Image Analysis Software (BioImage, Ann Arbor, MI).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GCNF expression during spermatogenesis
Though the expression of GCNF in spermatogenic cells was shown previously (1), the morphology of the seminiferous tubule makes it difficult to evaluate potentially low-level expression in Sertoli cells. Therefore, to confirm that GCNF is a germ cell-specific factor in the adult male, we compared expression in normal testis with that in the testis of hypogonadal (hpg) mice. Hpg mice have significantly decreased levels of gonadotropins, because of a deletion and subsequent inactivation of the GnRH gene (12, 13). Without the influence of LH and FSH, the testis of these mice are very small and lack development of spermatogenic cells beyond the first prophase of meiosis. Light microscopy of a section of the testis from adult hpg mice (Fig. 1BGo) shows that the seminiferous tubules are considerably smaller than those of wild-type mice (Fig. 1AGo). The hpg testis also show only Sertoli cells, Leydig cells, and germ cells before the first prophase of meiosis, whereas the seminiferous tubules of the wild-type mouse display many layers of developing germ cells. When sections of testis from both types of mice were hybridized to an 35S-labeled antisense riboprobe of the entire coding sequence of GCNF, specific hybridization to the germ cells of the wild-type testis was observed, whereas no specific signal was seen on the hpg testis (compare Fig. 1Go, C and D). Because there are only somatic cells and early spermatogenic cells in the hpg seminiferous tubules, we conclude that GCNF is not expressed in these early germ cells, in the Sertoli or Leydig cells, and is, indeed, specific to germ cells in the later stages of spermatogenesis.



View larger version (101K):
[in this window]
[in a new window]
 
Figure 1. In situ hybridization of GCNF message in wild-type and hpg mouse testis. Light field image of hemotoxylin-stained (A) wild-type or (B) hpg testis. Note the multiple cell types and organization of the wild-type testis in contrast to the small, immature hpg testis. Dark field image of (C) wild-type and (D) hpg testis hybridized to an 35S-labeled RNA probe of the full-length antisense GCNF cDNA. All magnifications are 100x.

 
Closer examination of the hybridization pattern seen on the wild-type testis in Fig. 1CGo reveals that GCNF is not expressed evenly in all tubules in the cross-section shown. Spermatogenesis initiates in waves along the length of the seminiferous tubule, and as the cells develop, they move somewhat perpendicularly to the length of the tubule, either toward the basal lamina or the lumen. Therefore, patterns of developmentally distinct cell associations can be characterized in different tubule cross-sections. Characterization of these cell associations in the mouse has revealed 12 different arrangements, indicating 12 different stages of spermatogenesis, according to Russell et al (10). Because the level of GCNF expression varies among cross-sections of tubules, it is not similar in each type of tubule; it is probably expressed at distinct phases of spermatogenesis.

In an early stage (II-III) tubule (10), shown in Fig. 2AGo, there are four different spermatogenic cell types. The small, flattened, mitotic spermatogonia lie along the basal lamina, whereas the larger, densely staining spermatocytes in the first prophase of meiosis are adjacent to them, closer to the lumen. Next, the more diffuse, postmeiotic round spermatids emerge and finally change into densely staining, maturing spermatids with their characteristic elongated heads. In this early stage tubule, expression of GCNF can be seen by in situ hybridization over the round spermatids, whereas a background level of signal is observed in the spermatogonia and spermatocytes. In a stage VIII tubule (10, Fig. 2BGo), round spermatids are present in the layer between pachytene spermatocytes and elongating spermatids. These round spermatids, in their last stages before terminal differentiation and elongation, show very significant levels of GCNF hybridization. Finally, in Fig. 2CGo, a later stage (IX) tubule (10), demonstrates only low levels of GCNF expression. This tubule displays early spermatocytes, pachytene spermatocytes, and elongating spermatids but an absence of round spermatids. Residual expression of GCNF may be caused by slow degradation of its message.



View larger version (94K):
[in this window]
[in a new window]
 
Figure 2. In situ hybridization of wild-type tubules, representing different stages of spermatogenesis. Sections were hybridized to an 35S-labeled RNA probe of the full-length antisense cDNA. A, An early stage II-III tubule, showing dark-staining mitotic spermatogonia (G), larger diffuse pachytene spermatocytes (P), smaller round spermatids (R), and dense elongating spermatids (E). B, A stage VIII tubule with cells as described in A. Notice the expansion of the round spermatid population. C, A stage IX tubule with pachytene and early elongating spermatids. Again, the cell populations are as described in A. Magnifications of A, B, and C are 400x. D, Quantitation of the in situ hybridization signals of spermatids, as depicted in A, B, and C.

 
To define the expression pattern of GCNF more precisely, computer-aided analysis was used to quantitate the actual number of silver grains in the spermatids during each of the 12 stages. The level of expression of GCNF in spermatogonia and spermatocytes also was determined but was found not to be significantly above background levels (see Materials and Methods). Figure 2DGo shows a graph of this quantitation of expression in spermatids at each of the stages of spermatogenesis from several tubules of one animal (the same results were obtained from several animals). Briefly, this was done by using a bandwidth filter to determine grain distribution, which was then expressed as the number of pixels per unit area of spermatids, subtracting the average background density of regions of the slide not containing tissue. GCNF message is expressed in stage I round spermatids at a high basal level. The analysis demonstrated that round spermatids in stage VII and VIII tubules express the highest levels of GCNF and that expression is significantly lower by stage X, where there are no round spermatids. Again, the residual expression may be caused by the mRNA half-life, which may allow it to persist into the early elongating spermatids. The high levels of expression, though, in the stage VII and VIII tubules do reflect an increase in the concentration of GCNF message, because the signal density increases significantly. GCNF, therefore, emerges as a postmeiotic factor, which is expressed in the final phase of gene expression during round spermatid development, just before initiation of the dramatic morphological changes of elongation.

Next, we analyzed the expression of GCNF in the testis across puberty to determine its expression pattern in the developing animal. Although primordial germ cells are present in the prepubertal mouse testis, the optimal production of more advanced stages of sperm development does not occur until the influence of gonadotropic hormones (14). Therefore, if GCNF is present only in the maturing postmeiotic spermatids, message should emerge during puberty, when these cells first appear. Northern analysis (Fig. 3AGo) of total RNA from the testis of mice, 5–40 days old, was performed using a 32P-labeled probe of the GCNF cDNA. Each time point represents total RNA isolated from two to five testis pooled from different individual mice. The entire experiment was repeated with similar results. Though both messages are almost undetectable at 5 and 10 days old, the larger, 7.5-kb, message appears very faintly at day 15 and increases to day 25. There is a decrease in the message at day 30 (Fig. 3Go, A and B), followed by a further increase and maintenance to maturity at day 40. The smaller message, in contrast, increases steadily from day 20 to day 40.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 3. GCNF expresssion across puberty. A, Northern analysis of GCNF expression at different ages across puberty. Total mouse testis RNA (10 ug) was loaded in each lane and blotted onto nylon membrane. Hybridization was done with a 32P-labeled probe of the ligand-binding domain (nucleotides 691-1451) of the GCNF cDNA. Equalization of RNA loading was normalized by ethidium staining of 18 and 28S RNAs, as shown in the insert. B, Densitometry of the signals from the Northern in A. C, Quantitation of in situ hybridization signal at different ages across puberty. D, In situ hybridization, performed as described for Figs. 1Go and 2Go, of 20-day-old mouse testis. The left panel shows light field, whereas the right shows the same area under dark field. Notice the signal in the left tubule, which shows round spermatids (400x magnification).

 
Figure 3CGo shows a graph of the quantitation of total in situ hybridization of the GCNF probe to testis sections of the ages in Fig. 3AGo. Each time point represents a single animal, and the mean and standard error are of multiple tubules analyzed within an animal. Repetition of the entire experiment produced similar results. In agreement with the Northern signal, in situ hybridization begins to become specific at 20 days. A peak is reached by 25 days, which is followed by a significant decrease in signal by day 30 and then a steady increase to adulthood. The transient peak seen at day 25 is reflected in the Northern blot, where the signal for day 30 is weaker than that for day 25 (Fig. 3Go, A and B). This may be caused by the characteristics of the first round of spermatogenesis. A greater percentage of cells are all in the round spermatid stage at this point in development than they are later, when different tubules are initiating at different times. Therefore, the first round, at day 25, will show a higher level of signal than at day 30, when elongating spermatids have appeared and the proportion of GCNF expression decreases. Eventually, the overall expression level of GCNF will increase as the testis grows. A similar phenomenon was seen with peaks in the expression of mRNAs encoding calmodulin, {alpha}-tubulin, and ß-tubulin during the first wave of spermatogenesis (15). Furthermore, Zhou et al, have described differences in the expression and actions of the growth factor Bmp 8b on spermatogenesis during early puberty, as compared with cycles in the mature mouse (16).

On a cellular level, specific hybridization to tubules in the 20-day-old mouse testis can be seen. In fact, in testes this young, tubules that have matured to the point of producing round spermatids can be distinguished from those that have not, as seen by comparing the left with the right tubule in Fig. 3DGo. In Fig. 3DGo, it is clear that tubules that display round spermatids show specific hybridization over these cells. Therefore, GCNF is a postmeiotically expressed transcription factor that, assuming translation in round spermatids, has the potential to regulate genes involved in the morphological changes of spermatid elongation.

Finally, the species conservation of GCNF was examined. Using a mouse probe of the full-length message, GCNF is clearly detected in sections of the rat testis (Fig. 4AGo). As in the mouse testis, different tubules show different levels of hybridization, indicating stage-specific expression of GCNF in the rat. The staging of tubules in the rat is similar to that in the mouse, but the rat displays 14 stages, as opposed to the 12 of the mouse (10). Indeed, GCNF expression peaks in stages VI–VIII in the rat (Fig. 4BGo), which corresponds with stages VII–VIII in the mouse (10). Both species show expression in the last appearance of round spermatids before initiation of elongation. As before, several tubules from the rat testis were analyzed to obtain the quantitation information.



View larger version (108K):
[in this window]
[in a new window]
 
Figure 4. Conservation of the GCNF message in the rat testis. A, In situ hybridization of adult rat testis using 35S-labeled mouse cDNA. The left side is of the light field image, while the right is of the dark field image (100x magnification). B, Quantitation of the hybridization signal over spermatids seen in A. A peak of GCNF expression is observed in stages VI–VIII.

 
GCNF expression during oogenesis
A similar series of studies was performed on the mouse ovary to determine the pattern of GCNF expression in the female. As in the male, GCNF has been shown to be specifically expressed in the germ cells, the oocytes, of the adult female (1). We were interested in determining whether there was a specific stage at which GCNF expression was most prominent. Figure 5AGo shows several follicles that are in the stage of development, with two layers of granulosa cells and one prominent follicle (on the bottom of picture) that is in the preovulatory stage. All of these growing follicles express significant levels of GCNF. To address the early stages of oocyte development, we looked at the ovaries of young prepubertal mice (Fig. 5BGo). GCNF expression is present in oocytes of mice as young as 5 days, which coincides with the beginning of follicular and oocyte growth. In fact, as shown in Fig. 5BGo, GCNF expression is observed in oocytes of follicles that have just begun to grow and have only one layer of cuboidal granulosa cells, whereas it is not present in the nests of primordial follicles, which have not yet begun follicular growth. Therefore, GCNF expression is characteristic of maturing oocytes throughout their tenure of growth but is not present in primordial oocytes.



View larger version (92K):
[in this window]
[in a new window]
 
Figure 5. GCNF expression in the ovary. A, Double light- and dark-field exposures of in situ hybridization of a mouse ovary with 35S-labeled GCNF probe of the entire cDNA. Note the expression in the late stage preovulatory follicle (A) at the bottom of the picture. 50x magnification. (B) Double light- and dark-field exposures of in situ hybridization of a 5-day-old mouse ovary performed as in A. Note the lack of expression in the cluster of primordial follicles (P) in the upper right hand portion of the ovary, as compared with the expression in the early one- and two-cell stage follicles (200x magnification).

 
Expression of different GCNF messages
In the adult mouse testis, GCNF is expressed as two messages, as shown by the 2.5- and 7.4-kb bands in Fig. 3AGo. To differentiate between these two messages, we used probes generated from different portions of the cloned cDNA, as shown in Fig. 6AGo. When the probe spanning the DBD is hybridized to mouse testis total RNA, the same two bands detected by the full-length probe are seen (Fig. 6BGo). In contrast, when a probe derived from the far 3' untranslated region of the cloned cDNA is used, only the larger message is observed. Therefore, the two messages differ, at least in the presence or absence of the cloned extreme 3' untranslated region. Thus, the full cloned cDNA originates from the larger message; however, the smaller message also contains the DBD and, most likely, the other translated regions.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 6. Analysis of the two GCNF messages. A, Schematic diagram of the probes used for Northern analysis in B. B, Northern analysis of total testis RNA (10 ug) from the rat and mouse probed with the 32P-labeled probes shown in A. Double light- and dark-field exposures of in situ hybridization of mouse ovary (C and D) using 35S-labeled probes of DBD (C) or 3'UT (D) fragments shown in A (50x magnification).

 
Figure 4AGo demonstrates that rats display a homologous message for GCNF, but we were curious as to how far this homology extends. In Fig. 6BGo, rat testis RNA was probed with the same common and message-specific probes as was the mouse testis RNA. Like the mouse, the full-length coding region and DBD probes hybridized to the rat RNA in two messages that are very similar in size to those of the mouse. The 3'UT probe, which was specific for the larger mouse message, hybridized poorly to the rat RNA. Therefore, whereas the rat has two messages like the mouse and shares sequence homology in the coding region, this conservation may not be as strong in the 3'untranslated region in the rat. Further analysis might show, though, that isolated sequences of the 3'untranslated region, which signal for different posttranscriptional processes, might be conserved between the two species.

In the ovary, both probes hybridize to the same individual oocytes, as seen in serial sections (Fig. 6Go, C and D). Because Northern analysis is not sensitive enough to detect GCNF, because of the limited RNA of the oocytes, we can conclude from these in situ studies that at least the larger message is present in the oocyte.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The work presented here defines the spatio-temporal expression pattern of an orphan member of the nuclear receptor superfamily, GCNF, in the adult germ cells. We have added more evidence that GCNF may be important for germ cell development, given that it is conserved between rat and mouse. GCNF expression was previously reported to be limited to the germ cells of the adult mouse. Here, we confirm these results and show that in the male, expression is more strictly limited to round spermatid development. In the female, GCNF expression begins as the oocyte starts growth and continues at least up to ovulation. Thus, in the male, GCNF is a postmeiotic factor, whereas in the female, expression begins before meiosis is complete. From these distinctions, we can begin to consider in which processes of germ cell development GCNF participates. Then, by identifying GCNF binding sites in the promoters of genes known to be involved in gametogenesis, we can assign potential target genes for regulation by GCNF.

Because GCNF is expressed at very different times (relative to meiosis) in the male and female, it is unlikely that it regulates the expression of genes that are essential for the basic mechanisms of the meiotic reduction division. GCNF might, though, participate in the highly regulated timing of meiosis in the female, because this timing differs in the male (17). In the female mouse, delays of days to months occur in the first prophase and the second metaphase of meiosis. An example of such a sex-specific regulator is the c-Mos protein, which acts to block the oocyte from proceeding through metaphase II until fertilization (18, 19).

In the male, postmeiotic expression of GCNF also opens many possibilities for its role in male gamete development. After reviewing the cloned cDNAs that are known to be haploid specific, several of these factors could be prime candidates for regulation by GCNF. These include the protamine 1 and 2 genes and the transition protein genes (20). These proteins participate in the dramatic restructuring of chromatin, allowing for elongation of the spermatids. Because GCNF is expressed during round spermatid development, just before these structural changes take place, it might regulate expression of the genes responsible for terminal differentiation. In fact, the protamine 1 and 2 genes do contain potential binding sites for GCNF in their promoters (21). GCNF has been shown to bind to half-sites of the AGGTCA motif, to which other nuclear receptors of its class bind. The GCNF-specific binding site consists of two half-sites arranged in direct orientation with no spacing between them, a DR0 (1). The protamine 1 promoter contains two such sequences, whereas the protamine 2 promoter contains one. In unpublished observations, GCNF has demonstrated binding to these sites in vitro (G. C. Hummelke and A. J. Cooney, unpublished). Additionally, several novel sequence tags of expressed genes have been identified that fit the different classifications of spermatogenic specific genes (22, 23). Again, promoter analysis of these genes might tie GCNF more closely to their expression.

Delineation of the expression patterns of GCNF might also lead to clues about potential ligands that regulate its activity. Though GCNF is expressed in the androgen-sensitive period of spermatogenesis (24), it is not activated by testosterone or dihydroxytestosterone in the experimental systems developed so far (A. J. Cooney, unpublished data). A metabolite might be activate, though, because members of the nuclear receptor superfamily often bind a variety of small hydrophobic or amphipathic molecules (25).

Finally, our analysis of the two different messages for GCNF has revealed that they differ in their extreme 3' untranslated regions. In the male, there are two different messages in the testis, which may indicate posttranscriptional processing and, possibly, delayed translation. This is seen with the protamine genes, which are transcribed in late round spermatids but not translated until the elongated spermatid stage. Perhaps, then, protein expression of GCNF is regulated. Alternatively, the longer message may be random read-through of the splice and polyA signal.

In the female, it was shown that a probe specific for the larger message hybridized to mRNA in the oocyte, indicating that the larger message is present. Without further analysis, using an ribonuclease protection strategy, it is not clear whether oocytes produce only the larger message, both messages, or a message of altogether different length. Like spermatogenic messages, posttranscriptional regulation of oocyte mRNAs, such as that from the tPA gene (26), also have been defined. Though the sequences required for polyA addition are not found in the GCNF 3' untranslated region, the sequence specific for delayed translation is (1, 27, 28).

In conclusion, these expression studies have further defined where GCNF fits into the intricate pathways of germ cell development. Certainly, more information will be learned by the identification of physiologically relevant target genes and potential ligands. With this knowledge, some causes of idiopathic infertility may become clearer, and novel contraceptives may be developed.


    Acknowledgments
 
The authors wish to thank Dr. Fred Pereira for help with in situ analysis; and Drs. Bert O’Malley, Dolores Lamb, and Marvin Meistrich, and Geoffrey Hummelke for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by NIDDK Fellowship F32 DK-09316 (to D.K.) and NICHD Grant HD-690105 (to A.J.C.). Back

Received May 5, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chen F, Cooney AJ, Wang Y, Law S, O’Malley BW 1994 Cloning of a novel orphan receptor (GCNF) expressed during germ cell development. Mol Endocrinol 8:1434–1444[Abstract/Free Full Text]
  2. Hirose T, O’Brien DA, Jetten AM 1995 RTR: a new member of the nuclear receptor superfamily that is highly expressed in murine testis. Gene 152:247–251[CrossRef][Medline]
  3. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans R 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  4. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166[Abstract/Free Full Text]
  5. Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery Jr CA, Shyamala G, Conneely OM, O’Malley BW 1995 Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9:2266–2278[Abstract/Free Full Text]
  6. McPhaul MJ, Marcelli M, Zoppi S, Griffin JE, Wilson JD 1993 Genetic basis of endocrine disease 4: the spectrum of mutations in the androgen receptor gene that causes androgen resistance. J Clin Endocrinol Metab 76:17–23[Abstract]
  7. Kastner P, Mark M, Leid M, Gansmuller A, Chin W, Grondona JM, Decimo D, Krezel W, Dierich A, Chambon P 1996 Abnormal spermatogenesis in RXRß mutant mice. Genes Dev 10:80–92[Abstract/Free Full Text]
  8. Lufkin T, Lohnes D, Mark M, Dierich A, Gorry P, Gaub M-P, LeMeur M, Chambon P 1993 High postnatal lethality and testis degeneration in retinoic acid receptor {alpha} mutant mice. Proc Natl Acad Sci USA 90:7225–7229[Abstract/Free Full Text]
  9. Lou X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  10. Russell LD, Ettlin RA, SinhaHikim AP, Clegg ED 1990 Histological and Histopathological Evaluation of the Testis. Cache River Press, Clearwater, FL, pp 119–161
  11. Niederberger C, Agulnik AI, Cho Y, Lamb D, Bishop CE 1997 In situ hybridization shows that Dzla expression in mouse testis is restricted to premeiotic stages IV–VI of spermatogenesis. Mamm Genome 8:277–278[CrossRef][Medline]
  12. Mason AJ, Hayflick JS, Zoeller RT, Young III WS, Phillips HS, Nikolics K, Seeburg PH 1986 A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science 234:1366–1371[Abstract/Free Full Text]
  13. Cattanach BM, Iddon CA, Charlton HM, Chiappa SA, Fink G 1977 Gonadotropin-releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 269:338–390[CrossRef][Medline]
  14. Russell LD, Alger LE, Nequin LG 1987 Hormonal control of pubertal spermatogenesis. Endocrinology 120:1615–1632[Abstract/Free Full Text]
  15. Slaughter GR, Needleman DS, Means AR 1987 Developmental regulation of calmodulin, actin and tubulin RNAs during rat testis differentiation. Biol Reprod 37:1259–1270[Abstract]
  16. Zhou G-Q, Deng K, Labosky PA, Liaw L, Hogan BLM 1996 The gene encoding bone morphogenetic protein 8b is required for the initiation and maintenance of spermatogenesis in the mouse. Genes Dev 10:1657–1669[Abstract/Free Full Text]
  17. Honigberg SM, McCarroll RM, Esposito RE 1993 Regulatory mechanisms in meiosis. Curr Opin Cell Biol 5:219–225[CrossRef][Medline]
  18. Colledge WH, Carlton MBL, Udy GB, Evans MJ 1994 Disruption of c-mos causes parthenogenetic development of unfertilized mouse eggs. Nature 370:65–68[CrossRef][Medline]
  19. Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K, Nagayoshi M, Takeda N, Ikawa Y, Aizawa S 1994 Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature 370:68–71[CrossRef][Medline]
  20. Wykes SM, Nelson JE, Visscher DW, Djakiew D, Krawetz SA 1995 Coordinate expression of the PRM1, PRM2 and TNP2 multigene locus in human testis. DNA Cell Biol 14:155–161[Medline]
  21. Johnson PA, Peschon JJ, Yelick PC, Palmiter RD, Hecht NB 1988 Sequence homologies in the mouse protamine 1 and 2 genes. Biochim Biophys Acta 950:45–53[Medline]
  22. Yuan L, Liu J-G, Hoog C 1995 Rapid cDNA sequencing in combination with RNA expression studies in mice identifies a large number of male germ cell-specific sequence tags. Biol Reprod 52:131–138[Abstract]
  23. Penttila T-L, Yaun L, Mali P, Hoog C, Parvinen M 1995 Haploid gene expression: temporal onset and storage patterns of 13 novel transcripts during rat and mouse spermiogenesis. Biol Reprod 53:499–510[Abstract]
  24. O’Donnell L, McLachlan RI, Wreford NG, Robertson DM 1994 Testosterone promotes the conversion of round spermatids between stages VII and VIII of the rat spermatogenic cycle. Endocrinology 135:2608–2614[Abstract]
  25. Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
  26. Vassalli J-D, Huarte J, Belin D, Gubler P, Vassalli A, O’Connell ML, Parton LA, Rickles RJ, Strickland S 1989 Regulated polyadenylation controls mRNA translation during meiotic maturation of mouse oocytes. Genes Dev 3:2163–2171[Abstract/Free Full Text]
  27. West MF, Verrotti AC, Salles FJ, Tsirka SE, Strickland S 1996 Isolation and characterization of two novel, cytoplasmically polyadenylated, oocyte-specific, mouse maternal RNAs. Dev Biol 175:132–141[CrossRef][Medline]
  28. Fox CA, Sheets MD, Wickens MP 1989 Poly (A) addition during maturation of frog oocytes: distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU. Genes Dev 3:2151–2162[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
Z.-J. Lan, X. Xu, A. C.-K. Chung, and A. J. Cooney
Extra-Germ Cell Expression of Mouse Nuclear Receptor Subfamily 6, Group A, Member 1 (NR6A1)
Biol Reprod, May 1, 2009; 80(5): 905 - 912.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q.-Y. Sun, K. Liu, and K. Kikuchi
Oocyte-Specific Knockout: A Novel In Vivo Approach for Studying Gene Functions During Folliculogenesis, Oocyte Maturation, Fertilization, and Embryogenesis
Biol Reprod, December 1, 2008; 79(6): 1014 - 1020.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
N. Yan, Y. Lu, H. Sun, D. Tao, S. Zhang, W. Liu, and Y. Ma
A microarray for microRNA profiling in mouse testis tissues
Reproduction, July 1, 2007; 134(1): 73 - 79.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. Mikawa, T. Morozumi, S.-I. Shimanuki, T. Hayashi, H. Uenishi, M. Domukai, N. Okumura, and T. Awata
Fine mapping of a swine quantitative trait locus for number of vertebrae and analysis of an orphan nuclear receptor, germ cell nuclear factor (NR6A1)
Genome Res., May 1, 2007; 17(5): 586 - 593.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Rajkovic, R. Middendorff, M. G. Wetzel, D. Frkovic, S. Damerow, H. J. Seitz, and J. M. Weitzel
Germ Cell Nuclear Factor Relieves cAMP-response Element Modulator {tau}-mediated Activation of the Testis-specific Promoter of Human Mitochondrial Glycerol-3-phosphate Dehydrogenase
J. Biol. Chem., December 10, 2004; 279(50): 52493 - 52499.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
U. Sattler, M. Samochocki, A. Maelicke, and C. Zechel
The Expression Level of the Orphan Nuclear Receptor GCNF (Germ Cell Nuclear Factor) Is Critical for Neuronal Differentiation
Mol. Endocrinol., November 1, 2004; 18(11): 2714 - 2726.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y.-S. Kim, G. Nakanishi, A. J. Oudes, K. H. Kim, H. Wang, D. L. Kilpatrick, and A. M. Jetten
Tsp57: A Novel Gene Induced During a Specific Stage of Spermatogenesis
Biol Reprod, January 1, 2004; 70(1): 106 - 113.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. Yang, Y.-L. Zhang, G. M. Buchold, A. M. Jetten, and D. A. O'Brien
Analysis of Germ Cell Nuclear Factor Transcripts and Protein Expression During Spermatogenesis
Biol Reprod, May 1, 2003; 68(5): 1620 - 1630.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Hu, Z. Zhou, C. Xu, Q. Shang, Y.-D. Zhang, and Y.-L. Zhang
Androgen Down-Regulated and Region-Specific Expression of Germ Cell Nuclear Factor in Mouse Epididymis
Endocrinology, April 1, 2003; 144(4): 1612 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Z.-J. Lan, P. Gu, X. Xu, and A. J. Cooney
Expression of the Orphan Nuclear Receptor, Germ Cell Nuclear Factor, in Mouse Gonads and Preimplantation Embryos
Biol Reprod, January 1, 2003; 68(1): 282 - 289.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-J. Lan, A. C.-K. Chung, X. Xu, F. J. DeMayo, and A. J. Cooney
The Embryonic Function of Germ Cell Nuclear Factor Is Dependent on the DNA Binding Domain
J. Biol. Chem., December 20, 2002; 277(52): 50660 - 50667.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. S. Richards
Perspective: The Ovarian Follicle--A Perspective in 2001
Endocrinology, June 1, 2001; 142(6): 2184 - 2193.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. C.-K. Chung, D. Katz, F. A. Pereira, K. J. Jackson, F. J. DeMayo, A. J. Cooney, and B. W. O'Malley
Loss of Orphan Receptor Germ Cell Nuclear Factor Function Results in Ectopic Development of the Tail Bud and a Novel Posterior Truncation
Mol. Cell. Biol., January 15, 2001; 21(2): 663 - 677.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H.-b. Lin, M. Jurk, T. Gulick, and G. M. Cooper
Identification of COUP-TF as a Transcriptional Repressor of the c-mos Proto-oncogene
J. Biol. Chem., December 17, 1999; 274(51): 36796 - 36800.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Giguère
Orphan Nuclear Receptors: From Gene to Function
Endocr. Rev., October 1, 1999; 20(5): 689 - 725.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
H. Greschik, J.-M. Wurtz, P. Hublitz, F. Kohler, D. Moras, and R. Schule
Characterization of the DNA-Binding and Dimerization Properties of the Nuclear Orphan Receptor Germ Cell Nuclear Factor
Mol. Cell. Biol., January 1, 1999; 19(1): 690 - 703.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Yan and A. M. Jetten
Characterization of the Repressor Function of the Nuclear Orphan Receptor Retinoid Receptor-related Testis-associated Receptor/Germ Cell Nuclear Factor
J. Biol. Chem., November 3, 2000; 275(45): 35077 - 35085.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katz, D.
Right arrow Articles by Cooney, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katz, D.
Right arrow Articles by Cooney, A. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals