| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Cell Biology (D.K., G.R.S., A.J.C.), Baylor College of Medicine, Houston, Texas 77030; and Department of Urology (C.N.), University of Illinois at Chicago, Chicago, Illinois 60612
Address all correspondence and requests for reprints to: Austin J. Cooney, Baylor College of Medicine, Department of Cell Biology, 1 Baylor Plaza, Houston, Texas 77030. E-mail: acooney{at}bcm.tmc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Germ cell nuclear factor (GCNF) is an orphan member of the nuclear
receptor superfamily of transcription factors (1, 2). It has regions,
including the zinc finger DNA-binding domain (DBD), that are
significantly homologous to the classical members of this superfamily
(3), the receptors for the steroid, retinoic acid, and thyroid
hormones. Many members of this superfamily have important roles in
reproduction. The estrogen (4) and progesterone (5) receptors have been
shown, by germline mutation in the mouse, to be required for normal
ovarian and uterine development. The androgen receptor is required for
male sexual development, as seen in humans who are phenotypically
female but genotypically male because of mutations or deletions of the
androgen receptor gene (6). Additionally, retinoids are critical for
spermatogenesis by transmitting signals through the retinoic acid
receptor (RAR) and retinoid X receptor (RXR) receptors. Mutation of the
RXRß receptor in the germline of male mice leads to significant
abnormalities in mature spermatozoa (7), whereas mutation of RAR
leads to testis degeneration (8). Even members of the nuclear receptor
superfamily that do not have known hormonal ligands have been
implicated in reproductive development. For example, mice with mutant
SF-1 alleles lack gonads entirely (9). GCNF also may play a role in
reproduction because, in the adult mouse, it is expressed predominantly
in the germ cells (1, 2). Northern analysis showed that two messages in
testis RNA hybridized to the GCNF probe, whereas the more sensitive
ribonuclease protection assay detected messenger RNA (mRNA) in the
ovary. Overexpression of the Northern also showed a very low level of
expression in the kidney and liver (1). Upon in situ
hybridization of the gonads, it became clear that GCNF is expressed
exclusively in the oocyte and spermatogenic cells.
Many questions exist about GCNF function. It is classified as an orphan receptor, because no ligand has been identified. Therefore, it is important to know if there is an activating ligand or if GCNF is activated by other signaling networks. As a transcription factor, it is relevant to know which genes GCNF activates and where they lie in signaling pathways for the development or function of specific cells. Finally, the nature of the two messages is of interest in determining whether there is more than one isoform of GCNF or whether the GCNF mRNA is subject to posttranscriptional regulation.
To begin to address these questions, we first characterized more specifically when GCNF is expressed in the germ cells. In this paper, we show that in the male, GCNF expression is postmeiotic, occurring in the round spermatids. In the female, expression occurs before the completion of meiosis, correlating with the start of oocyte growth. Furthermore, we have analyzed the expression of the two messages of GCNF. The larger message contains the entire cloned mRNA, whereas the smaller is missing the extreme 3' untranslated region. Additionally, we show that the expression of GCNF is conserved between the rat and mouse.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In situ analysis
In situ hybridization on testis and ovary sections
was performed as described previously (1). Ovaries and testis tissues
were fixed overnight in 4% paraformaldehyde and dehydrated step-wise
to 70% ethanol. Seven micron sections were made from wax-embedded
preparations. For probes of the entire complementary DNA (cDNA)
sequence, 35S-labeled antisense RNA probes were transcribed
from the T7 promoter of pBluescript containing the GCNF cDNA and cut
with BamHI restriction enzyme. Antisense riboprobes of the
isolated DBD were transcribed from a PCR fragment engineered to contain
a T7 promoter. Specifically, the cDNA was used as a template in a PCR
protocol with the 5' primer: ACCGCGCTACGGGCTTGC (bp 442–459); and 3'
primer: GGATCCTAATACGACTCACTATAGGGAGGTGGTCCAATGCTCTTGTT (bp
666–683). Similarly, the 3'UT probe was transcribed from a PCR product
of the cDNA with the 5' primer: GATGCTGCTGTCAAGTTTTCA (bp 2341–2361);
and the 3' primer: GGATCCTAATACGACTCACTATAGGGAGGCTCTACCTTTTGAGGGAAAC
(bp 2583–2602).
Quantitation of in situ signal
The in situ hybridizations were stained with
hemotoxylin and the histology analyzed to determine specific cell
associations within each tubule. These were classified according to the
stages defined in Russell et al. (10). The actual number of
silver grains in the spermatids during each of the 12 stages was
quantitated by computer-aided analysis, as described previously (11).
Briefly, a bandwidth filter was implemented in the Interactive Data
Language (IDL, Research Systems, Inc., Boulder, CO) to analyze 24-bit
color images captured from light microscopy of the in situ
hybridized sections. The bandwidth filter was tuned to exclude all but
the pixels corresponding to the darkened radioisotope reacted silver
grains. The IDL program then automatically calculated the ratio of
grain area per identified seminiferous tubular area. The measurements
were replicated for spermatogenic stage, and the resulting means and
standard errors for multiple tubules analyzed within one mouse are
denoted in the accompanying figures. Using the computer filter, silver
grains in premeiotic and meiotic germ cells were compared with slide
background (data not shown) and found to be not significantly different
from background.
Northern analysis
Total RNA was prepared from rat and mouse testis using guanidium
isothiocyanate/phenol chloroform extraction (Stratagene, La Jolla, CA).
Approximately 10 µg of RNA was loaded onto a formaldehyde gel and
electrophoresed overnight. After removing the formaldehyde, the RNA was
blotted onto Zetaprobe membrane (BioRad, Hercules, CA) in 20x SSC (3
M NaCl, 0.3 M Na3 citrate, pH 7.0).
Hybridization was done at 60 C overnight in Church buffer (500
mM Na2HPO4, pH 7.2; 1
mM EDTA, 7% SDS, 100 ug/ml single-stranded DNA) and washes
performed at room temperature and 55 C with 40 mM
Na2HPO4 (pH 7.2), 1% SDS. The probe of
full-length GCNF was made by random priming (Boehringer Mannheim
Biochemicals, Indianapolis, IN) with 32PdeoxyCTP and
32PdeoxyATP incorporation into the entire cDNA, whereas
those for the isolated DBD and 3'UT were made by Klenow labeling of PCR
products using specific primers. These specific primers for PCR and
labeling were the same as those described above for in situ
hybridization, except that the 3' primers lacked the T7 promoter
sequences (GGATCCTAATACGACTCACTATAGGGAGG). The Northern blot mRNA
levels were quantitated by densitometry using a BioImage gel scanner
and Intelligent Quantifier Electrophoresis Image Analysis Software
(BioImage, Ann Arbor, MI).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) shows that
the seminiferous tubules are considerably smaller than those of
wild-type mice (Fig. 1A). The hpg testis also show only
Sertoli cells, Leydig cells, and germ cells before the first prophase
of meiosis, whereas the seminiferous tubules of the wild-type mouse
display many layers of developing germ cells. When sections of testis
from both types of mice were hybridized to an 35S-labeled
antisense riboprobe of the entire coding sequence of GCNF, specific
hybridization to the germ cells of the wild-type testis was observed,
whereas no specific signal was seen on the hpg testis
(compare Fig. 1, C and D). Because there are only somatic cells and
early spermatogenic cells in the hpg seminiferous tubules,
we conclude that GCNF is not expressed in these early germ cells, in
the Sertoli or Leydig cells, and is, indeed, specific to germ cells in
the later stages of spermatogenesis.
|
reveals that GCNF is not expressed evenly in all
tubules in the cross-section shown. Spermatogenesis initiates in waves
along the length of the seminiferous tubule, and as the cells develop,
they move somewhat perpendicularly to the length of the tubule, either
toward the basal lamina or the lumen. Therefore, patterns of
developmentally distinct cell associations can be characterized in
different tubule cross-sections. Characterization of these cell
associations in the mouse has revealed 12 different arrangements,
indicating 12 different stages of spermatogenesis, according to Russell
et al (10). Because the level of GCNF expression varies
among cross-sections of tubules, it is not similar in each type of
tubule; it is probably expressed at distinct phases of
spermatogenesis.
In an early stage (II-III) tubule (10), shown in Fig. 2A, there are four different
spermatogenic cell types. The small, flattened, mitotic spermatogonia
lie along the basal lamina, whereas the larger, densely staining
spermatocytes in the first prophase of meiosis are adjacent to them,
closer to the lumen. Next, the more diffuse, postmeiotic round
spermatids emerge and finally change into densely staining, maturing
spermatids with their characteristic elongated heads. In this early
stage tubule, expression of GCNF can be seen by in situ
hybridization over the round spermatids, whereas a background level of
signal is observed in the spermatogonia and spermatocytes. In a stage
VIII tubule (10, Fig. 2B), round spermatids are present in the layer
between pachytene spermatocytes and elongating spermatids. These round
spermatids, in their last stages before terminal differentiation and
elongation, show very significant levels of GCNF hybridization.
Finally, in Fig. 2C, a later stage (IX) tubule (10), demonstrates only
low levels of GCNF expression. This tubule displays early
spermatocytes, pachytene spermatocytes, and elongating spermatids but
an absence of round spermatids. Residual expression of GCNF may be
caused by slow degradation of its message.
|
shows a graph of this
quantitation of expression in spermatids at each of the stages of
spermatogenesis from several tubules of one animal (the same results
were obtained from several animals). Briefly, this was done by using a
bandwidth filter to determine grain distribution, which was then
expressed as the number of pixels per unit area of spermatids,
subtracting the average background density of regions of the slide not
containing tissue. GCNF message is expressed in stage I round
spermatids at a high basal level. The analysis demonstrated that round
spermatids in stage VII and VIII tubules express the highest levels of
GCNF and that expression is significantly lower by stage X, where there
are no round spermatids. Again, the residual expression may be caused
by the mRNA half-life, which may allow it to persist into the early
elongating spermatids. The high levels of expression, though, in the
stage VII and VIII tubules do reflect an increase in the concentration
of GCNF message, because the signal density increases significantly.
GCNF, therefore, emerges as a postmeiotic factor, which is expressed in
the final phase of gene expression during round spermatid development,
just before initiation of the dramatic morphological changes of
elongation.
Next, we analyzed the expression of GCNF in the testis across puberty
to determine its expression pattern in the developing animal. Although
primordial germ cells are present in the prepubertal mouse testis, the
optimal production of more advanced stages of sperm development does
not occur until the influence of gonadotropic hormones (14). Therefore,
if GCNF is present only in the maturing postmeiotic spermatids, message
should emerge during puberty, when these cells first appear. Northern
analysis (Fig. 3A) of total RNA from the
testis of mice, 5–40 days old, was performed using a
32P-labeled probe of the GCNF cDNA. Each time point
represents total RNA isolated from two to five testis pooled from
different individual mice. The entire experiment was repeated with
similar results. Though both messages are almost undetectable at 5 and
10 days old, the larger, 7.5-kb, message appears very faintly at day 15
and increases to day 25. There is a decrease in the message at day 30
(Fig. 3, A and B), followed by a further increase and maintenance to
maturity at day 40. The smaller message, in contrast, increases
steadily from day 20 to day 40.
|
shows a graph of the quantitation of total in situ
hybridization of the GCNF probe to testis sections of the ages in Fig. 3A. Each time point represents a single animal, and the mean and
standard error are of multiple tubules analyzed within an animal.
Repetition of the entire experiment produced similar results. In
agreement with the Northern signal, in situ hybridization
begins to become specific at 20 days. A peak is reached by 25 days,
which is followed by a significant decrease in signal by day 30 and
then a steady increase to adulthood. The transient peak seen at day 25
is reflected in the Northern blot, where the signal for day 30 is
weaker than that for day 25 (Fig. 3, A and B). This may be caused by
the characteristics of the first round of spermatogenesis. A greater
percentage of cells are all in the round spermatid stage at this point
in development than they are later, when different tubules are
initiating at different times. Therefore, the first round, at day 25,
will show a higher level of signal than at day 30, when elongating
spermatids have appeared and the proportion of GCNF expression
decreases. Eventually, the overall expression level of GCNF will
increase as the testis grows. A similar phenomenon was seen with peaks
in the expression of mRNAs encoding calmodulin, -tubulin, and
ß-tubulin during the first wave of spermatogenesis (15). Furthermore,
Zhou et al, have described differences in the expression and
actions of the growth factor Bmp 8b on spermatogenesis during early
puberty, as compared with cycles in the mature mouse (16).
On a cellular level, specific hybridization to tubules in the
20-day-old mouse testis can be seen. In fact, in testes this young,
tubules that have matured to the point of producing round spermatids
can be distinguished from those that have not, as seen by comparing the
left with the right tubule in Fig. 3D. In Fig. 3D, it is clear that
tubules that display round spermatids show specific hybridization over
these cells. Therefore, GCNF is a postmeiotically expressed
transcription factor that, assuming translation in round spermatids,
has the potential to regulate genes involved in the morphological
changes of spermatid elongation.
Finally, the species conservation of GCNF was examined. Using a mouse
probe of the full-length message, GCNF is clearly detected in sections
of the rat testis (Fig. 4A). As in the
mouse testis, different tubules show different levels of hybridization,
indicating stage-specific expression of GCNF in the rat. The staging of
tubules in the rat is similar to that in the mouse, but the rat
displays 14 stages, as opposed to the 12 of the mouse (10). Indeed,
GCNF expression peaks in stages VI–VIII in the rat (Fig. 4B), which
corresponds with stages VII–VIII in the mouse (10). Both species show
expression in the last appearance of round spermatids before initiation
of elongation. As before, several tubules from the rat testis were
analyzed to obtain the quantitation information.
|
shows several
follicles that are in the stage of development, with two layers of
granulosa cells and one prominent follicle (on the bottom of
picture) that is in the preovulatory stage. All of these growing
follicles express significant levels of GCNF. To address the early
stages of oocyte development, we looked at the ovaries of young
prepubertal mice (Fig. 5B). GCNF expression is present in oocytes of
mice as young as 5 days, which coincides with the beginning of
follicular and oocyte growth. In fact, as shown in Fig. 5B, GCNF
expression is observed in oocytes of follicles that have just begun to
grow and have only one layer of cuboidal granulosa cells, whereas it is
not present in the nests of primordial follicles, which have not yet
begun follicular growth. Therefore, GCNF expression is characteristic
of maturing oocytes throughout their tenure of growth but is not
present in primordial oocytes.
|
. To differentiate between
these two messages, we used probes generated from different portions of
the cloned cDNA, as shown in Fig. 6A.
When the probe spanning the DBD is hybridized to mouse testis total
RNA, the same two bands detected by the full-length probe are seen
(Fig. 6B). In contrast, when a probe derived from the far 3'
untranslated region of the cloned cDNA is used, only the larger message
is observed. Therefore, the two messages differ, at least in the
presence or absence of the cloned extreme 3' untranslated region. Thus,
the full cloned cDNA originates from the larger message; however, the
smaller message also contains the DBD and, most likely, the other
translated regions.
|
demonstrates that rats display a homologous message for GCNF,
but we were curious as to how far this homology extends. In Fig. 6B, rat testis RNA was probed with the same common and message-specific
probes as was the mouse testis RNA. Like the mouse, the full-length
coding region and DBD probes hybridized to the rat RNA in two messages
that are very similar in size to those of the mouse. The 3'UT probe,
which was specific for the larger mouse message, hybridized poorly to
the rat RNA. Therefore, whereas the rat has two messages like the mouse
and shares sequence homology in the coding region, this conservation
may not be as strong in the 3'untranslated region in the rat. Further
analysis might show, though, that isolated sequences of the
3'untranslated region, which signal for different posttranscriptional
processes, might be conserved between the two species.
In the ovary, both probes hybridize to the same individual oocytes, as
seen in serial sections (Fig. 6, C and D). Because Northern analysis is
not sensitive enough to detect GCNF, because of the limited RNA of the
oocytes, we can conclude from these in situ studies that at
least the larger message is present in the oocyte.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Because GCNF is expressed at very different times (relative to meiosis) in the male and female, it is unlikely that it regulates the expression of genes that are essential for the basic mechanisms of the meiotic reduction division. GCNF might, though, participate in the highly regulated timing of meiosis in the female, because this timing differs in the male (17). In the female mouse, delays of days to months occur in the first prophase and the second metaphase of meiosis. An example of such a sex-specific regulator is the c-Mos protein, which acts to block the oocyte from proceeding through metaphase II until fertilization (18, 19).
In the male, postmeiotic expression of GCNF also opens many possibilities for its role in male gamete development. After reviewing the cloned cDNAs that are known to be haploid specific, several of these factors could be prime candidates for regulation by GCNF. These include the protamine 1 and 2 genes and the transition protein genes (20). These proteins participate in the dramatic restructuring of chromatin, allowing for elongation of the spermatids. Because GCNF is expressed during round spermatid development, just before these structural changes take place, it might regulate expression of the genes responsible for terminal differentiation. In fact, the protamine 1 and 2 genes do contain potential binding sites for GCNF in their promoters (21). GCNF has been shown to bind to half-sites of the AGGTCA motif, to which other nuclear receptors of its class bind. The GCNF-specific binding site consists of two half-sites arranged in direct orientation with no spacing between them, a DR0 (1). The protamine 1 promoter contains two such sequences, whereas the protamine 2 promoter contains one. In unpublished observations, GCNF has demonstrated binding to these sites in vitro (G. C. Hummelke and A. J. Cooney, unpublished). Additionally, several novel sequence tags of expressed genes have been identified that fit the different classifications of spermatogenic specific genes (22, 23). Again, promoter analysis of these genes might tie GCNF more closely to their expression.
Delineation of the expression patterns of GCNF might also lead to clues about potential ligands that regulate its activity. Though GCNF is expressed in the androgen-sensitive period of spermatogenesis (24), it is not activated by testosterone or dihydroxytestosterone in the experimental systems developed so far (A. J. Cooney, unpublished data). A metabolite might be activate, though, because members of the nuclear receptor superfamily often bind a variety of small hydrophobic or amphipathic molecules (25).
Finally, our analysis of the two different messages for GCNF has revealed that they differ in their extreme 3' untranslated regions. In the male, there are two different messages in the testis, which may indicate posttranscriptional processing and, possibly, delayed translation. This is seen with the protamine genes, which are transcribed in late round spermatids but not translated until the elongated spermatid stage. Perhaps, then, protein expression of GCNF is regulated. Alternatively, the longer message may be random read-through of the splice and polyA signal.
In the female, it was shown that a probe specific for the larger message hybridized to mRNA in the oocyte, indicating that the larger message is present. Without further analysis, using an ribonuclease protection strategy, it is not clear whether oocytes produce only the larger message, both messages, or a message of altogether different length. Like spermatogenic messages, posttranscriptional regulation of oocyte mRNAs, such as that from the tPA gene (26), also have been defined. Though the sequences required for polyA addition are not found in the GCNF 3' untranslated region, the sequence specific for delayed translation is (1, 27, 28).
In conclusion, these expression studies have further defined where GCNF fits into the intricate pathways of germ cell development. Certainly, more information will be learned by the identification of physiologically relevant target genes and potential ligands. With this knowledge, some causes of idiopathic infertility may become clearer, and novel contraceptives may be developed.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received May 5, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mutant mice. Proc Natl Acad
Sci USA 90:7225–7229This article has been cited by other articles:
 |
|
 |
|
  Z.-J. Lan, X. Xu, A. C.-K. Chung, and A. J. Cooney Extra-Germ Cell Expression of Mouse Nuclear Receptor Subfamily 6, Group A, Member 1 (NR6A1) Biol Reprod, May 1, 2009; 80(5): 905 - 912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q.-Y. Sun, K. Liu, and K. Kikuchi Oocyte-Specific Knockout: A Novel In Vivo Approach for Studying Gene Functions During Folliculogenesis, Oocyte Maturation, Fertilization, and Embryogenesis Biol Reprod, December 1, 2008; 79(6): 1014 - 1020. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Yan, Y. Lu, H. Sun, D. Tao, S. Zhang, W. Liu, and Y. Ma A microarray for microRNA profiling in mouse testis tissues Reproduction, July 1, 2007; 134(1): 73 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mikawa, T. Morozumi, S.-I. Shimanuki, T. Hayashi, H. Uenishi, M. Domukai, N. Okumura, and T. Awata Fine mapping of a swine quantitative trait locus for number of vertebrae and analysis of an orphan nuclear receptor, germ cell nuclear factor (NR6A1) Genome Res., May 1, 2007; 17(5): 586 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al. International Union of Pharmacology. LXVI. Orphan Nuclear Receptors Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rajkovic, R. Middendorff, M. G. Wetzel, D. Frkovic, S. Damerow, H. J. Seitz, and J. M. Weitzel Germ Cell Nuclear Factor Relieves cAMP-response Element Modulator {tau}-mediated Activation of the Testis-specific Promoter of Human Mitochondrial Glycerol-3-phosphate Dehydrogenase J. Biol. Chem., December 10, 2004; 279(50): 52493 - 52499. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Sattler, M. Samochocki, A. Maelicke, and C. Zechel The Expression Level of the Orphan Nuclear Receptor GCNF (Germ Cell Nuclear Factor) Is Critical for Neuronal Differentiation Mol. Endocrinol., November 1, 2004; 18(11): 2714 - 2726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-S. Kim, G. Nakanishi, A. J. Oudes, K. H. Kim, H. Wang, D. L. Kilpatrick, and A. M. Jetten Tsp57: A Novel Gene Induced During a Specific Stage of Spermatogenesis Biol Reprod, January 1, 2004; 70(1): 106 - 113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Yang, Y.-L. Zhang, G. M. Buchold, A. M. Jetten, and D. A. O'Brien Analysis of Germ Cell Nuclear Factor Transcripts and Protein Expression During Spermatogenesis Biol Reprod, May 1, 2003; 68(5): 1620 - 1630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hu, Z. Zhou, C. Xu, Q. Shang, Y.-D. Zhang, and Y.-L. Zhang Androgen Down-Regulated and Region-Specific Expression of Germ Cell Nuclear Factor in Mouse Epididymis Endocrinology, April 1, 2003; 144(4): 1612 - 1619. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-J. Lan, P. Gu, X. Xu, and A. J. Cooney Expression of the Orphan Nuclear Receptor, Germ Cell Nuclear Factor, in Mouse Gonads and Preimplantation Embryos Biol Reprod, January 1, 2003; 68(1): 282 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-J. Lan, A. C.-K. Chung, X. Xu, F. J. DeMayo, and A. J. Cooney The Embryonic Function of Germ Cell Nuclear Factor Is Dependent on the DNA Binding Domain J. Biol. Chem., December 20, 2002; 277(52): 50660 - 50667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards Perspective: The Ovarian Follicle--A Perspective in 2001 Endocrinology, June 1, 2001; 142(6): 2184 - 2193. [Full Text] [PDF]
|
|
|
|
 |
|
 A. C.-K. Chung, D. Katz, F. A. Pereira, K. J. Jackson, F. J. DeMayo, A. J. Cooney, and B. W. O'Malley Loss of Orphan Receptor Germ Cell Nuclear Factor Function Results in Ectopic Development of the Tail Bud and a Novel Posterior Truncation Mol. Cell. Biol., January 15, 2001; 21(2): 663 - 677. [Abstract] [Full Text]
|
|
|
|
|
|
H.-b. Lin, M. Jurk, T. Gulick, and G. M. Cooper Identification of COUP-TF as a Transcriptional Repressor of the c-mos Proto-oncogene J. Biol. Chem., December 17, 1999; 274(51): 36796 - 36800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Giguère Orphan Nuclear Receptors: From Gene to Function Endocr. Rev., October 1, 1999; 20(5): 689 - 725. [Abstract] [Full Text]
|
|
|
|
|
|
H. Greschik, J.-M. Wurtz, P. Hublitz, F. Kohler, D. Moras, and R. Schule Characterization of the DNA-Binding and Dimerization Properties of the Nuclear Orphan Receptor Germ Cell Nuclear Factor Mol. Cell. Biol., January 1, 1999; 19(1): 690 - 703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yan and A. M. Jetten Characterization of the Repressor Function of the Nuclear Orphan Receptor Retinoid Receptor-related Testis-associated Receptor/Germ Cell Nuclear Factor J. Biol. Chem., November 3, 2000; 275(45): 35077 - 35085. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
