Endocrinology Vol. 138, No. 11 4649-4656
Copyright © 1997 by The Endocrine Society
An Estrogen Receptor Binding Site within the Human Galanin Gene1
Georgette Howard,
Lihong Peng and
James F. Hyde
College of Pharmacy (G.H., L.P.) and Department of Anatomy and
Neurobiology (J.F.H.), University of Kentucky Medical Center,
Lexington, Kentucky 40536
Address all correspondence and requests for reprints to: James F. Hyde, Department of Anatomy and Neurobiology, University of Kentucky College of Medicine, 800 Rose Street (MN224), Lexington, Kentucky 40536-0084.
 |
Abstract
|
|---|
Regulation of galanin gene expression in the anterior pituitary (AP) is
positively influenced by estrogen in rodents and undetermined in
humans. The objective of this study was to investigate the mechanism
behind estrogen induction of galanin by identifying any putative
estrogen receptor (ER) binding sequences within the human galanin
promoter that may function as estrogen response elements (ERE). Two
regions, gERE1 and gERE2, were identified in the galanin 5'-flanking
sequence with similarity to the full 13-base ERE consensus previously
defined in the vitellogenin gene (vERE). Both sequences were tested in
mobility shift assays for the ability to bind nuclear proteins isolated
from rat AP tissue or MtTW-10 pituitary tumors.
Only the distal sequence at -527 (gERE1) yielded an ERE-specific
DNA/protein complex distinguished by mobility and cross-competition
with vERE. The gel mobility pattern of the DNA/protein complex was
comparable between the pituitary tissue and tumor extracts. However,
DNA/protein affinity estimations demonstrated a greater affinity of
pituitary proteins for gERE1 over the vERE sequence. Evidence that the
human ER (hER) does recognize the gERE1 sequence in the human galanin
gene was provided by electrophoretic mobility shift assays (EMSAs) with
Sf9 extracts enriched in recombinant hER. In addition, antibodies
specific for the hER recognized the gERE1/protein complex in supershift
experiments.
Enhancer activity by gERE1 was detected in transient transfections of
the rat GH3 pituitary cell line, resulting in a 4-fold
induction of expression driven by the heterologous thymidine kinase
promoter in the presence of estrogen. Evidence for ER regulation of the
gERE1 enhancer was demonstrated by: 1) inhibition of enhancement using
the specific ER antagonist ICI 164,384; and 2) enhancement in HeLa
cells that was dependent upon coexpression with hER. Enhancement by
gERE1 was half the magnitude as that from the vERE element and may
reflect a difference in affinity or composition of the ER complex
between the two sequences.
These data demonstrate the presence of a functional ERE sequence within
the human galanin gene that could potentially function as a regulatory
element for estrogen action in the AP.
 |
Introduction
|
|---|
GALANIN is a neuroendocrine peptide
expressed throughout the central and peripheral nervous systems, as
well as endocrine tissues, such as the anterior pituitary (AP) (1, 2, 3).
In rodents, galanin is expressed as a prepropeptide in both lactotrophs
and somatotrophs of the AP, where it is a target for estrogen
regulation (4, 5, 6, 7). Estrogen treatment of ovariectomized female rats
elevates AP galanin message levels by 10-fold (6, 8, 9). Galanin
secretion from AP cells exposed to estrogen in vivo is
inhibited by dopamine and somatostatin and stimulated by TRH (10).
Furthermore, bromocriptine (a dopamine receptor agonist) and SMS
201995 (octreotide; a somatostatin receptor agonist) inhibit
estrogen-induced galanin gene expression and pituitary tumor formation
in vivo (8, 9). Estradiol increases galanin secretion and
the number of galanin-containing pituitary cells in vitro
(11); thus, estradiol can act, at least in part, directly at the level
of the pituitary, to regulate galanin gene expression. The
mammosomatotropic rat pituitary tumor, MtTW-10, also displays estrogen
regulation of galanin gene expression, elevating message levels 20-fold
in response to in vivo estrogen treatment, but seems
insensitive to inhibition by dopamine (12). Whether such
estrogen-dependent increases in galanin message are signaled directly
through regulation by the estrogen receptor (ER) or indirectly through
effects on other proteins has not been determined.
Direct estrogen action is mediated through the ER, a member of the
steroid receptor superfamily, which regulates transcription in target
tissues (13, 14). Transcriptional regulation by estrogen is mediated
through receptor dimers binding to the palindromic consensus element
[estrogen response element (ERE)] (15, 16). Although estrogen is not
necessary for high-affinity binding of ERs to the consensus sequence,
bound ligand and protein/protein interactions are necessary for
transcriptional activation (17, 18).
Cloning and sequencing the galanin promoter has permitted analysis of
transcriptional regulators of galanin gene expression (19, 20, 21).
However, a functional ERE, in either the rat or human galanin genes,
has not yet been localized (21, 22). The purpose of this study was to
identify any putative ERE sequences within 3 kb of the 5'-flanking
region of the human galanin gene that may mediate ER action using the
following criteria: 1) sequence similarity to the ERE consensus; 2)
recognition and binding by the human recombinant ER; and 3) ER-mediated
enhancer activity, as defined by transient expression analysis. We
report the presence of an ERE-like sequence in the 5'-flanking region
of the human galanin gene that can bind human ER (hER) and act as an
enhancer of a heterologous promoter in pituitary cells. Thus, this
sequence may potentially function to regulate galanin gene expression
in the AP, in response to estrogen.
 |
Materials and Methods
|
|---|
MtTW-10 pituitary tumors
Tumors (kindly provided by Dr. U. Kim, Roswell Park Cancer
Institute, Buffalo, NY) were transplanted sc in adult female
Wistar-Furth rats (150175 g) for 3 weeks before ovariectomy, as
previously described (12). AP tissue was obtained from female Fischer
344 rats (150175 g; Harlan Industries, Indianapolis, IN). Those
animals to be treated with estradiol also were implanted sc with a
17ß-estradiol-containing capsule. The capsules were made with
SILASTIC brand silicon tubing (id, 0.020 inch; od, 0.037 inch;
Dow-Corning Corp., Midland, MI) and measured 2 mm in length. One week
after surgery, the rats were euthanized and tumor tissue dispersed for
tissue culture or frozen for nuclear extract preparation. Rats were
housed under controlled temperature and lighting conditions, and food
and water were available ad libitum. All experimental
procedures were conducted in accordance with the policies of the
University of Kentucky Institutional Animal Care and Use Committee.
MtTW-10 pituitary tumor cell culture
Trypsin-dispersed MtTW-10 pituitary tumor cells were prepared
from one estradiol-treated rat for each experiment, as previously
described (12). Briefly, tumor cells (500,000 cells/well) were cultured
in 24-well plates (Costar, Cambridge, MA) in DMEM (GIBCO, Grand Island,
NY) containing 10% horse serum, 2.5% FBS, antibiotics, and 1
nM 17ß-estradiol. The tumor cells were treated with
either 50 nM trans-4-hydroxy-tamoxifen (TOT), 50
nM ICI 164,384, or vehicle (0.01% ethanol) for a total of
4 days. Fresh culture medium (containing the ER antagonists or vehicle)
was added after 2 days. Two days later, the culture medium was
collected and frozen at -20 C until assayed for galanin content by RIA
(10).
Northern hybridization
RNA from the cultured pituitary tumor cells was isolated using
guanidinium thiocyanate extraction and centrifugation over a cesium
chloride cushion. Northern blots were hybridized initially with an
oligodeoxynucleotide complementary to rat galanin messenger RNA (mRNA)
(+241 to +288) (8). After 24 h exposure to x-ray film, the blots
were stripped and subsequently hybridized to the human 28S ribosomal
RNA (rRNA), as previously described (23). Oligodeoxynucleotide probes
were end-labeled using [32P]-ATP and T4 polynucleotide
kinase. Relative densities (gray levels) of the autoradiograms were
determined using NIH Image Software. Galanin message levels in each
lane were normalized against the densitometric signal from the 28S rRNA
rehybridization.
EMSA
Oligodeoxynucleotides vERE (5' GATCCCTGGTCAGCTTGACCGGAG 3'),
gERE1 (5' GATCCGGGTACCCCATGACCTCCG 3'), and gERE2 (5'
GATCGGGGGTCAGGCTTGCTCTGG 3') and their complements were synthesized by
the Oligodeoxynucleotide Core Facility at the University of Kentucky
and annealed to form double-stranded 24-bp elements. Double-stranded
glucocorticoid response element (GRE) oligodeoxynucleotides were
purchased from Promega (Madison, WI). Oligodeoxynucleotides were
radiolabeled with [32P]-ATP with T4 polynucleotide kinase
and separated from unincorporated radionucleotides by passage over
Sephadex G-50. AP tissue or MtTW-10 pituitary tumor tissue was
dissected, frozen in liquid nitrogen, and nuclear extracts isolated
using the 1-h minipreparation technique (24). Total protein was
quantitated by Bradford assay and normalized against extraction buffer.
Gel shift assays were carried out in 20 µl of 4-mM HEPES
(pH 7.9), 50 mM KCl, 1.5 mM MgCl2,
1 mM dithiothreitol, 1 mM EGTA, 10% glycerol,
2 µg poly dI:dC, 2 µg nuclear proteins, and 0.10.5 ng
radiolabeled probe (ca. 50,000 cpm/rxn) for 20 min at 22 C. For
supershift assays, DNA probes were incubated under the same conditions
for EMSA simultaneously with 50 nM recombinant hER in Sf9
cell extracts and 800 ng Antibody 6, specific to recombinant hER (25).
AP nuclear extracts also were incubated with C311 or MC20 (Santa Cruz
Biotech., Santa Cruz, CA), H222 (generously provided by Geoffrey L.
Greene, The Ben May Institute, Chicago, IL) (35), or antibody 6 (25).
After incubation, DNA/protein complexes were separated by
electrophoresis on a nondenaturing 6% polyacrylamide (30:1) gel by
electrophoresis in 45 mM Tris (pH 8.0), 45 mM
borate, and 1 mM EDTA and visualized by
autoradiography.
Plasmid construction
Synthetic oligodeoxynucleotides for gERE1 (-530 to -506 of the
human galanin gene) (21) were annealed and cloned into compatible
EcoRI and BamHI sites of pBluescript II KS(+)
vector (Stratagene Cloning Systems, La Jolla, CA). The 1.8-kb
XbaI/SstI fragment from pBLCAT2 (26), containing
166 bases of the Herpes Simplex thymidine kinase (TK) promoter and the
chloramphenicol acetyltransferase (CAT) reporter gene, was
directionally cloned downstream from a single copy of the gERE1 insert
to generate the gERE1/TKCAT plasmid. Double-stranded vERE
oligodeoxynucleotides (27) were cloned into the SmaI site of
pBLCAT2. Both hybrid constructs were verified by dideoxynucleotide
sequencing through junction segments.
Cell transfection and CAT assay
GH3 rat pituitary cells or HeLa cells (CCL 82.1, CCL
2; ATCC, Rockville, MD) were cultured in DMEM/Hams F-12 containing
2.5% FBS, 10% horse serum, 100 U/ml penicillin, 0.1 mg/ml
streptomycin, and 25 U/ml nystatin. For low estrogen conditions, cells
were grown in phenol red-free DMEM/Hams F-12 and 10% gelded horse
serum. One day before transfection, GH3 cells (5 x
105 cells) were plated on poly-L-lysine-coated
petri dishes (35 mm). Plasmids were prepared by FPLC (Pharmacia,
Piscataway, NJ). The cells were washed twice with Opti-MEM 1 (phenol
red-free, GIBCO BRL) and then 2 µg of hybrid CAT expression vector
and cytomegalovirus ß-galactosidase internal control plasmids were
cotransfected using Lipofectin reagent (GIBCO BRL), diluted in Opti-MEM
1. HeLa cells (2.5 x 105 cells) were transfected as
above, with or without 50 ng of a hER expression vector, HEGO
[generously provided by Pierre Chambon, Strasbourg, France (28)].
Transfections were optimized according to the manufacturers
directions. Forty-eight hours after transfection, cell extracts were
prepared and assayed for CAT (29) and ß-galactosidase activities
(30). After normalizing against ß-galactosidase activity, CAT
activities are expressed as percent induction over pBLCAT2 values.
 |
Results
|
|---|
Galanin is regulated through the ER in rat MtTW pituitary tumor
cells
To determine whether estrogen regulation of galanin gene
expression is mediated through the ER, as opposed to acting through
other in vivo hormones or receptors, MtTW cells were exposed
in vitro in the presence of the ER antagonists, TOT (31, 32)
or ICI 164,384 (33, 34). Galanin peptide secretion into culture medium
was specifically lowered 2- and 6-fold by the antagonist treatment,
respectively (Fig. 1
). Furthermore,
quantitation of galanin steady-state message (
900 bp), by Northern
analysis, shows a similar decrease of 2- and 10-fold with respective
antagonist treatments (Fig. 2
). These
data demonstrate that the ER is necessary to maintain elevated levels
of galanin in pituitary cells and that ER does mediate the regulation
of galanin gene expression by estrogen.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1. Estrogen receptor antagonists decrease galanin
peptide secretion from MtTW-10 pituitary tumor cells. MtTW-10 pituitary
tumor cells (500,000 cells/well) were cultured for 4 days, as described
in Materials and Methods. Cells were treated with either
trans-4-hydroxy-tamoxifen (TOT; 50 nM), ICI
164,383 (ICI; 50 nM), or vehicle (control). Galanin peptide
levels in the culture medium were determined by RIA (11). Data are
expressed as ng galanin/well. Each value represents a mean ±
SE of three experiments. *, P < 0.05,
as compared with vehicle control.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
Figure 2. Estrogen receptor antagonists decrease
steady-state galanin mRNA levels in MtTW-10 pituitary tumor cells. A,
Representative Northern blot analysis. RNA was extracted from 4 x
106 MtTW-10 cells treated with either ethanol (vehicle
control, lane 1), trans-4-hydroxy-tamoxifen (TOT, 50
nM; lane 2), or ICI 164,384 (ICI, 50 nM; lane
3). Ten micrograms of total RNA was fractionated by denaturing agarose
gel electrophoresis, transferred and hybridized to
32P-labeled antisense oligodeoxynucleotide probes
complementary to rat galanin transcripts (upper panel).
The blot was subsequently stripped and hybridized to human 28S rRNA
(lower panel). B, Estimation of galanin mRNA
concentrations. Values are expressed as a percentage of control after
normalization with 28S rRNA, to give relative galanin mRNA
concentrations, and represent the mean ± SE of three
experiments. *, P < 0.05, as compared with vehicle
control.
|
|
ERE-like sequences within the human galanin gene
Flanking sequences, 5' to the human galanin gene (21), were
consequently analyzed to locate potential ER binding sites. Regions
with the highest degree of similarity to the 13-base palindromic ERE
consensus element, as defined in the chicken and Xenopus
vitellogenin genes (27), were located within 3 kb of 5'-flanking using
the Intelligenetics Suite Alignseq program. Table 1
displays two galanin sequences at -527
(gERE1) and -365 (gERE2) with 77% similarity to the full ERE
palindromic consensus. Interestingly, the gERE1 sequence seems to be
composed of one perfect half-site of the ERE and one perfect half-site
of the glucocorticoid response element (35), separated by four
nucleotides. No regions of ERE similarity were found within the first
intron of the galanin gene.
gERE1 sequences are recognized by AP nuclear proteins
To test for the ability to bind nuclear protein, gERE1 and gERE2
sequences (24 bp) were incubated with crude nuclear extracts isolated
from either AP or MtTW tumor tissue and analyzed in EMSAs. The gERE1
sequence is specifically recognized by nuclear proteins from both AP
and MtTW tumor extracts and yields a bound complex of similar mobility
to that for the vERE consensus (Fig. 3a
).
However, the gERE2 sequence binds only a faster mobility protein
complex, as compared with vERE (Fig. 3b
), which is not specifically
competed by an excess of unlabeled vERE competitor. Hence, the gERE2
does not demonstrate ERE-specific protein binding and is eliminated as
a potential high-affinity binding site for the ER in the AP.

View larger version (84K):
[in this window]
[in a new window]
|
Figure 3. Putative ERE consensus sequence from the galanin
promoter, gERE1, binds nuclear protein. EMSA was used to analyze
nuclear protein binding to the radiolabeled double-stranded
oligodeoxynucleotides described in Table 1 . A, Radiolabeled vERE,
incubated in the absence (lane 1) or presence (lane 2) of 2 µg
nuclear extract isolated from rat anterior pituitary tissue (AP).
Radiolabeled gERE1 sequences from the galanin promoter (lanes 36),
incubated in the absence (lane 3) or presence of 2 µg nuclear extract
isolated from MtTW-10 tumors propagated in rats after ovariectomy (lane
4), estradiol replacement (lane 5), or AP tissue (lane 6). B,
Radiolabeled gERE2 sequences incubated in the absence (lane 1) or
presence of 2 µg nuclear extract isolated from MtTW-10 tumors
propagated in rats after ovariectomy (lane 2), estradiol replacement
(lanes 3 and 5), or AP tissue (lane 4). Unlabeled competitor DNA (lane
6, gERE2; lane 7, gERE1; lane 8, vERE; lane 9, GRE) was present at
500-fold molar excess of the radiolabeled probe. O, lane origin; B,
bound DNA/protein complex.
|
|
gERE1 and vERE sequences bind the same protein
Because both ERE and GRE half-sites are present within the gERE1
element, cross-competition with several full-length consensus sequences
(vERE and GRE) were used to identify the sequences recognized by the
pituitary nuclear complex (Fig. 4
).

View larger version (52K):
[in this window]
[in a new window]
|
Figure 4. Cross-competition of nuclear protein bound to
gERE1 detects ERE-specific binding activity in both rat AP and MtTW-10
tumor extracts. A, EMSA was carried out with rat AP nuclear extracts,
as described in Materials and Methods. Probes: gERE1,
lanes 16; vERE, lanes 712. Unlabeled competitor DNA indicated
above each lane was present at 500-fold molar excess of
the radiolabeled probe. Lanes 1 and 7 represent probe incubated in the
absence of nuclear extract. B, Bound DNA/protein complex; Free, unbound
radiolabeled probe. B, EMSA was carried out with nuclear extracts
isolated from MtTW-10 tumors propagated in rats after ovariectomy
(even lanes) or estradiol-replacement (odd
lanes). Protein binding and competitions were carried out for
the gERE1 probe, as described for A. Lane 1 represents gERE1 probe in
the absence of nuclear extract.
|
|
Addition of 500-fold molar-excess unlabeled self competitor, in
the binding reaction, resulted in complete competition for both the
gERE1 and vERE probes (Fig. 4a
, lanes 3 and 9). Cross-competition with
unlabeled vERE sequence resulted in partial competition for protein
binding to the gERE1 probe (Fig. 4a
, lane 4). However, an excess of
unlabeled gERE1 sequence completely competed protein binding to the
vERE probe (Fig. 4a
, lane 10). Not surprisingly, the gERE2 sequence did
not compete for the binding to either gERE1 or vERE probes (Fig. 4a
, lanes 5 and 11). Despite the sequence similarity between gERE1 and GRE,
no competition for binding was observed with an excess of GRE
oligodeoxynucleotide (Fig. 4a
, lanes 6 and 12). In addition, the
mobility pattern of protein binding to the gERE1 did not resemble that
observed for a GRE probe (data not shown). The cross-competitions
suggest that the gERE1 sequence does not primarily function as a
glucocorticoid receptor binding site and are consistent with the
presence of the ER in the AP complex.
Figure 4b
repeats the same cross-competition profile as in Fig. 4a
, with nuclear proteins isolated from MtTW tumor tissue. Growth of the
tumor in the presence or absence of estrogen did not influence the
protein binding to gERE1 in a manner similar to that seen with AP
tissue (36). Observations of partial competition by the vERE competitor
and lack of competition by the GRE competitor were duplicated with the
MtTW extracts (Fig. 4b
, lanes 69), further substantiating the
similarities between AP and MtTW tumor tissues.
Affinity of AP nuclear proteins is greater for gERE1 than vERE
sequences
To compare affinities of the two sequences for the AP protein
complex, nuclear protein binding to the gERE1 probe was titrated with
varying amounts of unlabeled gERE1 or vERE oligodeoxynucleotides (Fig. 5
). Approximately a 10-fold greater
amount of the vERE element was required to yield the same degree of
competition by the gERE1 element, thus, demonstrating a greater
affinity of AP proteins for the gERE1 sequence over the vERE sequence.
The ability of gERE1 to completely compete for protein bound to the
vERE probe in Fig. 4
suggests that the gERE1 sequence can bind ER.
However, the partial competition by vERE suggests that different
components of the ER complex seem to be uniquely bound to the gERE1
sequence for which the vERE cannot abolish binding (Fig. 4a
, lane 4;
Fig. 4b
, lanes 6 and 7; Fig. 5
, lane 9).

View larger version (77K):
[in this window]
[in a new window]
|
Figure 5. Affinity of AP nuclear proteins is greater for
gERE1 than for vERE sequences. EMSA was carried out as described for
Fig. 3 . Increasing amounts (50-, 200-, and 500-fold molar excess) of
unlabeled gERE1 (lanes 35) or vERE (lanes 79) were used as
competitor DNA to compare the affinity of the protein complex for the
ERE-like gERE1 sequence. Lane 1 represents gERE1 probe incubated in the
absence of nuclear extract.
|
|
hER can bind gERE1 sequences
Sf9 insect cell extracts, enriched in recombinant hER and specific
antibodies toward the recombinant hER [generously provided by A.
C. Notides, University of Rochester, Rochester, NY (25)], were used
for supershift assays to directly test for hER recognition of the human
gERE1 sequence. Incubation of gERE1, gERE2, and vERE sequences with the
crude Sf9 insect cell extracts (hER) were carried out in the absence or
presence of polyclonal antibody 6, as previously described (25). The
presence of hER bound to DNA was indicated by antibody recognition of
the DNA/protein complex, yielding a supershifted complex in EMSAs (Fig. 6
). Figure 6b
demonstrates strong binding
of the hER to the vERE sequence (lane 2), which is supershifted by the
anti-hER antibody 6 (lane 3). As shown in Fig. 6a
, the gERE1 sequence
is also bound by proteins recognized by antibody 6 (lanes 2 and 3). The
bound complex is of similar mobility to that seen with the vERE probe
in Fig. 6b
. Lastly, the gERE2 sequence did not yield a supershifted hER
complex when incubated with Sf9 extracts and antibody 6 (data not
shown), consistent with the previous EMSA data with pituitary extracts.
Competitions similar to those demonstrated in Fig. 4
were repeated with
the supershifted complex. Self-competition with excess unlabeled probe
was able to diminish the supershifted complex for both gERE1 and vERE
sequences (Fig. 6
, a and b; lane 4). Cross-competition by vERE
completely competes for the gERE1 supershifted complex (Fig. 6a
, lane
5). Although binding of the hER seems to favor the vERE more than the
gERE1 sequence, antibody 6 recognition of the protein/gERE1 complex and
partial competition of the vERE supershifted complex by gERE1 provides
evidence that the hER, indeed, can recognize the gERE1 sequence.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 6. Recombinant human estrogen receptor (hER)
recognizes the gERE1 sequence. EMSA was performed with Sf9 cell
extracts enriched in recombinant hER. Antibody 6, specific for the hER,
results in a supershifted complex (SS) for both gERE1 and vERE probes
in seven independent supershift assays. A, gERE1 probe; B, vERE probe.
Probe in the absence of hER or antibody 6 (lane 1); presence of hER
only (lane 2); hER and antibody 6 (lane 3); hER, antibody 6, and
500-fold molar excess of unlabeled self competitor DNA (lane 4) or
cross-competitor DNA (lane 5a, vERE; lane 5b, gERE1); uninfected Sf9
extracts alone (lane 6) or with antibody 6 (lane 7). O, lane origin;
SS, Ab/protein/DNA supershifted complex; B, bound protein/DNA
complex.
|
|
Enhancer activity by gERE1
To determine whether the gERE1 sequence could regulate expression
in an estrogen-inducible fashion, transient transfection was employed
to test for enhancer function. A single copy of the gERE1 sequence was
cloned within the pBLCAT2 expression vector directly upstream of the
heterologous TK promoter, designated gERE1/TKCAT (26). A single copy of
the defined vERE enhancer cloned into pBLCAT2 (vERE/TKCAT) was used as
a positive control for estrogen induction in transfection assays.
Cotransfection with cytomegalovirus/ß-galactosidase plasmid was used
to correct for variations in transfection efficiency between
assays.
GH3 pituitary cells, grown under low estrogen conditions
(see Materials and Methods), were transfected with each of
the hybrid vectors in the absence or presence of 10 nM 17
ß-estradiol (Fig. 7a
). The gERE1/TKCAT
hybrid construct resulted in an approximately 4-fold induction of CAT
expression in the presence of estrogen over the basal level of
gERE1/TKCAT without estrogen. Transfection of the vERE/TKCAT hybrid
vector yielded a 9-fold induction, whereas pBLCAT2 gave no estrogen
induction over basal expression levels. Enhancement from gERE1/TKCAT
was approximately half the magnitude as that measured for the
vERE/TKCAT positive control. To test whether the observed enhancement
from gERE1/TKCAT was dependent upon ER, the pure estrogen antagonist
ICI 164,384 (33) was used to block ER activity (Fig. 7b
). Treatment
with 50 nM of the antagonist ICI led to a significant
3-fold inhibition of enhanced expression from both the gERE1 and vERE
hybrid vectors, indicating involvement of the ER in enhancer activity
from the gERE1 element.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 7. Estrogen receptor antagonist ICI inhibits enhancer
activity from gERE1. GH3 cells were transfected with either
pBLCAT2, gERE1/TKCAT, or vERE/TKCAT hybrid expression vectors and
cotransfected with CMV/ß-galactosidase, as described in
Materials and Methods. A, Transfection in cells grown in
low-estrogen conditions (-E2) or in 10 nM 17ß-estradiol
(+E2); B, treatment with either 17ß-estradiol (+E2) or
17ß-estradiol plus ICI 164,384 (+E2/ICI) was initiated 7 h after
transfection. Transient expression was determined 42 h post
transfection, and CAT activity was corrected against the level of
ß-galactosidase measured per plate. Each value represents a mean
± SE of five to eight independent experiments. *,
P < 0.05, as compared with control values for each
construct; **, P < 0.05, as compared with +E2
values for the gERE1 construct.
|
|
To further test the dependence of gERE1/TKCAT enhancement on the ER,
cotransfections of HeLa cells that lack ERs were performed using the
gERE1/TKCAT and the ER expression vector, HEGO (28). In the presence of
10 nM 17 ß-estradiol, coexpression of gERE1/TKCAT and hER
displayed enhanced CAT expression, as compared with transfection of
gERE1/TKCAT without HEGO (Fig. 8
). The
positive control vector, vERE/TKCAT, also demonstrated a 9-fold
enhancement of expression after cotransfection with the HEGO expression
vector. Taken together, the findings from the various functional
studies demonstrate estrogen-responsiveness for the gERE1 sequence and
are consistent with our binding data that suggest that enhancement from
the gERE1 sequence, in part, is caused by ER interaction.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 8. Estrogen receptor dependence of enhancer activity
from gERE1. HeLa cells were cotransfected with either pBLCAT2,
gERE1/TKCAT, or vERE/TKCAT hybrid expression vectors with (+hER) or
without (-hER) the HEGO expression vector expressing human estrogen
receptor. Transfections were corrected against ß-galactosidase
activity and expressed as fold induction, as described for Fig. 7 . *,
P < 0.05, as compared with control values for each
construct; **, P < 0.05, as compared with +hER
values for the gERE1 construct.
|
|
 |
Discussion
|
|---|
In the present study, we identify a functional ERE at -527
upstream of the human galanin gene based on: 1) 77% sequence
similarity to the full palindromic ERE consensus; 2) the ability to
bind recombinant hER; 3) the ability to compete for pituitary nuclear
protein binding to the defined vERE element; and 4) the ability of the
isolated sequence to enhance expression in pituitary cells from the
heterologous TK promoter in an estrogen-dependent manner.
The conclusion of our study is in contrast to that recently reported by
Kofler et al. (21), who did not detect a functional ERE
within the 5'-flanking region of the human galanin gene. However, the
two studies differ in several aspects. Kofler et al.
identified three ERE-like sequences in the human galanin 5'-flanking
region located at -1162, -361, and -122, based on similarity to the
5' GGTCA 3' half-site sequence on the sense strand. Our study, however,
analyzed galanin gene sequences for similarity to the full-length
bipartite palindromic sequence (Table 1
), which identified two
sequences located at -527 and -365. Consequently, the gERE2 sequence
at -365 corresponds to one of the ERE-like sequences identified by
Kofler et al., which we report here to be nonfunctional in
EMSA. Analyzing sequences on the sense strand, the gERE1 at -527 does
not contain a perfect match to the sequence used by Kofler et
al. (21). However, it does contain a perfect match to the more
proximal ERE half-site, 5' TGACC 3', which previously has been shown to
be necessary for binding of the ER in vitro (17). Comparison
between gERE1 and the 5'-flanking sequences of galanin genes from other
species may reveal similar sequences.
It is generally thought that ER can regulate gene transcription by
binding to a perfect ERE palindromic sequence, 5' GGTCANNNTGACC 3', as
a homodimer (15). However, ER can also bind with lower affinity to
imperfect ERE sequences by forming heterodimers with nonhormone
proteins or through other protein-protein interactions (17, 18, 37, 38, 39). Through such protein interactions, imperfect EREs can render
tissue-specificity to hormonal regulation that is not observed with
perfect palindromic sequences (38, 39). Chambon and co-workers (37)
have documented that several half-palindromic ERE sequences can act
synergistically to achieve optimal and cell-specific estrogen
induction. Such may be the case with the gERE1 element.
When compared with binding of ER homodimers to a complete palindromic
sequence, palindromic half-sites only bind ER monomers weakly in
vitro (16, 17, 37). Our EMSA and competition assays suggest an
affinity difference between bound proteins from AP extracts and the Sf9
extracts enriched in hER. This difference could be indicative of a
species difference between the affinity of rat (AP) and human (Sf9) ER
for the human gERE1 sequence. Alternatively, this difference may
reflect the presence of tissue-specific accessory proteins, present
only in pituitary tissue, which may enhance the affinity of the
receptor for the imperfect palindrome (39). Lastly, a recent report by
Friend et al. (40) describes the existence of two
estrogen-inducible forms of the ER, TERP-1 and TERP-2, present in
pituitary tissue. TERP-1 displays both a pituitary-specific and
female-specific pattern of expression. However, the physiological
significance of these ER isoforms in mediating estrogen response is not
yet known. Using a panel of antibodies against the ER in supershift
assays (see Materials and Methods), we have been unable to
achieve antibody recognition of the pituitary complex bound to the vERE
element (G. Howard, L. Peng, and J. F. Hyde, unpublished
observation). This may be indicative of a pituitary-specific form of
the ER present in the vERE-bound complex or blockade of antibody
recognition by tissue-specific accessory proteins. Whether our EMSA
data, demonstrating strong binding by pituitary nuclear proteins to the
gERE1 sequence, represents binding of the specific TERP-1 isoform
remains to be determined.
The conclusions of Kofler et al. (21) are based primarily
upon transient transfections performed in neuroblastoma/glioma cells
and not pituitary cells. However, estrogen-dependent regulation from an
imperfect palindrome may not be seen in all cell types (37). In
neuroblastoma cells, expression from 1.9 kb of the human galanin
promoter increased 30-fold in the presence of 17ß-estradiol but only
at nonphysiological levels of cotransfected ER (21). Using
GH3 pituitary cells, we were able to detect
estrogen-dependent induction of expression from various reporter
constructs (Fig. 7
). In addition, cotransfection of the gERE1 hybrid
construct with a hER expression vector resulted in enhanced CAT
expression in HeLa cells (Fig. 8
). Considering both the detected
enhancer function and ER binding data, the gERE1 sequence could be
responsible, in part, for the 10-fold estrogen induction observed in
Fig. 2
. Based on our results, the estrogen-dependent increase of the
1.9 kb of promoter reported by Kofler et al. may indeed
occur at physiological levels of ER when tested in pituitary cells.
The magnitude of endogenous galanin gene expression in MtTW cells (Fig. 2
) is in agreement with the preliminary data from pituitary tissue
reported by Kaplan et al. (22) for the rat promoter.
However, whereas estrogen induces endogenous galanin gene expression
10-fold in pituitary tissue, a single copy of the gERE1 sequence was
able to enhance expression of the heterologous TK promoter only 4-fold.
The cellular and promoter context of the bound receptor influences the
magnitude of transcriptional regulation of the promoter (37). Such
quantitative differences between gERE1/TKCAT and the endogenous galanin
gene may reflect the absence of additional enhancers that impact the
magnitude of the estrogen induction. In addition, pituitary-specific
enhancer elements also may be required for optimal induction from
estrogen. Whether the other three ERE-like sequences reported by Kofler
et al. (21) or the full promoter context influences the
magnitude of induction from the gERE1 palindromic half-site at -527
remains to be determined.
The physiological roles of galanin in the pituitary are still to be
elucidated. The correlation of increased galanin gene expression with
estrogen-induced pituitary tumors, and decreased galanin gene
expression when tumor formation is inhibited (8, 9), has led to the
hypothesis that galanin may mediate the hyperplastic events associated
with estrogen-induced pituitary tumor formation (9). Indeed, galanin
increases the proliferation of human small-cell lung carcinoma cells
and 2351 pituitary cells in vitro (41, 42). Moreover, we
recently reported that estrogen-treated lactotrophs that contain
galanin mRNA secrete significantly greater amounts of PRL than those
lactotrophs not containing galanin message (43), suggesting a possible
autocrine regulation of PRL secretion by galanin in
estrogen-stimulated, hyperplastic pituitary cells. The role of galanin
in the human pituitary gland awaits further study.
In conclusion, identification of a functional ERE element within the
gERE1 sequence supports the possible mechanism of direct regulation of
galanin transcription by the ER in AP tissue. Whether the
tissue-specific estrogen induction of galanin gene expression occurs
through the binding of pituitary-specific forms of the ER to gERE1 or
whether it involves interactions with additional tissue-specific
proteins warrants further investigations.
 |
Acknowledgments
|
|---|
The authors greatly appreciate the generous gifts from Dr. U.
Kim for the MtTW-10 pituitary tumor, Dr. A. C. Notides (University
of Rochester) for the Sf9 cell extracts containing hER and antibody 6,
Dr. D. Noonan (University of Kentucky) for the vERE/TKCAT reporter
plasmid, and ICI Pharmaceuticals for the ICI 164,384. The authors would
like to thank K. Drake, D. G. Morrison, and J. P. Moore, Jr.
for expert technical assistance, M. G. Engle for photography, and
Drs. E. J. Pavlik, N. J. Koszewski, and D. J. Noonan for
helpful discussions.
 |
Footnotes
|
|---|
1 This work was supported by the National Institute for Diabetes and
Digestive and Kidney Diseases, USPHS Grant DK-45981 (to J.F.H.), and
University of Kentucky Medical Center Research Fund (to G.H.). 
Received May 5, 1997.
 |
References
|
|---|
-
Michener SR, Aimone LD, Yaksh TL, Go VLW 1990 Distribution of galanin-like immunoreactivity in the pig, rat and human
central nervous system. Peptides 11:12171223[CrossRef][Medline]
-
Vrontakis ME, Torsello A, Friesen HG 1991 Galanin.
J Endocrinol Invest 14:785794[Medline]
-
Kaplan LM, Spindel ER, Isselbacher KJ, Chin WW 1988 Tissue-specific expression of the rat galanin gene. Proc Natl Acad
Sci USA 85:10651069[Abstract/Free Full Text]
-
Kaplan LM, Gabriel SM, Koenig JI, Sunday ME, Spindel
ER, Martin JB, Chin WW 1988 Galanin is an estrogen-inducible,
secretory product of the rat anterior pituitary. Proc Natl Acad Sci USA 85:74087412[Abstract/Free Full Text]
-
Vrontakis ME, Yamamoto T, Schroedter IC, Nagy JI,
Friesen HG 1989 Estrogen induction of galanin synthesis in the rat
anterior pituitary gland demonstrated by in situ
hybridization and immunohistochemistry. Neurosci Lett 100:5964[CrossRef][Medline]
-
OHalloran DJ, Jones PM, Steel JH, Gon G, Ghatel MA,
Polak JM, Bloom SR 1990 Effect of endocrine manipulation on
anterior pituitary galanin in rat. Endocrinology 127:467475[Abstract/Free Full Text]
-
Hyde JF, Engle MG, Maley BE 1991 Colocalization of
galanin and prolactin within secretory granules of anterior pituitary
cells in estrogen-treated Fischer 344 rats. Endocrinology 129:270276[Abstract/Free Full Text]
-
Hyde JF, Keller BK, Howard G 1992 Dopaminergic
regulation of galanin gene expression in the rat anterior pituitary
gland. J Neuroendocrinol 4:449454[CrossRef]
-
Hyde JF, Howard G 1992 Regulation of galanin gene
expression in the rat anterior pituitary gland by the somatostatin
analog SMS 201995. Endocrinology 131:20972102[Abstract/Free Full Text]
-
Hyde JF, Keller BK 1991 Galanin secretion from
anterior pituitary cells in vitro is regulated by dopamine,
somatostatin and thyrotropin-releasing hormone. Endocrinology 128:917922[Abstract/Free Full Text]
-
Hemmer A, Hyde JF 1992 Regulation of galanin
secretion from pituitary cells in vitro by estradiol and
GHRH. Peptides 13:12011206[CrossRef][Medline]
-
Hyde JF, Morrison DG, Moore Jr JP, Howard G 1993 MtTW-10 pituitary tumor cells: galanin gene expression and peptide
secretion. Endocrinology 133:25882593[Abstract/Free Full Text]
-
Beato M 1989 Gene regulation by steroid hormones.
Cell 56:335344[CrossRef][Medline]
-
Evans R 1988 The steroid and thyroid hormone
receptor superfamily. Science 240:889895[Abstract/Free Full Text]
-
Kumar V, Chambon P 1988 The estrogen receptor binds
tightly to its responsive element as a ligand-induced homodimer. Cell 55:145156[CrossRef][Medline]
-
Schwabe JWR, Chapman L, Finch JT, Rhodes D 1993 The
crystal structure of the estrogen receptor DNA-binding domain bound to
DNA: how receptors discriminate between their response elements. Cell 75:567578[CrossRef][Medline]
-
Kato S, Tora L, Yamauchi J, Masushige S, Bellard M,
Chambon P 1992 A far upstream estrogen response element of the
ovalbumin gene contains several half-palindromic 5'-TGACC-3' motifs
acting synergistically. Cell 68:731742[CrossRef][Medline]
-
Furlow JD, Murdoch FE, Gorski J 1993 High affinity
binding of the estrogen receptor to a DNA response element does not
require homodimer formation or estrogen. J Biol Chem 268:1251912525[Abstract/Free Full Text]
-
Rokaeus A, Waschek JA 1994 Primary sequence and
functional analysis of the bovine galanin gene promoter in human
neuroblastoma cells. DNA Cell Biol 13:845855[Medline]
-
Evans H, Baumgartner M, Shine J, Herzog H 1993 Genomic organization and localization of the gene encoding human
preprogalanin. Genomics 18:473477[CrossRef][Medline]
-
Kofler B, Evans HF, Liu ML, Falls V, Kismaa TP, Shine J,
Herzog H 1995 Characterization of the 5' flanking region of the
human preprogalanin gene. DNA Cell Biol 14:321329[Medline]
-
Kaplan LM, Abraczinska D, Davidson M, Chin WW 1989 Estrogen regulation of rat galanin transcription is mediated by
sequences in the 5' flanking region of the galanin gene. Soc Neurosci 15:261.9 (Abstract)
-
Hyde JF, Bartke A, Davis BM 1993 Galanin gene
expression in the hypothalamopituitary axis of the Ames dwarf mouse.
Mol Cell Neurosci 4:298303[CrossRef]
-
Deryckere F, Gannon F 1994 A one-hour
minipreparation technique for extraction of DNA-binding proteins from
animal tissues. Biotechniques 16:405[Medline]
-
Obourn JD, Koszewski NJ, Notides AC 1993 Hormone-
and DNA-binding mechanisms of the recombinant human estrogen receptor.
Biochemistry 32:62296236[CrossRef][Medline]
-
Luckow B, Schuetz G 1987 CAT constructions with
multiple unique restriction sites for the functional analysis of
eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
-
Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU 1986 An estrogen-responsive element derived from the 5' flanking region
of the Xenopus vitellogenin A2 gene functions in transfected human
cells. Cell 46:10531061[CrossRef][Medline]
-
Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park
I, Chambon P 1989 The cloned human oestrogen receptor contains a
mutation which alters its hormone binding properties. EMBO J 8:19811986[Medline]
-
Seed B, Sheen JY 1988 A simple phase-extraction
assay for chloramphenicol acyltransferase activity. Gene 67:271277[CrossRef][Medline]
-
Rosenthal N 1987 Identification of regulatory
elements of cloned genes with functional assays. Methods Enzymol 152:704720[Medline]
-
Sutherland RI, Murphy LC 1987 Mechanism of estrogen
antagonism by nonsteroidal antioestrogens. Mol Cell Endocrinol 25:523
-
McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike
JW 1995 Analysis of estrogen receptor function in vitro
reveals three distinct classes of antiestrogens. Mol Endocrinol 9:659669[Abstract/Free Full Text]
-
Weatherhill PJ, Wilson APM, Nicholson RI, Davies P,
Waekling AE 1988 Interaction of the antioestrogen ICI 164,384 with
the oestrogen receptor. J Steroid Biochem Mol Biol 30:263266
-
Waekling AE, Bowler J 1988 Biology and mode of
action of pure antioestrogens. J Steroid Biochem Mol Biol 30:141148
-
Yamamoto KR 1985 Steroid receptor regulated
transcription of specific genes and gene networks. Annu Rev Genet 19:209252[CrossRef][Medline]
-
Shupnik MA, Gordon MJ, Chin WW 1989 Tissue-specific
regulation of rat estrogen receptor mRNAs. Mol Endocrinol 3:660665[Abstract/Free Full Text]
-
Tora L, Gaub M-P, Mader S, Dierich A, Bellard M, Chambon
P 1988 Cell-specific activity of a GGTCA half-palindromic
oestrogen-responsive element in the chicken ovalbumin gene promoter.
EMBO J 7:37713778[Medline]
-
Gaub MP, Bellard M, Scheuer I, Chambon P, Sassone-Corsi
P 1990 Activation of the ovalbumin gene by the estrogen receptor
involves the Fos-Jun complex. Cell 63:12671276[CrossRef][Medline]
-
Nardulli AM, Romine LE, Carpo C, Greene GL, Rainish
B 1996 Estrogen receptor affinity and location of consensus and
imperfect estrogen response elements influence transcriptional
activation of simplified promoters. Mol Endocrinol 10:694704[Abstract/Free Full Text]
-
Friend KE, Ang LW, Shupnik MA 1995 Estrogen
regulates the expression of several different estrogen receptor mRNA
isoforms in rat pituitary. Proc Natl Acad Sci USA 92:43674371[Abstract/Free Full Text]
-
Wynick D, Hammond PJ, Akinsanya KO, Bloom SR 1993 Galanin regulates basal and oestrogen-stimulated lactotroph function.
Nature 364:529532[CrossRef][Medline]
-
Sethi T, Rozengurt E 1991 Galanin stimulates
Ca2+ mobilization, inositol phosphate accumulation, and
clonal growth in small cell lung cancer cells. Cancer Res 51:16741679[Abstract/Free Full Text]
-
Cai A, Hyde JF 1996 Function of galanin in the
anterior pituitary of estrogen-treated Fischer 344 rats: autocrine
regulation of prolactin secretion. Soc Neurosci 22:1349
(Abstract)
This article has been cited by other articles:

|
 |

|
 |
 
J. Y.-L. Yu, C.-H. Pon, H.-C. Ku, C.-T. Wang, and Y.-H. Kao
A preprogalanin cDNA from the turtle pituitary and regulation of its gene expression
Am J Physiol Regulatory Integrative Comp Physiol,
April 1, 2007;
292(4):
R1649 - R1656.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Merchenthaler, G. E. Hoffman, and M. V. Lane
Estrogen and Estrogen Receptor-{beta} (ER{beta})-Selective Ligands Induce Galanin Expression within Gonadotropin Hormone-Releasing Hormone-Immunoreactive Neurons in the Female Rat Brain
Endocrinology,
June 1, 2005;
146(6):
2760 - 2765.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Counts, S. E. Perez, S. D. Ginsberg, S. de Lacalle, and E. J. Mufson
Galanin in Alzheimer Disease
Mol. Interv.,
May 1, 2003;
3(3):
137 - 156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Peng and A. H. Payne
AP-2gamma and the Homeodomain Protein Distal-less 3 Are Required for Placental-specific Expression of the Murine 3beta -Hydroxysteroid Dehydrogenase VI Gene, Hsd3b6
J. Biol. Chem.,
March 1, 2002;
277(10):
7945 - 7954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Freeman, B. Kanyicska, A. Lerant, and G. Nagy
Prolactin: Structure, Function, and Regulation of Secretion
Physiol Rev,
October 1, 2000;
80(4):
1523 - 1631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Giustina and J. D. Veldhuis
Pathophysiology of the Neuroregulation of Growth Hormone Secretion in Experimental Animals and the Human
Endocr. Rev.,
December 1, 1998;
19(6):
717 - 797.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Faure-Virelizier, D. Croix, S. Bouret, V. Prevot, S. Reig, J.-C. Beauvillain, and V. Mitchell
Effects of Estrous Cyclicity on the Expression of the Galanin Receptor Gal-R1 in the Rat Preoptic Area: A Comparison with the Male
Endocrinology,
October 1, 1998;
139(10):
4127 - 4139.
[Abstract]
[Full Text]
[PDF]
|
 |
|