help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shemesh, M.
Right arrow Articles by Shore, L. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shemesh, M.
Right arrow Articles by Shore, L. S.
Endocrinology Vol. 138, No. 11 4844-4851
Copyright © 1997 by The Endocrine Society

ARTICLES

Expression of Functional Luteinizing Hormone (LH) Receptor and Its Messenger Ribonucleic Acid in Bovine Uterine Veins: LH Induction of Cyclooxygenase and Augmentation of Prostaglandin Production in Bovine Uterine Veins1

Mordechai Shemesh, Michael Gurevich, Dario Mizrachi, Ludmila Dombrovski, Yehuda Stram, Michael J. Fields and Laurence S. Shore

Departments of Hormone Research (M.S., M.G., D.M., L.D., L.S.S.) and Molecular Virology (Y.M.), Kimron Veterinary Institute, Bet Dagan, Israel; and the Animal Science Department (M.J.F.), University of Florida, Gainesville, Florida 32611

Address all correspondence and requests for reprints to: Mordechai Shemesh, Department of Hormone Research, Kimron, Veterinary Institute, Bet Dagan 12, Israel. E-mail: shemesh{at}huji.agri.ac.il


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously reported that bovine endometrium contains LH/human CG binding receptors and LH induces cyclooxygenase and prostaglandin production in the bovine endometrium. The present study investigated 1) whether bovine uterine vein and artery contain LH receptor messenger RNA (mRNA) and receptor protein and 2) whether LH can regulate the formation of vasoactive eicosanoids by the uterine vein. The uterine vein endothelium, but not the uterine artery, contained LH receptor mRNA transcript essentially identical to that found in the bovine corpus luteum. The uterine vein endothelium also contained a 95-kDa immunoreactive receptor protein that bound to rat anti-LH receptor antibody in Western blots. The LH receptor mRNA and LH receptor were maximally expressed in the uterine vein from cows in proestrus/estrus compared with cows in luteal or postovulatory phases. Incubation of endothelial minces of uterine vein with LH resulted in a 2-fold increase in cyclooxygenase concentration as determined by Western blot using an antibody to ram seminal vesicle cyclooxygenase. The increase in cyclooxygenase was maximal in cows in proestrus/estrus compared with postovulatory and luteal phase cows. Incubation of proestrous/estrous uterine vein or artery minces with LH or mellitin (a phospholipase A2 stimulator) caused increased production of eicosanoids. In the uterine vein, LH caused a significant increase in both PGF2{alpha} (basal 4.1 ± 0.4 vs. 5.7 ± 0.4 ng/100 mg·6 h, P < 0.01; N = 9 cows) and PGE2 (basal 5.7 ± 0.3 vs. 7.7 ± 0.8 ng/100 mg·6 h, P < 0.01; N = 6 cows) but had no effect on prostaglandin production by the artery. Mellitin increased PGF2{alpha} production by both uterine vein and artery minces but had no effect on PGE2 production in either tissue. Addition of steroids (progesterone, estradiol) or cytokines (tumor necrosis factor-{alpha}, IL-6) to the uterine vascular tissues had essentially no effect on prostanoid production. In summary, bovine uterine vein from proestrous/estrous cows expressed the LH receptor and its mRNA. Expression of the receptor may have physiological significance as LH induces cyclooxygenase and increases prostaglandin release in the uterine vein. The maximal stimulation of the receptor and its mRNA at proestrus/estrus may serve to increase the amounts of prostanoids reaching the regressing corpus luteum either directly by increasing prostanoid production or indirectly by increasing the blood flow to the ovary.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
WE HAVE RECENTLY reported the presence of LH/human CG (hCG) receptors in the bovine endometrium (1). These receptors are more numerous on days 2–4 (post ovulation) and 15–17 (late luteal) than on the other days of the estrous cycle. LH/hCG receptors were essentially undetectable during the proestrous/estrous stage (days 18–20 to estrus). It was also found that LH induces cyclooxygenase in the bovine endometrium. This LH-stimulated increase in cyclooxygenase was functional as LH treatment resulted in an increase of PGF2{alpha} secretion by cultured endometrial cells. Using Western blot analysis, a strong signal for cyclooxygenase was seen shortly before luteolysis but only a weak or nonexistent signal was found in proestrus endometrium.

LH/hCG receptors are present in the uteri of other species including human (2), rat (3), rabbit (4), and pig (5, 6). They are also present in the human placenta, fetal membrane, and decidua (2) and have been characterized in human endometrial and myometrial vascular smooth muscle (7). Furthermore, the endothelia of these blood vessels express hCG/hLH receptor messenger RNA (mRNA) and immunoreactive receptor protein (7) and contain high concentrations of cyclooxygenase in both the human (7) and sheep (8). However, the presence of LH receptors has not been reported for the bovine uterine veins. The bovine uterine vein is physiologically important due to its proximity to the ovarian artery, which allows the transfer of PGF2{alpha} by a countercurrent mechanism (9).

Prostaglandins are produced by vascular tissue, and there is great regional variability in this production (7, 10). Lacroix and Kann (11) have suggested that prostaglandins produced by the vascular tissue could play a role in the well documented rise in PGF2{alpha} seen in the uterine vein blood during proestrus (12). They found that prostaglandin production by the ovine endometrium was lower on day 16–17 (estrous) than on day 14 (late luteal). Similarly we have reported that cyclooxygenase expression in the bovine uterus was lower on day 19–20 than on day 16 (13), and Basu and Kindahl (14) have reported that the prostaglandin synthetic capacity of the bovine uterus is much lower on the day of estrus than on day 14 or 17.

The present work was conducted to determine: 1) if the mRNA for LH receptor is expressed in the bovine uterine vein; 2) if the LH receptor is present in the uterine vein; 3) if exogenous LH can regulate the expression of cyclooxygenase in the uterine vein; and 4) if LH can regulate the release of prostaglandins of the cyclooxygenase pathway from uterine vein.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Veins and arteries were collected from Holstein cows at a local abattoir. The stage of the cycle was determined according to signs of ovulation and the status of corpora lutea (weight, color). Cows with a regressing corpus luteum of less than 2 g with a large preovulatory follicle on the contralateral ovary were considered proestrous (34 cows). Cows with corpora hemmorhagica were considered postovulatory (11 cows), and cows with corpora lutea greater than 4 g were considered luteal (11 cows). All procedures were approved by the Kimron Veterinary Institute animal care and use committee.

Incubation of tissues
Sections of uterine vein and artery about 4 cm in length were taken at a distance of approximately 5 cm from the uterus where the vein was in contact with the ovarian artery below the ovarian plexus (9). Vascular tissues were minced with a scalpel and equal aliquots (30–50 mg) were incubated in wells containing 1.5 ml TCM-199 without serum (Biological Industries, Beit Haemek, Israel) with one of the following treatments: bLH (USDA bLH-I-1; 1.6 SI U/mg) 20 ng/ml (maximal over range of 1–100 ng/ml); mellitin (an activator of phospholipase A2) 20 µg/ml (maximal over range of 1–40 µg/ml); IL-6, 50, 100, 200 ng/ml; tumor necrosis factor (TNF)-{alpha} 300 pmol [TNF-{alpha} had no effect on PGF2{alpha} production by the uterine vein over the range of 1 to 3000 pM; 300 pmol was used as this dose induced maximal stimulation of PGF2{alpha} production by granulosa cells (15)]; progesterone, 10 ng/ml, as it was inactive over the range of 1–100 ng, and 10 ng/ml represents the physiological concentration of progesterone (luteal phase plasma concentration); estrogen, 10 ng/ml (optimal over the range of 1 to 100 ng/ml) as it was effective in increasing PGF2{alpha} production in some vein preparations (3/9). All chemicals were purchased from Sigma Chemical Co. (St. Louis, MO) unless otherwise noted. Samples were incubated in quadruplicate for 3 or 6 h at 37 C under an atmosphere of 5% CO2. Aliquots of 100 µl were taken at the end of the 3-h incubation period for analysis of PGE2 and PGF2{alpha} by RIAs as described below.

LH receptor gene expression
1) RNA isolation and RT-PCR

Total RNA was extracted (within 20 min after slaughter) with guanidine isothiocyanate-phenol-chloroform as described by Chirgwin et al. (16). RNA purity was determined by the A260/A280 ratio and its quality by agarose-formaldehyde gel electrophoresis.

2) Oligonucleotide primers for bovine LH receptor
For detecting the bovine LH receptor mRNA, a pair of primers, 20-mer each were selected from the Oligo program (Oligo R1 primer analysis software, National Biosciences, Plymouth, MN). The forward primer was a 20 mer oligonucleotide corresponded to position 276–295 (5'CACCCTCACAGTCATCACAC3') on the bovine LH receptor mRNA.2 The reverse primer was a 21 mer oligonucleotide complementary to position 808–828 (5'CTCAGCAACAGAAAGAAATC3'). The predicted size of the RT-PCR product was 552 bp. For internal control, a bovine ß-actin fragment that consisted of 890 bp produced from an upper primer (ACCAACTGGGACGACATGGAG; 21 mer) and a lower primer (GCATTTGCGGTGGACAATGGA; 21 mer) was used (18). DNA was synthesized using 2 µg total RNA, 12 U AMV reverse transcriptase (Promega, Madison, WI) and 2 µg random primers. The negative control reaction was identical to the above reaction, but no RNA was added. The cycling parameters of the PCR were: 94 C for 45 sec, 52 C for 45 sec and 72 C for 45 sec. The reaction was allowed to proceed for 35 cycles using 2 U tag polymerase (Apligine) and 200 pmol of each primer. After amplification, the samples were separated on a 1% agarose gel, stained with ethidium bromide, and photographed under UV light. The 552-bp fragment was extracted using Wizard PCR Preps Kit (Promega, Madison, WI) and sequenced with the upper primer using an automatic sequencer (Applied Biosystems, Foster City, CA).

Incubation of vascular tissues for Western blot analysis
Uterine vein and artery were excised and the endothelial layer scraped off with a scalpel blade, minced finely, and 50 mg of the mince was incubated in 1.5 ml of media for 15 h (maximal signal compared with 3, 6, or 24 h). In some of the incubations, LH was added (20 ng/ml). At the end of the incubation, tissue homogenates were centrifuged at 800 x g for 10 min and washed with 5 ml cold saline. Tissues were then lysed in the lysing buffer which contained 10 nmol/liter Tris-HCl, pH 7.5; 0.5 nmol MgCl2; 2 nmol EGTA, 1 nmol phenylmethylsulfonyl fluoride plus 1% NP-40 and 0.1% SDS. The lysate was incubated for 15 min on ice, sonicated, and centrifuged (13,000 x g for 10 min). The supernatant was stored at -70 C. Before analysis, extracts were heated (100 C for 10 min in the presence of SDS (0.2%).

Western blots
Vascular tissue extracts and bovine seminal vesicle soluble cell extract (100 µg protein) were separated on SDS-PAGE and electroblotted onto nitrocellulose paper (Amersham, Buckinghamshire, UK) as previously described (19). The nitrocellulose paper was then treated with either 1) rabbit anticyclooxygenase polyclonal antiserum (19) (diluted 1:200 in washing buffer for 2.5 h at room temperature or 2) antiserum for rat LH receptor (diluted 1:200; antirat LH receptor - LHRO2; donation of Dr. D. Segaloff, University of Iowa) (20). The nitrocellulose paper was then incubated with horse radish peroxidase conjugated goat antirabbit IgG (Bio-Maker, Rehovot, Israel; diluted 1:2000 in washing buffer) for 1 h at room temperature. The presence of cyclooxygenase or LH receptor was then visualized by means of a color reaction as follows: The nitrocellulose paper was incubated in a substrate solution containing 3,3-diaminobenzidine (0.5 mg/ml, Sigma) in a mixture of PBS containing 0.5% CaCl2 and 6% H202. The antibody for cyclooxygenase recognized both cyclooxygenase I (~69 kDa) and cyclooxygenase II 72 kDa (19). However, although cyclooxygenase I was seen in seminal vesicle controls, it was not present in sufficient quantities in the vein preparations to be detected. The antibody to rat LH recognized both the mature (93 kDa) and immature (73 kDa) forms of the LH receptor (20). The Densiometric scans were obtained using a bioimaging system (B.I.S. 2020, Rhenium Dingo, Jerusalem, Israel) and processed with the Tina 2.0 software (Fuji, Japan).

RIA for prostaglandins E2 and F2{alpha}
Aliquots of 100 µl were taken at the end of the incubation period for specific RIA of PGE and PGF, which were performed without chromatographic separation. The antiserum for PGF (Sigma Israel, Rehovot, Israel) reacts preferentially with PGF2{alpha} but cross-reacts with PGF1{alpha} (60%) and to a negligible extent (0.1%) with prostaglandins of the A, B, and E series. The antiserum to PGE reacts preferentially with PGE2 but cross-reacts with PGA1, PGA2, PGF1, PGF2{alpha}, and PGE1 (<10%) and to a negligible extent with, PGB1 and PGB2 (<0.1%). The within-assay coefficients of variation were 9 and 11% and the between-assay coefficients of variance were 12 and 13% for PGF2{alpha} and PGE assays, respectively. The sensitivity per tube was 10 pg.

Statistical analysis
ANOVA was performed with a significance level of P < 0.05. Data were further analyzed using Tukey’s procedure to assess significance between treatments. Data are reported as means ± SEM.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
LH/hCG receptor mRNA in uterine vein and arteries
RT-PCR demonstrated that the LH receptor gene is expressed in the uterine vein from proestrous/estrous cows and the mid-cycle bovine corpus luteum (Fig. 1Go). There was no detectable signal for the mRNA in uterine veins from luteal or postovulatory phase cows. Similarly, there was no signal for the LH receptor mRNA in the arteries at any stage of the cycle (luteal, proestrus/estrus or postovulatory) tested (Figs. 2Go and 3Go). Tissues negative for LH receptor mRNA in extracts of fresh tissue were also incubated in 1.5 ml TCM 199 for 1 h at 37 C, but the signal was still undetected.



View larger version (66K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR amplification of bovine uterine vein LH receptor mRNA. RT-PCR was performed using 2 µg of uterine vein RNA from days 3–5 (lane 1); Luteal phase (lane 2); proestrus (lane 3). Lane 4 represents negative control, absence of RNA; lane 5 represents the positive control (mid-cycle corpus luteum). PCR amplification was performed as described in Material and Methods. PCR amplification products (estimated 552 bp) were separated on agarose gel electrophoresis and stained with ethidium bromide. The PCR product was present in appreciable quantities only in proestrus uterine veins (lane 3). Figure representative of four different experiments, each consisting of 3 cows.

 


View larger version (50K):
[in this window]
[in a new window]
  		Figure 2. RT-PCR amplification of bovine uterine vessel LH receptor mRNA. Uterine veins and arteries, jugular vein and carotid artery were taken from different stages of the estrous cycle. RT-PCR was performed using 2 µg RNA of: carotid artery from days 3–5 (lane 1); jugular vein from the same days (lane 2); uterine artery at the time of estrus (lane 3); uterine vein from time of estrus (lane 4); uterine artery from luteal phase (lane 5); uterine vein from luteal phase (lane 6). Lane 7 represents negative control in the absence of RNA and lane 8 represents the positive control (2 µg RNA from mid-cycle corpus luteum).

 


View larger version (59K):
[in this window]
[in a new window]
  		Figure 3. RT-PCR amplification of uterine artery, corpus luteum LH receptor mRNA, and bovine ß-actin transcript as internal standard. Incubation and RT-PCR were performed as described in Fig. 1Go. Lanes 1–4 refer to LH receptor mRNA and lanes 5–7 to beta actin mRNA. Lane 1, Uterine artery from days 3–5; lane 2, artery from luteal phase; lane 3, artery from proestrus. Lane 4, Positive control (mid-cycle corpus luteum) for RT-PCR amplification product (estimated 552 bp, cDNA). Lanes 5–7, same as for lanes 1–3 but tested for bovine ß-actin fragment of 890 bp as a loading control. Lane 8 represents negative control in absence of RNA. Lane 9 represents mid-cycle luteal tissue with ß-actin probe.

 
To demonstrate that the absence of LH receptor mRNA from the uterine artery or nonestrous vein was specific, bovine ß-actin mRNA was used as a control. PCR amplification using the primers described in Material and Methods demonstrated that a specific 890-bp band was produced from ß-actin complementary DNA (cDNA). The 890-bp fragments were found in the vein and artery preparations even though they were negative for the 552-bp band that corresponded to the LH receptor mRNA (Fig. 3Go).

The nucleotide sequence of the 552-bp fragment obtained from the bovine uterine vein receptor displayed a 99.8% homology with the comparable region on the bovine corpus luteum LH receptor mRNA reported by Lussier1 (Fig. 4Go).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 4. Automated nucleotide sequencing and homology analysis between Bos taurus mRNA LH receptor (accession no. Btu 20504) from nucleotide 316 to 785 and the PCR products were obtained using the upper primer described in Materials and Methods. An homology of 99.8% was found between the Bos taurus LH receptor and the PCR product for a 439-bp fragment, suggesting that our amplified cDNA is complimentary to LH receptor mRNA.

 
LH receptor in the uterine vein
To determine if the LH receptor is actually expressed in the uterine vein, endothelial layer minces from uterine veins were incubated for 0 or 15 h (time required for LH to induce maximal stimulation of cyclooxygenase expression) in TCM -199. Tissues were then extracted, soluble cell extract separated on SDS-PAGE, and tested in Western blot analysis using a specific antibody for rat LH receptor. The rat anti-LH receptor antibody recognized the mature 93-kDa bovine corpus luteum LH receptor as determined by Western blot analysis. After 15 h of incubation, a strong signal for the 93-kDa LH receptor was present in uterine vein extracts from estrus, whereas a weaker signal was seen in uterine vein extracts from the luteal phase. However, there was no detectable or weak signal in uterine veins from days 2–5 post ovulation (Fig. 5Go). Essentially the same results were seen in fresh tissue extracts without incubation (data not shown).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Expression of LH receptor in bovine uterine vein. Minces of the endothelial layer of the uterine vein were incubated in 1.5 ml of media for 15 h. Tissues were then lysed and soluble extract prepared as described in Material and Methods. One hundred micrograms of protein of soluble cell extract from the vein or mid-cycle bovine corpus luteum were separated on SDS-PAGE and electroblotted to nitrocellulose. The binding of rat anti-LH receptor antibody (1:200 dilution) was then used in the Western blot analysis to determine the presence of the LH receptor. CL, Mid-cycle corpus luteum; Vein 15–17, veins taken during the luteal phase, days 15–17; Vein EST, veins taken at estrus; Vein 2–5, veins taken shortly after ovulation, days 2–5. Histogram shows the relative intensity compared with CL of four vein preparations (0.21 ± 0.02 for day 15–17 vs. 0.32 ± 0.08 for day of estrus; P < 0.02 by unpaired t test. There was no detectable signal when veins from days 2–5 were tested.

 
Induction of cyclooxygenase by LH in bovine uterine vein
To determine if there was a direct effect of LH on the induction of cyclooxygenase, endothelial layer minces from uterine veins were incubated for 15 h in the presence or absence of LH (20 ng/ml). LH stimulated cyclooxygenase after 3 and 6 h of incubation, and this stimulation increased until 15 h after which time the signal was less intense (18 h, 24 h, data not shown). Tissues were extracted and separated on SDS-PAGE and tested for cyclooxygenase in Western blot analysis using a specific antibody for bovine cyclooxygenase. The effect of LH on the induction of bovine vein cyclooxygenase (72 kDa) is shown in Fig. 6Go. LH induced more than a 100 ± 20% (N = 4) increase in the expression of cyclooxygenase by uterine vein from proestrous cows. No stimulation of cyclooxygenase by LH was seen in uterine vein from luteal or postovulatory phase or in uterine artery from any stage of the cycle (data not shown).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 6. Induction of cyclooxygenase (72 kDa) by LH in bovine uterine vein. Veins were taken from proestrous/estrous cows and incubated (10–20 mg minces) in the absence or presence of LH (20 ng/ml) for 15 h. Soluble cell extracts were prepared and analyzed as described in Materials and Methods. Soluble cell extracts (100 µg protein) were used for the Western blots in the presence of antibody for bovine cyclooxygenase. Western blot shown was representative of four preparations. BSV, Soluble cell extract of bovine seminal vesicle; Vein, bovine uterine vein from proestrous/estrous cow in the presence (+) or absence (-) of LH. Histogram shows the relative intensity compared with BSV of the vein preparations (0.33 ± 0.06 vs. 0.57 ± 0.07 SEM in the absence and presence of LH, respectively; P < 0.02 by paired t test.

 
Time course for basal PGE2 and PGF2{alpha} production by uterine vein preparations
To determine if LH can affect the production of the products of the cyclooxygenase pathway, we tested the effect of LH on the production of prostaglandins by bovine vascular tissues. In parallel, we tested other possible stimulators of prostaglandin production (mellitin, steroids, and cytokines).

Initially, the time course for vascular tissue prostaglandin production was determined. Both PGE2 and PGF2{alpha} production by the vascular tissues increased linearly over 15 h of culture. Uterine vein preparations produced 2.78 ± 0.43 and 4.35 ± 0.39 ng PGF2{alpha}/100 mg tissue (N = 10 cows) after 3 h and 6 h, respectively. The corresponding values for PGE2 were 3.09 ± 0.38 and 5.59 ± 0.45 PGE2 ng/100 mg. The uterine artery preparations produced 3.66 ± 0.31 ng/ml and 4.89 ± 0.21 ng/ml PGF2{alpha} after 3 h and 6 h and 3.52 ± 0.41 and 5.69 ± 0.58 ng PGE2/ml, respectively.

Effect of LH and melittin on PGF2{alpha} production by uterine vein in vitro
To determine if activation of cyclooxygenase by exogenous LH is reflected in increased PGF2{alpha} or PGE2 production by the veins, vascular tissues were incubated with LH and the prostaglandins determined. We also examined if activation of phospholipase A2 by mellitin could cause increased prostaglandins production by the uterine vein or artery.

Minces of uterine vein tissue from nine proestrous cows were incubated in the presence or absence of LH or mellitin (Fig. 7Go). Both mellitin and LH increased PGF2{alpha} after 3 h and 6 h of incubation (P < 0.05). No significant effect of LH or mellitin was seen after 1 h of incubation, and no further stimulation was seen at incubation times longer than 6 h (12, 15, or 24 h).



View larger version (59K):
[in this window]
[in a new window]
  		Figure 7. PGF2{alpha} production by uterine veins in the presence or absence of progesterone (10 ng/ml), estradiol (10 ng/ml), bLH (20 ng/ml), or mellitin (20 µg/ml). Minces (50 mg) of veins were incubated for 3 or 6 h in TCM 199. PGF2{alpha} was measured directly in the media by RIA. All treatments were conducted in quadruplets. Each group contained nine cows. Columns with different superscripts were significantly different from each other by ANOVA (P < 0.01).

 
Effect of LH and mellitin on PGF2{alpha} production by uterine artery in vitro
Minces of uterine artery from nine proestrous/estrous cows were incubated in the absence or presence of LH or mellitin as described for uterine vein. LH did not affect PGF2{alpha} production by the uterine artery (Fig. 8Go) at either 3 or 6 h of incubation. However, mellitin increased (P < 0.05) PGF2{alpha} production after both 3 and 6 h of incubation.



View larger version (48K):
[in this window]
[in a new window]
  		Figure 8. PGF2{alpha} production by uterine arteries in the presence or absence of progesterone (10 ng/ml), estradiol (10 ng/ml), bLH (20 ng/ml), or mellitin (20 µg/ml). Minces (50 mg) of veins were incubated for 3 or 6 h in TCM 199. PGF2{alpha} was measured directly in the media by RIA. All treatments were conducted in quadruplets. Each group contained nine cows. Columns with different superscripts were significantly different from each other by ANOVA (P < 0.01).

 
In vitro PGE2 production by uterine vein and artery in the presence of LH and mellitin
PGE2 production by the vein preparations was elevated (P < 0.05) by LH after 6 h of incubation, but this was not seen after 3 h (Fig. 9Go). There was no demonstrable effect of mellitin on PGE2 production after 3 or 6 h of incubation. Neither LH or mellitin had any effect on PGE2 production by uterine artery at either 3 or 6 h of incubation (at 3 h, controls, 3.58 ± 0.61; LH -3.26 ± 0.71; mellitin, 3.83 ± 1.01 ng PGE2/100 mg; at 6 h, controls, 5.52 ± 0.86; LH, 5.72 ± 0.95; mellitin, 6.09 ± 1.23 ng PGE2/100 mg; N = 6 cows).



View larger version (45K):
[in this window]
[in a new window]
  		Figure 9. PGE2 production by uterine veins in the presence or absence of progesterone (10 ng/ml), estradiol (10 ng/ml), bLH (20 ng/ml), or mellitin (20 µg/ml). Minces (50 mg) of veins were incubated for 3 or 6 h in TCM 199. PGE2 was measured directly in the media by RIA. All treatments were conducted in quadruplets. Each group contained six cows. NS, Not significant. Columns with different superscripts were significantly different from each other by ANOVA (P < 0.01).

 
Effect of steroids and cytokines on prostaglandin production by vascular tissues
To demonstrate the specific effect of LH on the increased production of the products of the cyclooxygenase pathway by vascular tissues, we examined the effect of other known stimulators of this pathway. Progesterone (10 ng/ml) had no significant effect on the production of either PGF2{alpha} or PGE2 in any vascular tissue tested ( Figs. 7–9GoGoGo). The effect of estrogen was inconsistent in that it stimulated PGF2{alpha} production in 3/9 preparations but overall had no significant effect.

Neither IL-6 or TNF-{alpha} significantly affected PGF2{alpha} production by uterine vein minces (control: 4.04 ± 0.89 ng/100 mg; N = 5 vs. 3.32 ± 0.53 for IL-6 and 3.42 ± 0.42 for TNF-{alpha} after 6 h of incubation). Similarly, no effect of the two cytokines could be demonstrated on uterine PGE2 or arterial PGF2{alpha} or PGE2 production (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present work demonstrated that 1) LH mRNA is expressed in the bovine uterine vein and 2) the LH receptor is present in the uterine vein. The receptor and its mRNA are expressed maximally at the time of the LH peak, i.e. proestrus/estrus. The possible physiological significance of the presence of these LH receptors was evident from the observation that LH increased the expression of cyclooxygenase and the production of cyclooxygenase products by the uterine vein. The function of this increased prostaglandin production is not known but may be related to the final stages of luteolysis by a direct action of the prostaglandins on the corpus luteum or by alterations in the blood flow reaching the ovary to accelerate regression.

Expression of LH receptor mRNA and the presence of LH receptor have been reported for human uterine arteries (7, 21). Furthermore, the authors reported that exogenous hCG can increase cyclooxygenase and the formation of vasoactive eicosanoids in the human uterine artery as determined by immunohistochemistry. Binding of labeled hCG has also been reported in the porcine uterine vein and artery (22) and in the vasculature of the bovine corpus luteum (23). Although in the pig vasculature, the concentration of binding sites increased during the luteal phase, no such changes in hCG/LH binding sites could be demonstrated in the bovine ovarian vessels.

Luteinizing hormone mRNA expression by vascular tissue
The nucleotide sequence homology between our RT-PCR product consisting of 552 bp was 99.8% identical to the comparable region of the bovine LH receptor, showing that our amplified cDNA was complementary to the Bos taurus mRNA LH receptor at nucleotides 316–780. The 552-bp cDNA was consistently present in RT-PCR treated total RNA extracts of bovine corpus luteum and uterine vein of proestrus/estrus. However, the 552-bp cDNA was not found in uterine veins at other days of the cycle nor the uterine artery.

These results demonstrate the presence of functional LH receptor mRNA in the bovine uterine vein. The uterine vein LH receptor gene was homologous (99.8%) to the LH receptor gene present in the ovary. This suggests that both the extragonadal site and the CL have the same LH receptor gene and that they produce the same product. Furthermore, there is strong evidence that the LH receptor gene present in the uterine vein is physiologically functional as the uterine vein expressed an LH receptor protein of the same molecular weight as that found in the bovine corpus luteum.

Presence of LH receptor protein in vascular tissue
The specific antibody to rat LH receptor was prepared against the N-terminal amino acid sequence (197–207; LHRO2). This antibody was used for Western blot analysis to detect the 93 kDa LH receptor protein in both the bovine uterine vein and corpus luteum. The size of the luteal LH receptor on our SDS gels appeared to be the same as the uterine vein receptor, suggesting that the same form is present on the cell surface of both tissues. However, in some preparations a small 73-kDa band was observed. This may be the result of processing of the mature receptor by proteolytic cleavage as suggested by Segaloff for the two forms of the rat LH receptor (20).

A strong signal for the 93-kDa LH receptor was present in uterine vein extracts from estrus. However, there was only a weak signal during the luteal phase, and no detectable signal was seen in uterine veins from days 2–5 post ovulation. These data demonstrate a good correlation between the expression of the LH receptor mRNA and induction of the receptor at proestrus/estrus.

Induction of cyclooxygenase by LH in bovine uterine vein
The presence of the cyclooxygenase was demonstrated using an antibody to ram seminal vesicle cyclooxygenase. Our antibody could discriminate between cyclooxygenase I and II (19), but only cyclooxygenase II was seen in vein preparations regardless whether LH was present. This was not unexpected as in vivo administration of hCG induces cyclooxygenase II but not cyclooxygenase I in bovine preovulatory follicles (24). Similarly, we have reported that LH stimulates primarily cyclooxygenase II in the bovine endometrium (13).

LH caused more than a 2-fold increase in the expression of cyclooxygenase by uterine vein from proestrous cows. No stimulation of cyclooxygenase by LH was seen in uterine vein from luteal or postovulatory phase or in uterine artery from any stage of the cycle.

Effect of LH on prostaglandin production by vascular tissue
Activation of the PGF2{alpha} pathway simultaneously with activation of PGE2 production by LH was tissue specific as it was seen only in uterine vein and not in the uterine artery. This effect was specific to bLH as activation of phospholipase A2 by mellitin, which caused a significant increase in PGF2{alpha} in both vein and artery, did not elevate PGE2 in either tissue. Similarly, in a few preparations of vein where a stimulatory effect of estradiol on PGF2{alpha} was detected, PGE2 was not affected. Thus the stimulatory effect of bLH on both PGF2{alpha} and PGE2 is different from other hormonal regulators of the cyclooxygenase pathway products. This increased prostaglandin production is presumably due to a direct effect on cyclooxygenase as previously reported for the endometrium (1). However in the endometrium only PGF2{alpha} production was stimulated by LH while both PGF2{alpha} and PGE2 were stimulated by LH in the uterine vein. Tissue specific response to stimulators of cyclooxygenase is not unusual in the bovine reproductive tract as we have found that the principal product of oxytocin stimulated prostaglandin production in the endometrium is PGF2{alpha}, whereas the principal product in the cervix is PGE (unpublished observations).

Extragonadal effects of LH
The hyperemic effect of LH on ovarian blood vessels was one of the earliest reported effects of LH (25, 26). Subsequently it has been established that LH increases ovarian blood flow in the human (27, 28), rabbit (29, 30) and rat (31, 32, 33, 34). More recently, it has been shown that LH/hCG receptors are present in a wide variety of tissues (fallopian tube, myometrium, endometrium, chorion, amnion decidua, placenta, umbilical cord (for review see Ref.35) and has been shown to have physiological effects in these tissues.

Specifically in the vascular system, human uterine and umbilical arteries but not placental vessels contain hCG receptors (21, 35). In the human uterine artery, hCG was found to stimulate PGI2 and PGF2{alpha} but decreased production of PGE2 and TXA2. This may be related to the action of PGI2 on dilating and PGE2 action in constricting uterine blood vessels in humans (36, 37) and dogs (38). The differential release of these compounds could therefore be related to vasodilatory effect of LH on uterine vessels. The action of hCG on human uterine artery is in contrast to our finding that LH had no effect on bovine arterial production of prostanoids. This may reflect the very different mechanisms for maternal recognition of pregnancy in ruminants as opposed to primates.

Physiological significance of LH stimulation of uterine vein prostanoids in the cow
The present experiments were conducted with uterine vein and artery from proestrous cows. At the time of proestrus/estrus, the level of cyclooxygenase in the endometrium is very low (1). However, during ruminant proestrus/estrus, the concentration of PGF2{alpha} in the uterine venous blood is substantial being about 1–3 ng/ml in the cow (12) and about 6–7 ng/ml in the ewe (39, 40). Because LH does increase cyclooxygenase and its products in the uterine vein during proestrus/estrus, some of the prostaglandin measured in the uterine venous blood at this time could well be the result of prostanoids production within the vein itself.

An increase in eicosanoids during proestrus/estrus could play a role in luteolysis by two mechanisms: 1) increasing blood flow in the countercurrent plexus between the uterine artery and the ovarian vein by PGE2; and 2) increasing the amount of the luteolytic agent (PGF2{alpha}) reaching the corpus luteum. Other roles for uterine venous PGE2 could be the softening of the cervix at estrus or initiation of the preovulatory development of antral follicles and the increase in estradiol secretion from the preovulatory follicles. This later hypothesis is suggested by the finding of a secondary LH peak at the time of luteolysis in the goat (41).

In this study, it was found that bovine uterine vein LH receptor mRNA levels and the level of LH receptor varied during the estrous cycle. Both the LH mRNA level and receptor concentration reached maximum levels concomitantly at proestrus/estrus. However, during the luteal phase, mRNA levels were not detectable and the receptor concentration was only minor compared with that seen at proestrus/estrus. The maximal expression of the receptor and its mRNA at proestrus/estrus correlated with the maximal effect of exogenous LH on the induction of cyclooxygenase and prostanoid production by the uterine vein tissue preparations.

Additional investigations of these relationships may prove important in the understanding of the mechanisms involved in LH receptor regulation in both the bovine endometrium and vein. This, in turn, could lead to the design of novel protocols to induce contraction of the uterus or regression of the corpus luteum.


   Acknowledgments
 
We thank Dr. D. L Segaloff, University of Iowa College of Medicine, for her generous gift of the antirat LH receptor, LHR02, used in this study.


   Footnotes
 
1 This work was supported by Grant No. US-2333–93 from the US-Israel Binational Agricultural Research and Development Fund (BARD). Back

2 Lussier, J. G., and A. Houde; GenBank accession number U20504. Back

Received February 11, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Friedman S, Gurevich M, Shemesh M 1995 Bovine cyclic endometrium contains high-affinity luteinizing hormone/human chorionic gonadotropin receptors. Biol Reprod 52:1020–1026[Abstract]
  2. Reshef E, Lei ZM, Rao ChV, Pridham DD, Chegini N, Luborsky JL 1990 The presence of gonadotropin receptors in nonpregnant human uterus, human placenta, fetal membranes, and decidua. J Clin Endocrinol Metab 70:421–430[Abstract/Free Full Text]
  3. Bonnamy PJ, Benhaim A, Leymarie P 1990 Estrous cycle related changes of high affinity luteinizing hormone/human chorionic gonadotropin binding sites in the rat uterus. Endocrinology 126:1264–1269[Abstract/Free Full Text]
  4. Jensen JD, Odell WD 1988 Identification of LH/hCG receptors in rabbit uterus. Proc Soc Exp Biol Med 189:28–30[CrossRef][Medline]
  5. Ziecik AJ, Stanchev PD, Tilton JE 1986 Evidence for the presence of luteinizing hormone/human chorionic gonadotropin-binding sites in the porcine uterus. Endocrinology 119:1159–1163[Abstract/Free Full Text]
  6. Ziecik AJ, Jedlinska M, Rzucidlo JS 1992 Effect of estradiol and progesterone on myometrial LH/hCG receptors in pigs. Acta Endocrinol 127:185–188
  7. Lei ZM, Reshef E, Rao ChV 1992 The expression of human chorionic gonadotropin/luteinizing hormone receptors in human endometrial and myometrial blood vessels. J Clin Endocrinol Metab 75:651–659[Abstract]
  8. Salamonsen LA, Findlay JK 1990 Immunohistochemical localization of prostaglandin synthase in the ovine uterus during the oestrous cycle and in early pregnancy. Reprod Fertil Dev 2:311–319[CrossRef][Medline]
  9. Ginther OJ, Del Campo CH 1974 Vascular anatomy of the uterus and ovaries and the unilateral luteolytic effect of the uterus: cattle. Am J Vet Res 35:193–203[Medline]
  10. Jen CJ, Huang TY, Chen L.-Y C, Wing C, Lin MT, Wu HL, Chang WC 1994 Regional differences in prostaglandin production rates among porcine intrathoracic vessels. Prostaglandins 47:109–122[CrossRef][Medline]
  11. Lacroix MC, Kann G 1983 Discriminating analysis of "in vitro" prostaglandin release by myometrial and luminal sides of the ewe endometrium. Prostaglandins 25:853–869[CrossRef][Medline]
  12. Shemesh M, Hansel W 1975 Levels of prostaglandins (PGF) in bovine endometrium, uterine venous, ovarian arterial and jugular plasma during the estrous cycle. Proc Soc Exp Biol 148:123–126[CrossRef][Medline]
  13. Shemesh M, Freidman S, Harel-Markowitz E, Gurevich M 1994 Induction and regulation of the cyclooxygenase in the bovine endometrium. In: Zor M (ed) Lipid Mediators in Health and Disease, Freund Publishing House Ltd., Tel Aviv, Israel, pp 71–78
  14. Basu S, Kindahl H 1987 Prostaglandin biosynthesis and its regulation in the bovine endometrium: A comparison between nonpregnant and pregnant status. Theriogenology 28:175–193
  15. Zolti M, Meirom R, Shemesh M, Wollach D, Mashiach S, Shore L, Ben Rafael Z 1990 Granulosa cells as a source and target organ for tumor necrosis factor-{alpha}. FEBS Lett 261:253–255[CrossRef][Medline]
  16. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299[CrossRef][Medline]
  17. Deleted in proof
  18. Degen JL, Neubauer MG, Freizner-Degen SJ, Seyfried CE, Morris DR 1983 Regulation of protein synthesis in mitogen-activated bovine lymphocytes. Analysis of actin-specific and total mRNA accumulation and utilization. J Biol Chem 258:12153–12162[Abstract/Free Full Text]
  19. Izhar M, Pasmanik M, Marcus S, Shemesh M 1992 Dexamethasone inhibition of cyclooxygenase expression in bovine term placenta. Prostaglandins 43:239–254[CrossRef][Medline]
  20. Rodriguez MC, Segaloff DL 1990 The orientation of the lutropin/choriogonadotropin receptor in rat luteal cells as revealed by site-specific antibodies. Endocrinology 127:674–681[Abstract/Free Full Text]
  21. Toth P, Li X, Rao ChV, Lincoln SR, Sanfilippo JS, Spinnato JA II, Yussman MA 1994 Expression of functional human chorionic gonadotropin/human luteinizing hormone receptor gene in human uterine arteries. J Clin Endocrinol Metab 79:307–315[Abstract]
  22. Ziecik AJ, Ostrowska G, Kisielewska J, Zezula-Szpyra A 1995 Distribution and cycle phase dependency of gonadotropin receptors in musculature and blood vessels of the porcine broad ligament. Exp Clin Endocrinol Diab 44:44–51
  23. Chegini N, Lei ZM, Rao ChV, Hansel W 1991 Cellular distribution and cycle phase dependency of gonadotropin and eicosanoid binding sites in bovine corpora lutea. Biol Reprod 45:506–513[Abstract]
  24. Sirois J 1994 Induction of prostaglandin endoperoxide synthetase-2 by human chorionic gonadotropin bovine preovulatory follicles in vivo. Endocrinology 135:841–848[Abstract]
  25. Zondek B, Sulma F, Black R 1945 The hyperemia effect of gonadotropins on the ovary and its use in a rapid pregnancy test. J Am Med Assoc 129:939–949
  26. Ellis S 1961 Bioassay of luteinizing hormone. Endocrinology 68:334–340
  27. Goswamy RK, Steptoe PC 1988 Doppler ultrasound studies of the uterine artery in spontaneous ovarian cycles. Hum Reprod 3:721–726[Abstract/Free Full Text]
  28. Kurjak A, Kupesic-Urek S, Schulman H, Zalud I 1991 Transvaginal color flow Doppler in the assessment of ovarian, uterine blood flow in infertile women. Fertil Steril 56:870–873[Medline]
  29. Janson PO 1975 Effects of the luteinizing hormone on blood flow in the follicular rabbit ovary, as measured by radioactive microspheres. Acta Endocrinol 79:122–133
  30. Lee W, Novy MJ 1978 Effects of luteinizing hormone and indomethacin on blood flow and steroidogenesis in the rabbit ovary. Biol Reprod 17:799–807
  31. Wurtman RJ 1964 An effect of luteinizing hormone on the fractional perfusion of the rat ovary. Endocrinology 75:927–933
  32. Bruce NW, Dimmit SB 1977 Ovarian venous blood flow in non-pregnant and pregnant rats. J Endocrinol 72:127–133[Abstract/Free Full Text]
  33. Norjavaara E, Olofsson J, Gafvels M, Selstam G 1987 Redistribution of ovarian blood flow after injection of human chorionic gonadotropin and luteinizing hormone in the adult pseudopregnant rat. Endocrinology 120:107–114[Abstract/Free Full Text]
  34. Bonnamy PJ, Benhaim A, Leymarie P 1989 Human chorionic gonadotrophin affects tissue levels of progesterone and cyclic adenosine 3',5'-monophosphate in the metestrus rat uterus in vitro. Biol Reprod 40:511–516[Abstract]
  35. Rodway MR, Rao Ch V 1995 A novel perspective on the role of human chorionic gonadotropin during pregnancy and in gestational trophoblastic disease. Early pregnancy. Biol Med 1:176–187
  36. Wilhelmsson L, Lindblom B, Wikland M, Wigwist N 1981 Effects of prostaglandins on the isolated uterine artery from non-pregnant women. Prostaglandins 22:223–233[CrossRef][Medline]
  37. Hollister MC, Reid Dl, Phenetton TM, Landauer M, Ranken JHG 1988 Dose-response curves of uterine and placental vascular beds to prostaglandin I2. Am J Obstet Gynecol 159:1372–1375[Medline]
  38. Kimura T, Yoshida Y, Toda N 1992 Mechanisms of relaxation induced by prostaglandins in isolated canine uterine arteries. Am J Obstet Gynecol 167:1409–1416[Medline]
  39. Pexton JE, Weems CW, Inskeep EK 1975 Prostaglandins F in uterine venous plasma, ovarian arterial and venous plasma and in ovarian and luteal tissue of pregnant and nonpregnant ewes. J Anim Sci 41:154–159
  40. Lewis GS, Wilson JR, Wilks JW, Pexton JE, Fogwell, RL, Ford SP, Butcher RL, Thayne WV, Inskeep EK 1977 PGF2{alpha} and its metabolites in uterine and jugular venous plasma and endometrium of ewes during early pregnancy. J Anim Sci 45:320–327
  41. Mori Y, Kano Y 1984 Changes in plasma concentrations of LH, progesterone and oestradiol in relation to the occurrence of luteolysis, oestrus and the time of ovulation in the Shiba goat (Capra hircus). J Reprod Fertil 72:223–230[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
M. J. Fields and M. Shemesh
Extragonadal Luteinizing Hormone Receptors in the Reproductive Tract of Domestic Animals
Biol Reprod, November 1, 2004; 71(5): 1412 - 1418.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
N. Danilovich, I. Roy, and M. R. Sairam
Emergence of Uterine Pathology during Accelerated Biological Aging in FSH Receptor-Haploinsufficient Mice
Endocrinology, September 1, 2002; 143(9): 3618 - 3627.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
G. Schuler, C. Wirth, U. Teichmann, K. Failing, R. Leiser, H. Thole, and B. Hoffmann
Occurrence of Estrogen Receptor {alpha} in Bovine Placentomes Throughout Mid and Late Gestation and at Parturition
Biol Reprod, April 1, 2002; 66(4): 976 - 982.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
D. Mizrachi and M. Shemesh
Follicle-Stimulating Hormone Receptor and Its Messenger Ribonucleic Acid Are Present in the Bovine Cervix and Can Regulate Cervical Prostanoid Synthesis
Biol Reprod, September 1, 1999; 61(3): 776 - 784.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shemesh, M.
Right arrow Articles by Shore, L. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shemesh, M.
Right arrow Articles by Shore, L. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals