| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
(ER) and Estrogen Receptor-ß (ERß) Messenger Ribonucleic Acid in the Wild-Type and ER-Knockout Mouse
Receptor Biology Section (J.F.C., J.L., K.S.K.), Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709; and the Department of Medical Nutrition (K.G., J.-A.G.), Karolinska Institute, NOVUM, S-14186, Huddinge, Sweden
Address all correspondence and requests for reprints to: Dr. Kenneth S. Korach, Receptor Biology Section, Laboratory of Reproductive and Developmental Toxicology, National Institute of Environmental Health Sciences, National Institutes of Health, MD B3–02, P.O. Box 12233, Research Triangle Park, North Carolina 27709.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) and is able to mediate the effects of estradiol
in transfected mammalian cell lines. Essential to further
investigations of the possible physiological roles of ERß, and its
possible interactions with ER, are data on the tissue distribution
of the two ER types. Herein, we have described the optimization and use
of an RNase protection assay able to detect and distinguish messenger
RNA (mRNA) transcripts from both the ER and ERß genes in the
mouse. Because this assay is directly quantitative, a comparison of the
levels of expression within various tissues was possible. In addition,
the effect of disruption of the ER gene on the expression of the
ERß gene was also investigated using the ER-knockout (ERKO) mouse.
Transcripts encoding ER were detected in all the wild-type tissues
assayed from both sexes. In the female reproductive tract, the highest
expression of ERß mRNA was observed in the ovary and showed great
variation among individual animals; detectable levels were observed in
the uterus and oviduct, whereas mammary tissue was negative. In the
male reproductive tract, significant expression of ERß was seen in
the prostate and epididymis, whereas the testes were negative. In other
tissues of both sexes, the hypothalamus and lung were clearly positive
for both ER and ERß mRNA. The ERKO mice demonstrated slightly
reduced levels of ERß mRNA in the ovary, prostate, and epididymis.
These data, in combination with the several described phenotypes in
both sexes of the ERKO mouse, suggest that the biological functions of
the ERß protein may be dependent on the presence of ER in certain
cell types and tissues. Further characterization of the physiological
phenotypes in the ERKO mice may elucidate possible ERß specific
actions. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) as detected by high
affinity binding assays with radiolabeled-estradiol as well as the
demonstration of a measurable physiological response upon exposure to
the hormone. Mammalian tissues known to possess detectable levels of
ER include the tissues of the female and male reproductive tracts,
the female mammary gland, bone, the cardiovascular system, and regions
of the brain. The estrogen/ER signaling system is known to play
critical roles in the female, especially in the normal functions of the
reproductive tract, the development of secondary sex characteristics,
and in normal reproductive behavior. Recent descriptions of definitive
phenotypes in the male mouse after targeted disruption of the ER
gene (1, 2) as well as in a human male that is homozygous for a natural
mutation of the ER gene and subsequently estrogen resistant (3) have
now indicated critical roles for the estrogen signaling system in the
male. Furthermore, both natural and synthetic estrogens, presumably
acting through the ER protein, have been implicated in the
initiation and maintenance of neoplastic events, especially in the
tissues of the uterus, ovary, and mammary gland (4).
Until recently, ER was thought to be the only form of nuclear
receptor able to bind estradiol and ultimately mediate its hormonal
effects in the normal physiological processes of the mammal. This is in
contrast to other members of the nuclear receptor superfamily in which
multiple forms are known to exist, such as for the thyroid, retinoic
acid, and progesterone receptors (5). However, the recent descriptions
of a gene encoding a second type of estrogen receptor, termed ERß, in
the rat (6), mouse (7), and human (8) has prompted a reexamination of
the estrogen signaling system. The ERß protein is smaller than the
ER but possesses the modular structure of distinct functional
domains (A–F) characteristic of the members of the superfamily of
nuclear receptors. When compared with ER, the protein sequence of
the mouse ERß demonstrates considerable homology in the DNA and
ligand binding domains (6, 7, 8). Relative binding studies on in
vitro translated protein have shown that the ERß is able to bind
17ß-estradiol with an affinity similar to that of ER (8, 9).
Transactivation studies using an estrogen responsive reporter construct
transfected into the mammalian cell lines CHO, Hela, and Cos-1 have
shown that the ERß is able to mediate the effects of 17ß-estradiol
in a dose-dependent manner, although levels of induction were slightly
lower than those obtained with ER (6, 7, 8). Furthermore, these same
studies demonstrated that the estrogen stimulated transactivation was
specific to estradiol (6) and could be significantly reduced by the
addition of the known ER antagonists, hydroxy-tamoxifen (6, 7),
ICI-182780, raloxifene (7), and ICI-164384 (8).
Knowledge of the distribution of ERß in various tissues is limited at
this time. In the rat, the highest levels of ERß messenger RNA (mRNA)
as detected by in situ hybridization were reported in the
granulosa cells of primary, secondary, and mature follicles of the
ovary as well as in the prostate epithelium (6). A recent report also
demonstrated the use of in situ hybridization to detect
ERß mRNA in several regions of the anterior hypothalamus of the
female rat (10). In the human, ERß transcripts were detected by
Northern blot analysis in the testis, ovary, and thymus (8). In the
mouse, ERß transcripts were not detected in the liver, heart, kidney,
skeletal muscle, thymus, spleen, and brain when assayed by Northern
blot, indicating that these tissues are either negative for expression
or that ERß mRNA levels exist below the level of detection using this
technique (7). However, a more thorough study of the tissue
distribution of ERß is essential to continued investigations of its
functions and importance to the whole estrogen signaling system.
Herein, we describe an RNase protection assay (RPA) designed to detect
and distinguish mRNA transcripts from both the ER and ERß genes in
the mouse. This assay is directly quantitative, and therefore a
comparison of the expression levels of the ER and ERß mRNAs within
various tissues was possible. In the adult mouse, the highest level of
ERß mRNA was observed in the ovary of the female, the prostate and
epididymis of the male, followed by the hypothalamus and lung in both
sexes. In addition, a possible role for ER in the regulation of the
ERß gene would be difficult to study in the wild-type (WT) mouse
based on the known biological properties of each. Therefore, we have
employed the transgenic ER-knockout (ERKO) mouse, previously
described as homozygous for a disruption of the ER gene (11, 12, 13), to
investigate the effect of the lack of functional ER on the
expression pattern of the ERß gene. ERKO mice demonstrated slightly
decreased levels of ERß mRNA in the ovary, epididymis and prostate,
whereas no altered expression levels or patterns of ERß appeared in
the other tissues of either sex when compared with WT litter mates.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cloning of the ERß complementary DNA (cDNA) probe template
A 262-bp cDNA fragment of the mouse ERß gene was amplified
from WT ovary RNA by RT-PCR. All RT-PCR reagents were purchased from
Perkin-Elmer (Norwalk, CT) and all reactions carried out in a GeneAmp
9600 Thermal Cycler (Perkin-Elmer). The RT reaction was prepared
according to the manufacturer’s protocol using random hexamers, 0.5
µg of total WT ovary RNA, and scaled up to 50 µl per reaction. PCR
was then carried out using the following primers specific for ERß (bp
numbers refer to the rat ERß sequence (6), GCG accession no. U57439):
forward (bp +454; 5' TTCCCGGCAGCACCAGTAACC 3') and reverse (bp +695; 5'
TCCCTCTGTTTGCGTTGACTAG 3'). The PCR reaction consisted of 5 µl of the
cDNA preparation in a 25 µl reaction including 100 pmol of each
primer, deoxy (d)-NTPS at 0.2 mM each, Invitrogen Optimized
PCR buffer I (San Diego, CA) at 1x concentration, and 1.5 U UlTma DNA
polymerase (Perkin-Elmer), a thermostable DNA polymerase with
proofreading capability. Thermal cycling conditions consisted of an
initial 95 C/2 min followed by 35 cycles at 95 C/30 sec, 58 C/45 sec,
72 C/30 sec; followed by a final incubation of 72 C/7 min. The
amplified ERß cDNA fragment was then cloned into the SrfI
site of the pCR-Script SK(+) phagemid (Stratagene Cloning Systems, La
Jolla, CA) according to the manufacturer’s protocol such that
transcription with T3 RNA polymerase would generate the antisense
strand.
RNase protection assay
Sense and antisense riboprobes were generated from linearized
templates using the Maxiscript kit (Ambion, Austin, TX), the
appropriate RNA polymerase (T3 or T7), and the incorporation of
[32P]-CTP (Amersham, Arlington Heights, IL) according to
the manufacturer’s protocol. The mouse ER antisense riboprobe was
490 nucleotides (nt) in full length and produced a specific protected
fragment of 366 nt as previously described (14). The mouse ERß
antisense riboprobe was generated from the cloned cDNA fragment
described previously and was 318 nt in full length and generated a
protected fragment of 262 nt. An antisense riboprobe specific for mouse
cyclophilin, used to equate loading among lanes, was generated from the
template pTRI-Cyclophilin (Ambion) at a full-length of 165 nt and
produced a protected fragment of 103 nt.
For all RPA reactions 5 x 104 cpm of each probe, sample RNA, and yeast transfer tRNA (for a final total RNA equal to 25 µg) were mixed and ethanol precipitated at -70 C for 3 h to overnight. The resulting pellets were then processed through the RPA using the Hybspeed RPA kit (Ambion) according to the manufacturer’s protocol. Final analysis of protected fragments was carried out by electrophoresis on a 1.5-mm thick, 6% bis-acrylamide/8.3 M urea/1x TBE gel (National Diagnostics, Atlanta, GA) that was then fixed, dried, and exposed to a phosphorimager screen followed by exposure to x-ray film. All RPA results were analyzed with the aid of a PhosphorImager Storm 860 and accompanying ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß transcripts
The ER antisense riboprobes used in this study were specific for coding
regions in the mRNA of each ER type as shown in Fig. 1
. Radiolabeled sense riboprobes of the
same respective sequences resulted in no protected fragments when
incubated with WT ovary RNA or yeast transfer RNA (data not shown),
indicating the specificity of each of the antisense riboprobes for
their respective mRNAs. To determine if the designed antisense
riboprobes for the mouse ER and ERß transcripts, as well as the
riboprobe for cyclophilin (used for normalization among samples)
satisfied the requirements described above, the assay was optimized
using WT mouse ovarian RNA as a target. The ovarian RNA used for
optimization was isolated from tissue pooled from several adult WT mice
(and therefore is not one of the the same preparations assayed and
shown in Fig. 3) and was chosen because it was known to possess
relatively high levels of both receptor transcripts. As shown in Fig. 2, the riboprobes for ER and ERß
were effective in detecting their respective transcripts when used
separately. Furthermore, when the two riboprobes were combined in the
same hybridization reaction, there was no compromise in the ability of
each to fully detect their respective transcripts. Also, because the
two resulting protected fragments differ in size by slightly over 100
nt, they are easily resolved by electrophoresis in a denaturing 6%
bis-acrylamide gel system.
|
|
|
and ERß mRNA in the female reproductive
tract and mammary gland
. The ER transcript was
present at significant levels in all four of the WT tissues analyzed,
with the uterus showing the greatest concentration. The WT ovary
possessed the highest level of ERß mRNA among the assayed tissues of
the female reproductive tract (Fig. 3). This is in agreement with
previous reports for the rat (6). Among sexually mature WT female mice,
the average ratio of ERß to ER mRNA was approximately 5:1 and
demonstrated a wide range of 0.3–12 (Table 1). This is most likely related to the
stages of folliculogenesis present at the time of collecting the
tissue. The animals used in this particular analysis were not assessed
for their specific stage in the ovarian cycle, and therefore this
information is not available. The levels of ERß mRNA in ovaries from
adult ERKO females appeared to be slightly lower than that in the WT
mice, and more importantly showed a much more narrow range compared
with WT mice (Table 2).
|
|
was the predominant transcript in the uterus and
oviduct, the ERß transcript was detectable in these tissues, at a
level at or below 5% of that in the ovary. This was also true for
tissues of the cervix and vagina of WT mice (data not shown). However,
mammary glands from adult females were negative for ERß expression.
The ERKO females showed no altered levels of ERß expression in these
tissues.
Although the ERKO mouse is homozygous for a targeted disruption of the
ER gene, tissues of the female reproductive tract as well as others
to be presented below appear to possess detectable levels of ER
mRNA. It is important to note that the antisense riboprobe used in this
study is specific for sequences located downstream from the site of the
disrupting neo construct (see Fig. 1). The presence of ER
mRNA in the ERKO has been well described (12) and is due to
transcriptional read through of the neo poly A signals,
resulting in continuation to the termination signals innate to the
ER gene. However, the coding sequences of the resulting ER
transcripts in the ERKO mouse are disrupted by the presence of multiple
premature stop codons within the disrupting construct, with the
exception of a single splicing variant detectable only by RT-PCR and
previously described (12). A similar phenomenom of transcriptional
read-through and aberrant splicing has been reported in the
transforming growth factor--targeted mice in which a comparable
targeting strategy was used (15). Despite the presence of these
transcripts, the ERKO mice have been documented to be resistant to the
actions of estradiol by several biochemical assays and have
demonstrated many of the phenotypes expected to result from complete
estrogen insensitivity (11, 12, 13, 16, 17).
Distribution of ER and ERß mRNAs in the male reproductive
tract
The distribution of the mRNAs encoding the two ER types in the
reproductive tract of WT and ERKO male mice is shown in Fig. 4. Once again, significant levels of
ER mRNA were detected in all the tissues analyzed. However, only the
prostate and epididymis possessed detectable levels of ERß mRNA,
whereas the testes were negative. As shown in Table 1, the ERß:ER
mRNA ratio in WT male mouse epididymis and prostate was approximately
1. However, in the ERKO males, the levels of ERß appeared to have
decreased in both the epididymis and prostate when compared with the WT
(Table 2). The intermediate band that appears in the ERKO epididymis
samples is due to DNA contamination of the RNA preparation and can be
removed with pretreatment of the RNA samples with DNase I (data not
shown).
|
and ERß mRNAs in the pituitary and neural
tissue) and male (Fig. 6) mouse expressed detectable levels of
ER mRNA, with the pituitary possessing the highest level in both
sexes. There were no detectable levels of ERß in the pituitary of
mice of either sex. However, the hypothalamus did possess significant
levels of ERß mRNA in both the female and male, appearing to be the
highest among the neural tissues assayed. As shown in Table 1, the
levels of ERß mRNA were consistent and approximately half that of
ER in the WT mice of both sexes. Detectable levels of ERß mRNA
also appeared in the cortex and olfactory bulb of each sex although at
very low levels. As shown in Table 2, no effect of disruption of the
ER gene on ERß levels was observed in the ERKO mice of either sex.
Once again, the intermediate band that appears in several of the
samples is due to DNA contamination of the RNA preparation and can be
removed with pretreatment of the RNA samples with DNase I (data not
shown).
|
|
mRNA is present in tissues of the
ERKO mouse. Interestingly, expression of the ER gene in the
hypothalamus, olfactory bulb, and cortex of the ERKO mouse does not
appear to be as attenuated when compared with levels in other ERKO
tissues. Although the ERKO ER mRNA is disrupted, these data indicate
that transcription of the ER gene in the tissues of the brain may be
dependent on mechanisms that are not affected by the disrupting
neo construct to the degree of those existing in the
reproductive tract tissues.
Distribution of ER and ERß mRNAs in nonreproductive organ
systems
Among the tissues of the nonreproductive organ systems that were
assayed, the lung possessed the highest levels of ERß mRNA in both
sexes (Fig. 7). Although transcripts for
each type of ER were present, ERß mRNA was clearly predominant in the
lung with an average ERß:ER ratio of 3.1 and 2.6 in WT females and
males, respectively. In an attempt to determine if the ERß gene may
be regulated in the female lung by ovarian factors, mice of both WT and
ERKO genotypes were ovariectomized for two weeks before tissue
collection; however, no significant effect was seen (Table 1). The
levels of ERß in the lungs of ERKO mice did not appear to vary from
that seen in the WT mice (Table 2).
|
mRNA was clearly
detectable in the heart and aorta of female (Fig. 8) and male mice (data not shown). The
heart of both sexes (male not shown) did possess slightly detectable
levels of ERß mRNA after extended exposure of the gels to x-ray film.
The aorta of both sexes (male not shown) was clearly negative for ERß
expression when assayed by RPA. No genotypic effect on the ERß levels
in these tissues was observed in ERKO mice of either sex.
|
mRNA but
only slightly detectable levels of ERß mRNA (data not shown). Other
tissues of both sexes that possessed undetectable levels of ERß mRNA
but were positive for ER when assayed by RPA were kidney, spleen,
skeletal muscle, and bone marrow (data not shown). Once again, no
genotypic effect on the ERß levels in these tissues was observed in
ERKO mice of either sex. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene in various tissues of the mouse. Transcripts encoding
ER were detected in all the tissues assayed of both sexes; however,
several tissues, such as the mammary gland, kidney, and aorta, were
negative for ERß expression when assayed by the RPA. In the WT mouse,
ERß was the predominant species of ER encoding transcript in the
ovary and lung. In the prostate and epididymis of the WT male, there
appeared to be equal levels of the two transcripts, whereas in the
hypothalamus of both sexes there was approximately twice the level of
ER mRNA. These data suggest that tissues such as the ovary,
prostate, lung, and hypothalamus may be interesting targets to explore
ERß protein expression once antibodies or ligands of sufficient
specificity and quality become available.
The initial descriptions of the ERKO female mouse reported the presence
of residual high affinity binding in the uterus (11, 12, 16). However,
a possible explanation for this binding was provided by the finding of
a splice variant of the disrupted ER mRNA that would result in a
mutant form of ER with an intact ligand binding domain (12). It has
been suggested that this residual estrogen binding in the uteri of ERKO
mice is due to ERß (6). However, although very low levels of ERß
mRNA are present in WT and ERKO uteri as shown in this report, the high
affinity binding factor in the ERKO uterus was previously shown to be
recognized by the ER antibody H222 (12), which has been reported to
have no cross-reactivity with in vitro translated ERß
protein (9). Therefore, the residual estrogen binding activity found in
the uteri of ERKO mice is most likely not due to the presence of
ERß.
Significant ERß expression is seen in the ovary of WT mice. This is
in accordance with recent reports that have localized the presence of
ERß transcripts in the rat ovary to the granulosa cells of small
preovulatory follicles (6, 18). Although the level of ER transcripts
in the WT ovary appeared relatively consistent, the level of ERß mRNA
showed a considerable range among sexually mature females (Table 1).
The level of ERß mRNA in the ovaries of adult ERKO mice appeared
slightly lower on average and less variable when compared with WT
(Table 2). However, the ovaries of adult ERKO females are acyclic and
do not possess follicles in the most mature stages of folliculogenesis,
resulting in altered proportions of the various cell types and stages
compared with the WT ovary. Therefore, the apparent decrease in ERß
mRNA levels in the ERKO ovary may be due to a loss of certain cell
types or stages or possibly to a direct regulatory effect on the ERß
gene.
It is interesting to note that the characteristic ovarian phenotype of
multiple large, atretic follicles that eventually become hemorrhagic
and cystic in the ERKO female mice (11, 16, 17) occurs in the presence
of significant levels of ERß expression. Because the ERKO ovary
possesses primary and secondary follicles, it is possible that ERß is
essential to the early stages of folliculogenesis, and that these
pathways have remained intact in the ERKO. However, the significant
levels of ERß mRNA in the ovary in combination with the pronounced
phenotype that results from disruption of the ER gene indicates a
significant role for each type of the ER in the ovary. These data
suggest a requirement for interaction between the two ER types for
proper cell and gene specific regulation during the later stages of
folliculogenesis.
In agreement with the results reported for the rat (6), the mouse
prostate expressed significant levels of ERß mRNA, whereas the testis
was negative. The levels of the two ER transcripts in the WT mouse
prostate and epididymis were high and relatively equal. In both of
these tissues, the ERKO male demonstrated a decrease in the level of
ERß expression (Table 2). It is possible that this is either a
reflection of specific ER mediated down regulation of the ERß
gene, a decrease in mitotic activity among the cells of these tissues,
or simply the loss of certain cell types in these tissues, and
therefore warrants further investigation. Interestingly, the initial
description of the human ERß gene reported the prostate to be
negative and the testis to be positive for ERß mRNA when assayed by
Northern blot techniques (8). This contrast with the present study
suggests possible species specific expression patterns of the ERß
gene.
The absence of ERß mRNA in the pituitary of both sexes, in contrast
to the high levels of ER mRNA, would suggest that ER is the sole
mediator of estrogen action in this tissue. This conclusion is
supported by the finding that ERKO mice exhibit no estrogen regulated
negative feedback on the expression of the gonadotropin genes in the
pituitary (19). However, the WT and ERKO hypothalamus of both sexes
possessed ERß mRNA levels that were at least half of that for ER.
A recent report by Shughrue et al. (10) localized ERß gene
expression to several distinct regions of the hypothalamus in the adult
female rat. Nonetheless, ERKO female mice appear to lack the effects of
estrogen feedback in the hypothalamus (unpublished results), suggesting
that ER is essential to the regulatory roles of the hypothalamus as
they relate to proper gonadal function. Furthermore, recent reports
have described abnormal sexual behavior in the ERKO female (20, 21),
including a lack of sexual receptivity, as well as in the ERKO male
(2). Therefore, although the expression level of ERß in the
hypothalamus of ERKO mice appears normal, their abnormal behavioral
phenotype indicates an important role for ER in reproductive
behavior.
The indications that estrogen may be a protective factor in the
development of cardiovascular disease has been founded upon the
observations that premenopausal women are at a much lower risk for this
disease (22, 23). Therefore, the possibility of a role for ERß in the
tissues of the cardiovascular system is of great interest. However, in
the mouse, whereas the heart of both sexes possessed just slightly
detectable levels of ERß, aorta from each sex demonstrated expression
of ER only when assayed by RPA. These data would suggest that the
actions of estrogens on the cardiovascular system are most likely
mediated in part by ER. This is supported by reports of abnormal
phenotypes in the cardiovascular tissues of ERKO mice, including
compromised nitric oxide synthesis in the aorta (24) and a lack of
estrogen-induced angiogenesis (25).
The biological significance of a second type of ER can be only
speculated upon at this time. Two known isoforms of the progesterone
receptor, PRA and PRB, are also known to exist
and have been well described to form both homodimers and heterodimers,
each complex having different gene regulatory effects (26, 27, 28, 29). The
ERß protein possesses a shortened N-terminus when compared with
ER, similar to the relationship of PRA to
PRB. It is interesting to note that no tissue analyzed in
this study possessed ERß as the sole species of ER transcript,
whereas ER mRNA was present at varying levels in all the tissues
assayed and the sole form in several. However, because the assays
herein were carried out on RNA extracted from whole tissue, possible
differences in the localization of the two ER mRNAs within distinct
cell types cannot be commented on from this analysis.
The lack of significant alterations in the expression levels or pattern
of the ERß gene in the ERKO mice would suggest that regulation of the
ERß gene may not be directly dependent on the actions of ER. These
data, in combination with the several described phenotypes present in
both sexes of the ERKO mouse, suggest that some of the biological
functions of the ERß protein may be dependent on the presence of
ER. Recent studies with in vitro translated protein have
shown that the formation of ER/ERß heterodimers preferentially
occurs over the formation of homodimers (30), suggesting that a loss of
functional ER may also result in decreased ERß activity. Also
possible is that the functions of the ERß are essential only during
development, thereby allowing for the unpredicted successful generation
of an ER-knockout. Lastly, the ERß may function to regulate the
expression of genes and hormonal responses that have yet to be studied
in the ERKO mouse. Because the ERß gene appears to be expressed in a
relatively normal pattern in the ERKO mouse, these animals should prove
to be a valuable in vivo model to study the biological
actions of this specific type of ER. Furthermore, the data presented
here demonstrating expression of the ERß gene in various tissues, and
how it compares to that of the ER gene, will be of significant
importance in discerning the full roles of each receptor in the
estrogen signaling system.
|
Acknowledgments |
|---|
Received May 16, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. Endocrinology 138:863–870 deficiency results in hair follicle and eye
abnormalities in targeted and waved-1 mice. Cell 73:263–278[CrossRef][Medline]
in the
anterior pituitary gland. Mol Endocrinol 11:674–681. Mol Endocrinol 11:1486–1496This article has been cited by other articles:
 |
|
 |
|
  Z. Hammoud, B. Tan, S. Badve, and R. M Bigsby Estrogen promotes tumor progression in a genetically defined mouse model of lung adenocarcinoma Endocr. Relat. Cancer, June 1, 2008; 15(2): 475 - 483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. M. Miller and S. P. Duckles Vascular Actions of Estrogens: Functional Implications Pharmacol. Rev., June 1, 2008; 60(2): 210 - 241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ikeda, K. Nakamura, K. Kogure, Y. Omori, S. Yamashita, K. Kubota, T. Mizutani, K. Miyamoto, and T. Minegishi Effect of Estrogen on the Expression of Luteinizing Hormone-Human Chorionic Gonadotropin Receptor Messenger Ribonucleic Acid in Cultured Rat Granulosa Cells Endocrinology, April 1, 2008; 149(4): 1524 - 1533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Khan, R. G Berger, and D. deCatanzaro The onset of puberty in female mice as reflected in urinary steroids and uterine/ovarian mass: interactions of exposure to males, phyto-oestrogen content of diet, and ano-genital distance Reproduction, January 1, 2008; 135(1): 99 - 106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cvoro, D. Tatomer, M.-K. Tee, T. Zogovic, H. A. Harris, and D. C. Leitman Selective Estrogen Receptor- Agonists Repress Transcription of Proinflammatory Genes J. Immunol., January 1, 2008; 180(1): 630 - 636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Sun, Z. Nawaz, and J. M. Slingerland Long-Range Activation of GREB1 by Estrogen Receptor via Three Distal Consensus Estrogen-Responsive Elements in Breast Cancer Cells Mol. Endocrinol., November 1, 2007; 21(11): 2651 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Shao, E. Egecioglu, B. Weijdegard, J. J. Kopchick, J. Fernandez-Rodriguez, N. Andersson, and H. Billig Dynamic regulation of estrogen receptor-{alpha} isoform expression in the mouse fallopian tube: mechanistic insight into estrogen-dependent production and secretion of insulin-like growth factors Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1430 - E1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Grisouard, S. Medunjanin, A. Hermani, A. Shukla, and D. Mayer Glycogen Synthase Kinase-3 Protects Estrogen Receptor {alpha} from Proteasomal Degradation and Is Required for Full Transcriptional Activity of the Receptor Mol. Endocrinol., October 1, 2007; 21(10): 2427 - 2439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wang, E. R. Prossnitz, and S. K. Roy Expression of G Protein-Coupled Receptor 30 in the Hamster Ovary: Differential Regulation by Gonadotropins and Steroid Hormones Endocrinology, October 1, 2007; 148(10): 4853 - 4864. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Carey, J. W. Card, J. W. Voltz, D. R. Germolec, K. S. Korach, and D. C. Zeldin The impact of sex and sex hormones on lung physiology and disease: lessons from animal studies Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L272 - L278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Shao, B. Weijdegard, J. Fernandez-Rodriguez, E. Egecioglu, C. Zhu, N. Andersson, A. Thurin-Kjellberg, C. Bergh, and H. Billig Ciliated epithelial-specific and regional-specific expression and regulation of the estrogen receptor-beta2 in the fallopian tubes of immature rats: a possible mechanism for estrogen-mediated transport process in vivo Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E147 - E158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Massaro, L. B. Clerch, and G. D. Massaro Estrogen receptor-{alpha} regulates pulmonary alveolar loss and regeneration in female mice: morphometric and gene expression studies Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L222 - L228. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Tiwari-Pandey, Y. Yang, J. Aravindakshan, and M.R. Sairam Normalization of hormonal imbalances, ovarian follicular dynamics and metabolic effects in follitrophin receptor knockout mice Mol. Hum. Reprod., May 1, 2007; 13(5): 287 - 297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.-E. Costin and V. J. Hearing Human skin pigmentation: melanocytes modulate skin color in response to stress FASEB J, April 1, 2007; 21(4): 976 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Genazzani, N. Pluchino, S. Luisi, and M. Luisi Estrogen, cognition and female ageing Hum. Reprod. Update, March 1, 2007; 13(2): 175 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Carey, J. W. Card, J. A. Bradbury, M. P. Moorman, N. Haykal-Coates, S. H. Gavett, J. P. Graves, V. R. Walker, G. P. Flake, J. W. Voltz, et al. Spontaneous Airway Hyperresponsiveness in Estrogen Receptor-{alpha}-deficient Mice Am. J. Respir. Crit. Care Med., January 15, 2007; 175(2): 126 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
