| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Hormone Research (M.S., M.G., D.M., L.D., L.S.S.) and Molecular Virology (Y.M.), Kimron Veterinary Institute, Bet Dagan, Israel; and the Animal Science Department (M.J.F.), University of Florida, Gainesville, Florida 32611
Address all correspondence and requests for reprints to: Mordechai Shemesh, Department of Hormone Research, Kimron, Veterinary Institute, Bet Dagan 12, Israel. E-mail: shemesh{at}huji.agri.ac.il
| Abstract |
|---|
|
|
|---|
(basal 4.1 ± 0.4 vs. 5.7
± 0.4 ng/100 mg·6 h, P < 0.01; N = 9 cows)
and PGE2 (basal 5.7 ± 0.3 vs. 7.7
± 0.8 ng/100 mg·6 h, P < 0.01; N = 6 cows)
but had no effect on prostaglandin production by the artery. Mellitin
increased PGF2
production by both uterine vein and
artery minces but had no effect on PGE2 production in
either tissue. Addition of steroids (progesterone, estradiol) or
cytokines (tumor necrosis factor-
, IL-6) to the uterine vascular
tissues had essentially no effect on prostanoid production. In summary,
bovine uterine vein from proestrous/estrous cows expressed the LH
receptor and its mRNA. Expression of the receptor may have
physiological significance as LH induces cyclooxygenase and
increases prostaglandin release in the uterine vein. The maximal
stimulation of the receptor and its mRNA at proestrus/estrus may serve
to increase the amounts of prostanoids reaching the regressing corpus
luteum either directly by increasing prostanoid production or
indirectly by increasing the blood flow to the ovary. | Introduction |
|---|
|
|
|---|
secretion by cultured endometrial
cells. Using Western blot analysis, a strong signal for cyclooxygenase
was seen shortly before luteolysis but only a weak or nonexistent
signal was found in proestrus endometrium.
LH/hCG receptors are present in the uteri of other species including
human (2), rat (3), rabbit (4), and pig (5, 6). They are also present
in the human placenta, fetal membrane, and decidua (2) and have been
characterized in human endometrial and myometrial vascular smooth
muscle (7). Furthermore, the endothelia of these blood vessels express
hCG/hLH receptor messenger RNA (mRNA) and immunoreactive receptor
protein (7) and contain high concentrations of cyclooxygenase in both
the human (7) and sheep (8). However, the presence of LH receptors has
not been reported for the bovine uterine veins. The bovine uterine vein
is physiologically important due to its proximity to the ovarian
artery, which allows the transfer of PGF2
by a
countercurrent mechanism (9).
Prostaglandins are produced by vascular tissue, and there is great
regional variability in this production (7, 10). Lacroix and Kann (11)
have suggested that prostaglandins produced by the vascular tissue
could play a role in the well documented rise in PGF2
seen in the uterine vein blood during proestrus (12). They found that
prostaglandin production by the ovine endometrium was lower on day
1617 (estrous) than on day 14 (late luteal). Similarly we have
reported that cyclooxygenase expression in the bovine uterus was lower
on day 1920 than on day 16 (13), and Basu and Kindahl (14) have
reported that the prostaglandin synthetic capacity of the bovine uterus
is much lower on the day of estrus than on day 14 or 17.
The present work was conducted to determine: 1) if the mRNA for LH receptor is expressed in the bovine uterine vein; 2) if the LH receptor is present in the uterine vein; 3) if exogenous LH can regulate the expression of cyclooxygenase in the uterine vein; and 4) if LH can regulate the release of prostaglandins of the cyclooxygenase pathway from uterine vein.
| Materials and Methods |
|---|
|
|
|---|
Incubation of tissues
Sections of uterine vein and artery about 4 cm in length were
taken at a distance of approximately 5 cm from the uterus where the
vein was in contact with the ovarian artery below the ovarian plexus
(9). Vascular tissues were minced with a scalpel and equal aliquots
(3050 mg) were incubated in wells containing 1.5 ml TCM-199 without
serum (Biological Industries, Beit Haemek, Israel) with one of the
following treatments: bLH (USDA bLH-I-1; 1.6 SI U/mg) 20 ng/ml (maximal
over range of 1100 ng/ml); mellitin (an activator of phospholipase
A2) 20 µg/ml (maximal over range of 140 µg/ml); IL-6,
50, 100, 200 ng/ml; tumor necrosis factor (TNF)-
300 pmol [TNF-
had no effect on PGF2
production by the uterine vein
over the range of 1 to 3000 pM; 300 pmol was used as this
dose induced maximal stimulation of PGF2
production by
granulosa cells (15)]; progesterone, 10 ng/ml, as it was inactive over
the range of 1100 ng, and 10 ng/ml represents the physiological
concentration of progesterone (luteal phase plasma concentration);
estrogen, 10 ng/ml (optimal over the range of 1 to 100 ng/ml) as it was
effective in increasing PGF2
production in some vein
preparations (3/9). All chemicals were purchased from Sigma Chemical
Co. (St. Louis, MO) unless otherwise noted. Samples were incubated in
quadruplicate for 3 or 6 h at 37 C under an atmosphere of 5%
CO2. Aliquots of 100 µl were taken at the end of the 3-h
incubation period for analysis of PGE2 and
PGF2
by RIAs as described below.
LH receptor gene expression
1) RNA isolation and RT-PCR
Total RNA was extracted (within 20 min after slaughter) with guanidine isothiocyanate-phenol-chloroform as described by Chirgwin et al. (16). RNA purity was determined by the A260/A280 ratio and its quality by agarose-formaldehyde gel electrophoresis.
2) Oligonucleotide primers for bovine LH receptor
For detecting the bovine LH receptor mRNA, a pair of primers,
20-mer each were selected from the Oligo program (Oligo R1 primer
analysis software, National Biosciences, Plymouth, MN). The
forward primer was a 20 mer oligonucleotide corresponded to
position 276295 (5'CACCCTCACAGTCATCACAC3') on the bovine LH receptor
mRNA.2 The reverse primer was a 21 mer
oligonucleotide complementary to position 808828
(5'CTCAGCAACAGAAAGAAATC3'). The predicted size of the RT-PCR product
was 552 bp. For internal control, a bovine ß-actin fragment that
consisted of 890 bp produced from an upper primer
(ACCAACTGGGACGACATGGAG; 21 mer) and a lower primer
(GCATTTGCGGTGGACAATGGA; 21 mer) was used (18). DNA was synthesized
using 2 µg total RNA, 12 U AMV reverse transcriptase (Promega,
Madison, WI) and 2 µg random primers. The negative control reaction
was identical to the above reaction, but no RNA was added. The cycling
parameters of the PCR were: 94 C for 45 sec, 52 C for 45 sec and 72 C
for 45 sec. The reaction was allowed to proceed for 35 cycles using 2 U
tag polymerase (Apligine) and 200 pmol of each primer. After
amplification, the samples were separated on a 1% agarose gel, stained
with ethidium bromide, and photographed under UV light. The 552-bp
fragment was extracted using Wizard PCR Preps Kit (Promega, Madison,
WI) and sequenced with the upper primer using an automatic sequencer
(Applied Biosystems, Foster City, CA).
Incubation of vascular tissues for Western blot analysis
Uterine vein and artery were excised and the endothelial layer
scraped off with a scalpel blade, minced finely, and 50 mg of the mince
was incubated in 1.5 ml of media for 15 h (maximal signal compared
with 3, 6, or 24 h). In some of the incubations, LH was added (20
ng/ml). At the end of the incubation, tissue homogenates were
centrifuged at 800 x g for 10 min and washed with 5 ml
cold saline. Tissues were then lysed in the lysing buffer which
contained 10 nmol/liter Tris-HCl, pH 7.5; 0.5 nmol MgCl2; 2
nmol EGTA, 1 nmol phenylmethylsulfonyl fluoride plus 1% NP-40 and
0.1% SDS. The lysate was incubated for 15 min on ice, sonicated, and
centrifuged (13,000 x g for 10 min). The supernatant
was stored at -70 C. Before analysis, extracts were heated (100 C for
10 min in the presence of SDS (0.2%).
Western blots
Vascular tissue extracts and bovine seminal vesicle soluble cell
extract (100 µg protein) were separated on SDS-PAGE and
electroblotted onto nitrocellulose paper (Amersham, Buckinghamshire,
UK) as previously described (19). The nitrocellulose paper was then
treated with either 1) rabbit anticyclooxygenase polyclonal antiserum
(19) (diluted 1:200 in washing buffer for 2.5 h at room
temperature or 2) antiserum for rat LH receptor (diluted 1:200; antirat
LH receptor - LHRO2; donation of Dr. D. Segaloff,
University of Iowa) (20). The nitrocellulose paper was then incubated
with horse radish peroxidase conjugated goat antirabbit IgG (Bio-Maker,
Rehovot, Israel; diluted 1:2000 in washing buffer) for 1 h at room
temperature. The presence of cyclooxygenase or LH receptor was then
visualized by means of a color reaction as follows: The nitrocellulose
paper was incubated in a substrate solution containing
3,3-diaminobenzidine (0.5 mg/ml, Sigma) in a mixture of PBS containing
0.5% CaCl2 and 6% H202. The
antibody for cyclooxygenase recognized both cyclooxygenase I (
69
kDa) and cyclooxygenase II 72 kDa (19). However, although
cyclooxygenase I was seen in seminal vesicle controls, it was not
present in sufficient quantities in the vein preparations to be
detected. The antibody to rat LH recognized both the mature (93 kDa)
and immature (73 kDa) forms of the LH receptor (20). The Densiometric
scans were obtained using a bioimaging system (B.I.S. 2020, Rhenium
Dingo, Jerusalem, Israel) and processed with the Tina 2.0 software
(Fuji, Japan).
RIA for prostaglandins E2 and F2
Aliquots of 100 µl were taken at the end of the incubation
period for specific RIA of PGE and PGF, which were performed without
chromatographic separation. The antiserum for PGF (Sigma Israel,
Rehovot, Israel) reacts preferentially with PGF2
but
cross-reacts with PGF1
(60%) and to a negligible extent
(0.1%) with prostaglandins of the A, B, and E series. The antiserum to
PGE reacts preferentially with PGE2 but cross-reacts with
PGA1, PGA2, PGF1,
PGF2
, and PGE1 (<10%) and to a negligible
extent with, PGB1 and PGB2 (<0.1%). The
within-assay coefficients of variation were 9 and 11% and the
between-assay coefficients of variance were 12 and 13% for
PGF2
and PGE assays, respectively. The sensitivity per
tube was 10 pg.
Statistical analysis
ANOVA was performed with a significance level of
P < 0.05. Data were further analyzed using Tukeys
procedure to assess significance between treatments. Data are reported
as means ± SEM.
| Results |
|---|
|
|
|---|
|
|
|
The nucleotide sequence of the 552-bp fragment obtained from the bovine
uterine vein receptor displayed a 99.8% homology with the comparable
region on the bovine corpus luteum LH receptor mRNA reported by
Lussier1 (Fig. 4
).
|
|
|
production by uterine vein preparations
Initially, the time course for vascular tissue prostaglandin production
was determined. Both PGE2 and PGF2
production by the vascular tissues increased linearly over 15 h of
culture. Uterine vein preparations produced 2.78 ± 0.43 and
4.35 ± 0.39 ng PGF2
/100 mg tissue (N = 10
cows) after 3 h and 6 h, respectively. The corresponding
values for PGE2 were 3.09 ± 0.38 and 5.59 ±
0.45 PGE2 ng/100 mg. The uterine artery preparations
produced 3.66 ± 0.31 ng/ml and 4.89 ± 0.21 ng/ml
PGF2
after 3 h and 6 h and 3.52 ± 0.41
and 5.69 ± 0.58 ng PGE2/ml, respectively.
Effect of LH and melittin on PGF2
production by
uterine vein in vitro
To determine if activation of cyclooxygenase by exogenous LH is
reflected in increased PGF2
or PGE2
production by the veins, vascular tissues were incubated with LH and
the prostaglandins determined. We also examined if activation of
phospholipase A2 by mellitin could cause increased
prostaglandins production by the uterine vein or artery.
Minces of uterine vein tissue from nine proestrous cows were incubated
in the presence or absence of LH or mellitin (Fig. 7
). Both mellitin and LH increased
PGF2
after 3 h and 6 h of incubation
(P < 0.05). No significant effect of LH or mellitin
was seen after 1 h of incubation, and no further stimulation was
seen at incubation times longer than 6 h (12, 15, or 24
h).
|
production by
uterine artery in vitro
production by the
uterine artery (Fig. 8
production after both 3 and 6 h of
incubation.
|
|
or PGE2 in any
vascular tissue tested (
Figs. 79
production in
3/9 preparations but overall had no significant effect.
Neither IL-6 or TNF-
significantly affected PGF2
production by uterine vein minces (control: 4.04 ± 0.89 ng/100
mg; N = 5 vs. 3.32 ± 0.53 for IL-6 and
3.42 ± 0.42 for TNF-
after 6 h of incubation). Similarly,
no effect of the two cytokines could be demonstrated on uterine
PGE2 or arterial PGF2
or PGE2
production (data not shown).
| Discussion |
|---|
|
|
|---|
Expression of LH receptor mRNA and the presence of LH receptor have been reported for human uterine arteries (7, 21). Furthermore, the authors reported that exogenous hCG can increase cyclooxygenase and the formation of vasoactive eicosanoids in the human uterine artery as determined by immunohistochemistry. Binding of labeled hCG has also been reported in the porcine uterine vein and artery (22) and in the vasculature of the bovine corpus luteum (23). Although in the pig vasculature, the concentration of binding sites increased during the luteal phase, no such changes in hCG/LH binding sites could be demonstrated in the bovine ovarian vessels.
Luteinizing hormone mRNA expression by vascular tissue
The nucleotide sequence homology between our RT-PCR product
consisting of 552 bp was 99.8% identical to the comparable region of
the bovine LH receptor, showing that our amplified cDNA was
complementary to the Bos taurus mRNA LH receptor at nucleotides
316780. The 552-bp cDNA was consistently present in RT-PCR treated
total RNA extracts of bovine corpus luteum and uterine vein of
proestrus/estrus. However, the 552-bp cDNA was not found in uterine
veins at other days of the cycle nor the uterine artery.
These results demonstrate the presence of functional LH receptor mRNA in the bovine uterine vein. The uterine vein LH receptor gene was homologous (99.8%) to the LH receptor gene present in the ovary. This suggests that both the extragonadal site and the CL have the same LH receptor gene and that they produce the same product. Furthermore, there is strong evidence that the LH receptor gene present in the uterine vein is physiologically functional as the uterine vein expressed an LH receptor protein of the same molecular weight as that found in the bovine corpus luteum.
Presence of LH receptor protein in vascular tissue
The specific antibody to rat LH receptor was prepared against the
N-terminal amino acid sequence (197207; LHRO2). This
antibody was used for Western blot analysis to detect the 93 kDa LH
receptor protein in both the bovine uterine vein and corpus luteum. The
size of the luteal LH receptor on our SDS gels appeared to be the same
as the uterine vein receptor, suggesting that the same form is present
on the cell surface of both tissues. However, in some preparations a
small 73-kDa band was observed. This may be the result of processing of
the mature receptor by proteolytic cleavage as suggested by Segaloff
for the two forms of the rat LH receptor (20).
A strong signal for the 93-kDa LH receptor was present in uterine vein extracts from estrus. However, there was only a weak signal during the luteal phase, and no detectable signal was seen in uterine veins from days 25 post ovulation. These data demonstrate a good correlation between the expression of the LH receptor mRNA and induction of the receptor at proestrus/estrus.
Induction of cyclooxygenase by LH in bovine uterine vein
The presence of the cyclooxygenase was demonstrated using an
antibody to ram seminal vesicle cyclooxygenase. Our antibody could
discriminate between cyclooxygenase I and II (19), but only
cyclooxygenase II was seen in vein preparations regardless whether LH
was present. This was not unexpected as in vivo
administration of hCG induces cyclooxygenase II but not cyclooxygenase
I in bovine preovulatory follicles (24). Similarly, we have reported
that LH stimulates primarily cyclooxygenase II in the bovine
endometrium (13).
LH caused more than a 2-fold increase in the expression of cyclooxygenase by uterine vein from proestrous cows. No stimulation of cyclooxygenase by LH was seen in uterine vein from luteal or postovulatory phase or in uterine artery from any stage of the cycle.
Effect of LH on prostaglandin production by vascular tissue
Activation of the PGF2
pathway simultaneously with
activation of PGE2 production by LH was tissue specific as
it was seen only in uterine vein and not in the uterine artery. This
effect was specific to bLH as activation of phospholipase
A2 by mellitin, which caused a significant increase in
PGF2
in both vein and artery, did not elevate
PGE2 in either tissue. Similarly, in a few preparations of
vein where a stimulatory effect of estradiol on PGF2
was
detected, PGE2 was not affected. Thus the stimulatory
effect of bLH on both PGF2
and PGE2 is
different from other hormonal regulators of the cyclooxygenase pathway
products. This increased prostaglandin production is presumably due to
a direct effect on cyclooxygenase as previously reported for the
endometrium (1). However in the endometrium only PGF2
production was stimulated by LH while both PGF2
and
PGE2 were stimulated by LH in the uterine vein. Tissue
specific response to stimulators of cyclooxygenase is not unusual in
the bovine reproductive tract as we have found that the principal
product of oxytocin stimulated prostaglandin production in the
endometrium is PGF2
, whereas the principal product in
the cervix is PGE (unpublished observations).
Extragonadal effects of LH
The hyperemic effect of LH on ovarian blood vessels was one of the
earliest reported effects of LH (25, 26). Subsequently it has been
established that LH increases ovarian blood flow in the human (27, 28),
rabbit (29, 30) and rat (31, 32, 33, 34). More recently, it has been shown that
LH/hCG receptors are present in a wide variety of tissues (fallopian
tube, myometrium, endometrium, chorion, amnion decidua, placenta,
umbilical cord (for review see Ref.35) and has been shown to have
physiological effects in these tissues.
Specifically in the vascular system, human uterine and umbilical
arteries but not placental vessels contain hCG receptors (21, 35). In
the human uterine artery, hCG was found to stimulate PGI2
and PGF2
but decreased production of PGE2
and TXA2. This may be related to the action of
PGI2 on dilating and PGE2 action in
constricting uterine blood vessels in humans (36, 37) and dogs (38).
The differential release of these compounds could therefore be related
to vasodilatory effect of LH on uterine vessels. The action of hCG on
human uterine artery is in contrast to our finding that LH had no
effect on bovine arterial production of prostanoids. This may reflect
the very different mechanisms for maternal recognition of pregnancy in
ruminants as opposed to primates.
Physiological significance of LH stimulation of uterine vein
prostanoids in the cow
The present experiments were conducted with uterine vein and
artery from proestrous cows. At the time of proestrus/estrus, the level
of cyclooxygenase in the endometrium is very low (1). However, during
ruminant proestrus/estrus, the concentration of PGF2
in
the uterine venous blood is substantial being about 13 ng/ml in the
cow (12) and about 67 ng/ml in the ewe (39, 40). Because LH does
increase cyclooxygenase and its products in the uterine vein during
proestrus/estrus, some of the prostaglandin measured in the uterine
venous blood at this time could well be the result of prostanoids
production within the vein itself.
An increase in eicosanoids during proestrus/estrus could play a role in
luteolysis by two mechanisms: 1) increasing blood flow in the
countercurrent plexus between the uterine artery and the ovarian vein
by PGE2; and 2) increasing the amount of the luteolytic
agent (PGF2
) reaching the corpus luteum. Other roles for
uterine venous PGE2 could be the softening of the cervix at
estrus or initiation of the preovulatory development of antral
follicles and the increase in estradiol secretion from the preovulatory
follicles. This later hypothesis is suggested by the finding of a
secondary LH peak at the time of luteolysis in the goat (41).
In this study, it was found that bovine uterine vein LH receptor mRNA levels and the level of LH receptor varied during the estrous cycle. Both the LH mRNA level and receptor concentration reached maximum levels concomitantly at proestrus/estrus. However, during the luteal phase, mRNA levels were not detectable and the receptor concentration was only minor compared with that seen at proestrus/estrus. The maximal expression of the receptor and its mRNA at proestrus/estrus correlated with the maximal effect of exogenous LH on the induction of cyclooxygenase and prostanoid production by the uterine vein tissue preparations.
Additional investigations of these relationships may prove important in the understanding of the mechanisms involved in LH receptor regulation in both the bovine endometrium and vein. This, in turn, could lead to the design of novel protocols to induce contraction of the uterus or regression of the corpus luteum.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Lussier, J. G., and A. Houde; GenBank accession
number U20504. ![]()
Received February 11, 1997.
| References |
|---|
|
|
|---|
. FEBS Lett 261:253255[CrossRef][Medline]
and its metabolites in uterine and jugular venous
plasma and endometrium of ewes during early pregnancy. J Anim Sci 45:320327
This article has been cited by other articles:
![]() |
M. J. Fields and M. Shemesh Extragonadal Luteinizing Hormone Receptors in the Reproductive Tract of Domestic Animals Biol Reprod, November 1, 2004; 71(5): 1412 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Danilovich, I. Roy, and M. R. Sairam Emergence of Uterine Pathology during Accelerated Biological Aging in FSH Receptor-Haploinsufficient Mice Endocrinology, September 1, 2002; 143(9): 3618 - 3627. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schuler, C. Wirth, U. Teichmann, K. Failing, R. Leiser, H. Thole, and B. Hoffmann Occurrence of Estrogen Receptor {alpha} in Bovine Placentomes Throughout Mid and Late Gestation and at Parturition Biol Reprod, April 1, 2002; 66(4): 976 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mizrachi and M. Shemesh Follicle-Stimulating Hormone Receptor and Its Messenger Ribonucleic Acid Are Present in the Bovine Cervix and Can Regulate Cervical Prostanoid Synthesis Biol Reprod, September 1, 1999; 61(3): 776 - 784. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |