help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carver, R. S.
Right arrow Articles by Russell, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carver, R. S.
Right arrow Articles by Russell, W. E.
Endocrinology Vol. 138, No. 12 5195-5201
Copyright © 1997 by The Endocrine Society

ARTICLES

Hepatic Expression of ErbB3 Is Repressed by Insulin in a Pathway Sensitive to PI-3 Kinase Inhibitors1

Robert S. Carver, Puthenpurackal M. Mathew and William E. Russell

Departments of Cell Biology (R.S.C., W.E.R.), Pediatrics (W.E.R., P.M.M.), and the Vanderbilt Cancer Center (W.E.R.), Vanderbilt University, Nashville, Tennessee 37232

Address all correspondence and requests for reprints to: Dr. William E. Russell, Division of Pediatric Endocrinology, T-0101 Medical Center North, Vanderbilt University, Nashville, Tennessee 37232-2579. E-mail: bill.russell{at}mcmail.vanderbilt.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ErbB3 is an epidermal growth factor receptor-related type I tyrosine kinase receptor capable, in conjunction with ErbB2 or epidermal growth factor receptor, of transmitting proliferative and differentiative signals in a variety of cell types. We previously showed that ErbB3 messenger RNA and protein increase in cultured hepatocytes during the first 12 h in culture, as does the binding of heregulin ß1, a ligand for ErbB3. Insulin inhibits the increase in heregulin ß1 binding, as well as the increase in ErbB3 messenger RNA and protein. Two models of insulin deficiency in vivo (diabetes and fasting) demonstrated elevated levels of hepatic ErbB3 protein, strengthening the relevance of our observations in vitro. Using chemical activators or antagonists, we sought to identify the signaling pathways that link insulin to ErbB3 expression. The PI-3 kinase inhibitors, wortmannin and LY294002, completely blocked the inhibition of ErbB3 protein expression by insulin, suggesting a role for PI-3 kinase in the regulation of this growth factor receptor. Rapamycin, an inhibitor of p70 S6 kinase, an enzyme downstream of PI-3 kinase, failed to block the effect of insulin on ErbB3 expression. These results suggest a complex regulatory paradigm for ErbB3 that includes PI-3 kinase and may be linked, via insulin, to the metabolic status of the animal.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
WE RECENTLY reported that ErbB3 is the primary heregulin (HRG) binding site in rat hepatocytes and that insulin inhibits the spontaneous increase in both HRG binding and ErbB3 protein that occurs in these cells during the first 12 h in culture (1). The four ErbB proteins are a family of transmembrane kinase receptors that include the epidermal growth factor (EGF) receptor (EGFr) and are capable of transducing both growth and differentiative signals in various cell types (2). The HRGs, also called neu differentiation factors (NDF) or neuregulins, are epidermal growth factor-related ligands for ErbB3 and ErbB4 (3) but not ErbB2 or EGFr. ErbB2, which has no clearly defined ligand, plays a role in signaling by both HRG and members of the EGF family by forming heterodimers with ErbB3, ErbB4, or EGFr (4). ErbB3 lacks intrinsic kinase activity because of substitutions in its catalytic domain (5, 6) but is capable of activating numerous signaling pathways when transactivated by other ErbB receptors. Biologic activities associated with ErbB3 signaling include: 1) mammary epithelial (7, 8) and breast tumor cell (9, 10, 11) growth; 2) breast tumor (12, 13, 14, 15) and muscle cell differentiation (12, 13, 14, 15, 16); 3) Schwann cell precursor proliferation, maturation and survival (17, 18, 19); and 4) proliferation and survival of keratinocytes in vitro (20). However, in liver, HRG-mediated ErbB3 activation has only a modest effect on proliferation (1), and the spectrum of physiological effects resulting from ErbB3 signaling is unknown.

Portal blood-derived insulin is a mitogen for hepatocytes, acting synergistically with glucagon, EGF, and other peptide growth factors to stimulate DNA synthesis (21, 22). Physiologic concentrations of insulin fluctuate according to the metabolic state of the animal and are known to induce or repress hepatic genes (23). In addition to the known targets of insulin receptor signaling (24), the regulation of growth factor receptors, such as ErbB3, may represent an additional mechanism of insulin action. The insulin-activated pathways involved in regulating ErbB3 are not known, and the resultant diminished signaling by ErbB3 may be part of the mechanism by which insulin regulates growth or metabolic functions in the liver. In this study, we confirmed the inhibitory effect of insulin on hepatic ErbB3 expression in an animal model of insulin deficiency and sufficiency and explored a number of insulin-mediated second-messenger pathways to better understand the regulation of ErbB3 by insulin.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents, radiopeptides, and antibodies
Human recombinant insulin was from Eli Lilly & Co. (Indianapolis, IN). Wortmannin, LY294002, and rapamycin were from Biomol (Plymouth Meeting, PA). Streptozotocin (STZ), N6, 2'-0-dibutyryl cAMP (dbcAMP), and phorbol 12-myristate 13-acetate (PMA) were from Sigma (St. Louis, MO). Anti-ErbB3 antibodies were from Santa Cruz (Santa Cruz, CA). Protein G-sepharose was from Pierce (Rockford, IL). ECL reagents were from Amersham (Arlington Heights, IL). Human recombinant HRG ß1 (HRGß1) was prepared, as described, and iodinated to a specific activity of 250–300 µCi/µg by the lactoperoxidase method (9). This protein corresponds to the EGF domain of the mature secreted form of HRGß1, amino acids 177–244. Avian myeloblastosis virus-reverse transcriptase (AMV-RT) and Taq polymerase were from Promega.

Culture media and supplies
Williams’ Medium E, supplemented with 20 mM pyruvate, 10 nM dexamethasone, and 50 µg/ml gentamycin, was the medium used for all in vitro studies. Medium and calf serum were purchased from Life Technologies, Inc. (Gaithersburg, MD). Type I collagenase was from Waco Pure Chemical Industries Ltd. (Richmond, VA), and Falcon six-well culture dishes were from Fisher (Pittsburgh, PA).

Animals
Male Sprague-Dawley rats (150–200 g) from Harlan Sprague-Dawley (Indianapolis, IN) were housed under conditions of regulated environment and lighting (lights on 0600 h–1800 h) and ad libitum access to water and Purina rodent chow (Ralston-Purina, St. Louis, MO). Diabetic rats were generated by a single ip STZ injection (65 mg/kg). Blood glucose levels were monitored using a One Touch Glucose meter (Lifescan, Milpitas, CA). A subset of diabetic animals received 3–15 U of Ultralente insulin sc once daily until blood glucose levels were 200 mg/dl or less. After 8 days, the animals in each group were killed and their livers harvested and analyzed as described below. In a separate study, 8 rats were fasted for 48 h and killed. Age-matched animals were used for baseline measurements in all experiments. All protocols were approved in advance by the Animal Use Subcommittee of the Vanderbilt Animal Care Committee.

Primary culture of hepatocytes
Hepatocytes were isolated from the livers of 175- to 250-g male Sprague-Dawley rats (Harlan) with modifications of our previously described methods (25). The livers of ether-anesthetized rats were perfused through the portal vein with a calcium-free solution consisting of 150 mM NaCl, 2.8 mM KCl, 5.5 mM glucose, and 25 mM HEPES (pH 7.6) for 10 min, followed by the same solution containing 3.8 mM CaCl2, 10 µg/ml soybean trypsin inhibitor, and 0.5 mg/ml collagenase type I. The cells were dispersed in medium supplemented with 10% calf serum and filtered through 61-µm nylon mesh. The hepatocytes were then purified by a 5 min of sedimentation at 1 x g in serum-containing medium followed by centrifugation at 50 x g in isotonic percoll (specific gravity = 1.06) to reduce contamination by nonparenchymal cells (26). Percoll was removed by two washes in serum-containing medium, and the hepatocytes were assessed for viability by trypan blue exclusion (>95% viable). Cells (375,000 cells/well) were plated in type-1 collagen-coated 35-mm wells. After a 30 min attachment period, the serum-containing medium was replaced with 1.5 ml of serum-free medium containing growth factors as indicated.

Chemical treatment, immunoprecipitation, and Western blotting
Chemicals tested for their ability to block the effect of insulin on ErbB3 expression, were added to the cultures 15 min before exposure to insulin. The cells were incubated for 12 h at 37 C before harvesting. Because of the instability of wortmannin and LY294002 in vitro (27), these drugs were re-added every 2 h in 5 µl dimethyl sulfoxide. Control cultures were exposed to dimethyl sulfoxide only. After treatment, liver tissue or cultured hepatocytes were lysed in TGH (20 mM HEPES, 1% Triton X-100, 10% glycerol, 50 mM NaCl) as described (1), normalized for protein content, and immunoprecipitated overnight at 4 C with antibodies directed against ErbB3. Complexes were precipitated for 2 h at 4 C with protein G-sepharose (Pierce). Pellets were washed four times with TGH at room temperature, raised to 20 µl in 1x SDS-gel sample buffer, and heated to 95 C for 5 min. Supernatants were loaded in a 6% SDS-polyacrylamide gel and electrophoresed. Resolved proteins were then electrotransferred onto nitrocellulose membranes and blotted with ErbB3 antibodies. Immunoreactive species were detected using the ECL method (Amersham) and exposed to x-ray film for radiography. Films were scanned on a IS-1000 digital densitometer for quantification (Alpha Innotec Corp., San Leandro, CA).

RT-PCRs
Five micrograms of total RNA, extracted from treated cultures of hepatocytes, was used to synthesize complementary DNA (cDNA) in a 20-µl reaction vol using AMV-RT. One microliter of these reactions was then used in PCR reactions with ErbB3-specific or ß-actin-specific primers (as a control). ErbB3 and ß-actin sense primers were 5'-CTCCCGTCCCATCTCTCTGC-3' and 5'-CATCGTGGGCCGCCCTAGGC-3', respectively. Antisense primers were 5'-TCGAAGGCAGAGTCGGT-GGC-3' and GGCCAGCCAGGTCCAGACGC, respectively. Annealing conditions were 64 C/30 sec for both primer sets, and polymerization time was 30 sec. Cycle number was titered in each experiment to amplify only from the largest pool of ErbB3 cDNA. PCR products were resolved by electrophoresing 50% of the reaction volume in a 1% agarose gel and visualizing with ethidium bromide staining.

Statistical analysis
Statistical analysis was performed using an unpaired, two-tailed Student’s t test assuming equal variances between compared groups.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Regulation of ErbB3 in rat liver cells in vitro and in vivo
After isolation and culture for 12 h, total protein levels of hepatocyte ErbB3 receptor increased 5.3-fold (±2.2) above those at the time of plating (Fig. 1AGo). In the presence of insulin, ErbB3 protein levels at 12 h remained within 2% (±0.5%) of those at the time of plating. Our previous studies demonstrated that the binding of [125I]HRGß1 to freshly cultured hepatocytes increases with similar kinetics and also is inhibited by insulin (1). Analyzing ErbB3 messenger RNA (mRNA), using Northern analysis, was unsuccessful; therefore, semiquantitative RT-PCR was used. Though less quantitative than Northern blotting, this method gave reproducible results when the number of cycles was titrated to amplify ErbB3 mRNA only from the largest message pool. As shown in Fig. 1BGo, the observed changes in ErbB3 protein paralleled changes in ErbB mRNA.



View larger version (49K):
[in this window]
[in a new window]
  		Figure 1. Effect of insulin on ErbB3 expression in cultured rat hepatocytes. A, ErbB3 protein was immunoprecipitated from freshly isolated hepatocytes, or from cells cultured 12 h with or without 150 nM insulin. Immune complexes were electrophoresed and blotted with the same antibody used for immunoprecipitation. Densitometric analysis was performed on data from three separate hepatocyte preparations. Shown is a representative gel. The mean increase in ErbB3 protein in the absence of insulin was 5.3 ± 2.2-fold, P < 0.01 (vs. time 0); with insulin, 1.3 ± 0.5-fold, P < 0.05 (vs. time 0); n = 3. B, Total RNA was purified from identically treated hepatocytes for RT-PCR analysis using primers specific for ErbB3 or ß-actin (as a control). PCR cycle number was titered to amplify ErbB3 cDNA only from the largest mRNA pool. Shown is a representative gel from three hepatocyte preparations.

 
To determine if physiologic regulation of insulin levels would influence ErbB3 expression in vivo, two methods of insulin manipulation were used: diabetes and fasting. The mean blood glucose of normal rats was: 96 ± 14, n = 4; of diabetic rats: 355 ± 56, n = 3, P < 0.05 (vs. insulin-treated); and of insulin-treated diabetic rats at sacrifice: 90 ± 88, n = 3, P < 0.05 (vs. untreated). As shown in Fig. 2Go, diabetic rats had significantly higher (P < 0.01) ErbB3 protein levels than baseline. When diabetic rats were treated with doses of insulin sufficient to restore normal blood glucose levels, ErbB3 expression was repressed to baseline levels (P < 0.01). Fasted rats also demonstrated significantly higher ErbB3 protein levels than did control rats (P < 0.01). These results strongly suggest that hepatic expression of ErbB3 protein is regulated by physiologic changes in plasma insulin levels.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. Effect of physiologic insulin levels on hepatic ErbB3 expression in vivo. Hepatic ErbB protein levels were analyzed in normal, diabetic, insulin-treated diabetic, and fasted rats by immunoprecipitation/Western blotting with anti-ErbB3 antibody. Each band corresponds to an individual rat. Densitometric analysis was used for statistical analysis and to generate graph. *, P < 0.01 (vs. baseline); **, P < 0.01 (vs. diabetic). Data are means ± SD.

 
Effect of intracellular cAMP levels and protein kinase C (PKC) activation on the regulation of ErbB3 expression by insulin in vitro
Stimulation of hepatocytes with insulin leads to diminished cAMP levels in vitro (28, 29) and may be a mechanism by which insulin regulates other genes. We questioned whether elevated cAMP levels would interfere with the inhibitory effect of insulin on ErbB3 expression. Fig. 3Go, A and B, shows that treatment with 5 µM dibutyryl cAMP failed to inhibit the effect of insulin on ErbB3 protein expression. Other methods of elevating hepatocyte cAMP levels [activation of adenyl cyclase by glucagon (30), inhibition of cAMP phosphodiesterase by isobutylmethylxanthine, and activation of the Gs subunit of the heterotrimeric G protein complex by cholera toxin] also failed to block the inhibition of ErbB3 protein up-regulation or [125I]-HRGß1 binding by insulin (data not shown).



View larger version (40K):
[in this window]
[in a new window]
  		Figure 3. Effect of 5 µM dibutyryl cAMP, 100 nM PMA, and 300 nM rapamycin on insulin inhibition of ErbB3 protein expression and 125I-HRGß1 binding in cultured hepatocytes. A, ErbB3 protein was immunoprecipitated from freshly isolated hepatocytes, or from cells cultured 12 h with or without 150 nM insulin and the indicated drug. Immune complexes were electrophoresed and blotted with the same antibody used for immunoprecipitation. Shown is a representative gel. Densitometric analysis was performed on data from three separate hepatocyte preparations to generate B. {diamond}, P < 0.01 (vs. baseline); *, P < 0.05 (vs. 12-h control); **, P < 0.05 (vs. drug alone and 12-h control). C, After 12 h in culture, triplicate dishes of cells, treated as indicated, were chilled to 4 C and incubated 4 h with 1.5 nM 125I-HRGß1 with or without a 200-fold excess of unlabeled HRGß1 to correct for nonspecific binding. After incubation, cells were washed and lysed, and cell-associated radioactivity was quantified by {gamma}-counter. Data are means ± SD from triplicate dishes from a single hepatocyte preparation.

 
PKC is a signaling pathway activated in hepatocytes by insulin treatment (31). Phorbol esters, such as PMA, are diacylglycerol (DAG) analogs that bind to and activate conventional and novel isoforms of PKC in the absence of ligand-bound receptors (32, 33). To investigate the involvement of PKC in the regulation of ErbB3 by insulin, cells were treated with 100 nM PMA for 12 h, lysed, and immunoprecipitated with anti-ErbB3 antibodies. As shown in Fig. 3Go, A and B, treatment with 100 nM PMA did not inhibit ErbB3 protein up-regulation, nor did it interfere with the repression of ErbB3 by insulin. Treatment with PMA for 12 h also failed to inhibit the effect of insulin on HRGß1 binding (Fig. 3CGo). Because insulin is known to induce PKC activity in these cells (31, 34), the data indicate either that PKC is not involved in regulating ErbB3 or that it activates isoforms insensitive to PMA. These results suggest that the inhibition of ErbB3 expression in vitro by insulin does not involve regulation of intracellular cAMP levels or modulation of PMA-sensitive PKC activity.

Role of PI-3 kinase in the regulation of ErbB3 expression by insulin in vitro
Phosphatidylinositol (PtdIns) 3-kinase, which is activated by the insulin receptor, can be specifically inhibited by the drugs, wortmannin (35) or LY294002 (36), which respectively bind to (covalently) or compete for the ATP binding site in the catalytic domain of the kinase. To test whether activation of PI-3 kinase is required for insulin to repress ErbB3 expression, control and insulin-treated cultures of freshly plated hepatocytes were incubated alone or with the indicated concentrations of PI-3 kinase inhibitor for 12 h. Treatment with either inhibitor completely blocked the effect of insulin on ErbB3 protein expression (Fig. 4Go, A and B). ErbB3 mRNA up-regulation was not inhibited by insulin in the presence of LY294002 (Fig. 5Go). Treatment with wortmannin completely blocked the effect of insulin on HRGß1 binding (Fig. 4CGo), consistent with its effect on ErbB3 protein expression. The sensitivity to these inhibitors strongly suggests that PI-3 kinase activation is required for insulin to repress ErbB3 expression in hepatocytes.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 4. Effect of wortmannin and LY294002 on insulin inhibition of ErbB3 protein expression and 125I-HRGß1 binding in cultured hepatocytes. A, ErbB3 protein was immunoprecipitated from freshly isolated hepatocytes, or from cells cultured 12 h with or without 150 nM insulin and the indicated drug. Immune complexes were electrophoresed and blotted with the same antibody used for immunoprecipitation. Shown is a representative gel. Densitometric analysis was performed on data from three hepatocyte preparations to generate B. *, P < 0.01 (vs. 12-h control); **, P < 0.02 (vs. insulin). C, After 12 h in culture, triplicate dishes of cells, treated as indicated, were chilled to 4 C and incubated 4 h with 1.5 nM 125I-HRGß1 with or without a 200-fold excess of unlabeled HRGß1 to correct for nonspecific binding. After incubation, cells were washed and lysed and cell-associated radioactivity was quantified by {gamma}-counter. Data are means ± SD from triplicate dishes from a single hepatocyte preparation.

 


View larger version (38K):
[in this window]
[in a new window]
  		Figure 5. Effect of LY294002 on insulin inhibition of ErbB3 mRNA expression. Total RNA was extracted from freshly isolated hepatocytes and cells cultured 12 h with or without insulin and the indicated drug. Five micrograms of RNA was used for RT-PCR analysis using primers specific for ErbB3 or ß-actin (as a control). PCR cycle number was titered to amplify ErbB3 cDNA only from the largest pools of mRNA. Shown is a gel representative of experiments from three separate hepatocyte preparations.

 
Role of p70 S6 kinase in the regulation of ErbB3 in rat hepatocytes in vitro
In the insulin receptor transduction cascade, activation of p70 S6 kinase is downstream of PI-3 kinase, and previous reports have indicated that inhibition of PI-3 kinase with LY294002 blocks the insulin-induced activation of p70 S6 kinase in 3T3 L1 adipocytes (37). To determine whether p70 S6 kinase activity is involved in the regulation of ErbB3 by insulin, control and insulin-treated hepatocytes were incubated 12 h with or without 300 nM rapamycin, a specific inhibitor of this kinase (38). As shown in Fig. 3Go, rapamycin neither blocked nor mimicked the effect of insulin on ErbB3 protein expression, suggesting that p70 S6 kinase is not a component of the insulin-mediated signaling pathway regulating ErbB3 expression.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
ErbB3 is an HRG receptor that we previously showed to be the primary HRG-binding protein in adult rat hepatocytes and whole liver (1). Because of inactivating substitutions in its tyrosine kinase domain (5, 6), ErbB3 is unlikely to initiate intracellular signaling on its own. However, in conjunction with EGFr or ErbB2, neither of which bind HRG, ErbB3 has been shown to elicit both differentiative and growth responses. In freshly plated hepatocytes, HRG binding and ErbB3 protein levels spontaneously increase about 5-fold, and this increase is inhibited by insulin (1).

Physiological alterations in insulin concentration can regulate hepatic ErbB3 protein levels in vivo, as evidenced in fasted rats, or in rats made diabetic with STZ. In both cases, ErbB3 protein levels were significantly higher than baseline. A hepatotoxic effect of STZ on ErbB3 expression was ruled out by the observation that insulin reversed the effect of diabetes. The effects on ErbB3 expression are in contrast to those observed for EGFr, where the tyrosine kinase activity and the number of EGF binding sites are reduced in fasted and diabetic liver membranes without changes in binding affinity (39, 40). In the case of diabetic liver, the effects on EGFr can be partially restored by insulin treatment (40). The present study focuses on selected insulin-activated signaling pathways to begin to elucidate the mechanism by which insulin or other factors regulate ErbB3 expression.

Through its inhibitory actions on hepatocyte adenylate cyclase (28) and its stimulatory actions on cAMP phosphodiesterase (29), insulin decreases intracellular cAMP concentrations. Dibutyryl cAMP (dbcAMP) is a nonhydrolyzable form of cAMP that is cell membrane permeable and can simulate elevated levels of this second messenger in vitro (41). Western blot analysis of hepatocyte cultures treated with dbcAMP and other agents that elevate intracellular cAMP levels showed that these agents did not block the inhibitory effect of insulin on ErbB3 protein expression, suggesting that the mechanism by which insulin regulates ErbB3 expression in hepatocytes either does not involve alterations in cAMP levels or requires other activities in conjunction with inhibition of adenylate cyclase.

Signaling by the insulin receptor leads to diacylglycerol (DAG) synthesis from phosphatidic acid (42), or inositol-containing glycolipids (43). DAG and certain synthetic analogs, such as phorbol myristic acid (PMA), subsequently activate a subset of PKC isoforms (33) and can mimic certain insulin actions in cultured hepatocytes while inhibiting others. Like insulin, PMA stimulates glycolysis, amino acid uptake, and glycogenesis, and antagonizes glucagon-mediated activation of phosphoenolpyruvate carboxykinase (PEPCK) in cultured rat hepatocytes (34). In vitro stimulation for 24 h or more with higher doses of PMA will down-regulate PKC activity in this and other cell types (44). However, our cultures were exposed to PMA no longer that 12 h, and any insulin-mimetic actions of that agent would have been manifested within the first 4–8 h, the period during which insulin-induced repression of ErbB3 occurs. The observation that 12 h of exposure to 100 nM PMA did not block the spontaneous up-regulation of ErbB3 or the inhibitory effect of insulin on ErbB3 expression and HRGß1 binding suggests that the PKC isoforms that are sensitive to activation by PMA are not involved in regulating ErbB3. Atypical PKC isoforms, such as PKC-{zeta}, are activated by insulin but not by PMA (45). Specific PKC inhibitors (32, 46) in the presence of insulin may help to further elucidate the role of this enzyme in ErbB3 regulation.

A second phosphoinositide pathway, activated by insulin, involves PtdIns 3-kinase. Upon autophosphorylation, docking sites form on the insulin receptor that bind SH2 domain-containing proteins such as insulin substrate-1 or -2. This, in turn, allows for the recruitment and activation of the 85 kDa/110 kDa complex of PtdIns 3-kinase (47). The activated enzyme is capable of phosphorylating PtdIns, PtdIns-4 phosphate, or PtdIns-4,5 biphosphate on the D3 position (48). This leads to the formation of PtdIns-3 phosphate, PtdIns-3,4 biphosphate, or PtdIns-3,4,5 triphosphate, respectively. The activity of PI-3 kinase can be selectively inhibited in vitro by the drugs, wortmannin (35) or LY294002 (36), and both of these drugs blocked insulin-mediated inhibition of ErbB3 protein expression. Wortmannin also blocked the inhibitory effect of insulin on HRGß1 binding. These results strongly suggest that in the context of insulin signaling, the insulin-mediated inhibition of ErbB3 up-regulation in hepatocytes requires activation of PI-3 kinase. Although specific functions of the products of PI-3 kinase are largely unknown, they may involve activating other kinases such as PKB, PKC-{zeta} (45), (Akt/Rac) (49), or other SH2-containing enzymes, such as pp60src (50).

Activation of p70 S6 kinase in insulin-responsive cells, such as 3T3 L1 adipocytes, has been shown to be downstream of PI-3 kinase (37) and, therefore, may be important in propagating the insulin signal to inhibit ErbB3. This kinase is responsible for the insulin- and growth factor-stimulated phosphorylation of ribosomal protein S6 in vivo (51); and this, in turn, may result in increased translation from specific polypyrimidine-containing mRNAs (52, 53). Having shown that PI-3 kinase activity was required for insulin to regulate ErbB3 expression, we tested the hypothesis that p70 S6 kinase activity is the next step in the cascade of reactions involved in the regulation of ErbB3 expression by insulin. Rapamycin, an immunosuppressant known to inhibit p70 S6 kinase activity in T cells (54), was used to test the role of this enzyme in ErbB3 regulation. Treatment with rapamycin did not mimic, nor did it interfere with, the effect of insulin on ErbB3 expression suggesting that once insulin activates PI-3 kinase, the signaling pathway regulating ErbB3 diverges from p70 S6 kinase. This is consistent with observations regarding insulin regulation of hexokinase II and PEPCK in liver, where hexokinase II is inhibited by wortmannin and rapamycin (55), whereas PEPCK is only inhibited by wortmannin (56).

The purpose of this study was to examine insulin-mediated pathways that lead to the inhibition of ErbB3 expression in cultured hepatocytes. Though many insulin actions have been shown to be mediated through PI-3 kinase (24), the insulin-mimetic activity of phorbol esters (34) and the influence of insulin on intracellular cAMP levels warrant their investigation as well. We showed that elevated cAMP levels and phorbol ester-mediated activation of conventional PKC isoforms are not directly involved in the regulation of ErbB3 by insulin in cultured hepatocytes. We also showed that the insulin-mediated inhibition of ErbB3 expression is sensitive to two PI-3 kinase inhibitors, wortmannin and LY294002, suggesting that PI-3 kinase activity is required for ErbB3 repression. However, one target of PI-3 kinase activation, p70 S6 kinase, does not seem to be required for propagating the insulin signal to inhibit ErbB3. The physiologic relevance of our observations in cultured hepatocytes is strengthened by the demonstration of increased hepatic ErbB3 levels in two models of insulin deficiency in vivo. We speculate that the expression, and thus the signaling of ErbB3, can be regulated by physiologic changes in hepatic insulin levels, and indirectly by metabolic status. Because of cross-talk between receptor family members, changes in ErbB3 expression levels could affect signaling pathways used by both HRGs and EGFr ligands. The resultant signaling pattern may reflect the needs of this tissue under differing metabolic states. Further studies may elucidate the interactions between insulin action, nutritional status, and proliferative or differentiating signals in liver. They may have particular relevance to the diabetic state.


   Acknowledgments
 
The authors would like to thank Dr. Ian Burr for his support and encouragement. The authors would also like to thank Dr. Mark Sliwkowski, Genentech Inc., for the [125I]-HRGß1, and Drs. Lucy Liaw and Richard O’Brien for their critical reviews of this manuscript.


   Footnotes
 
1 This work was supported by NIH Grant DK-44557 (to W.E.R.) and by a Student Research Fellowship from the American Liver Foundation (to R.S.C.). Back

Received June 25, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Carver RS, Sliwkowski MX, Sitaric S, Russell WE 1996 Insulin regulates heregulin binding and ErbB3 expression in rat hepatocyes. J Biol Chem 271:13491–13496[Abstract/Free Full Text]
  2. Prigent SA, Lemoine NR 1992 The type 1 (EGFR-related) family of growth factor receptors and their ligands. Prog Growth Factor Res [Review]4:1–24
  3. Carraway III KL, Cantley LC 1994 A neu acquaintance for erbB3 and erbB4: a role for receptor heterodimerization in growth signaling. Cell [Review]78:5–8
  4. Sliwkowski MX, Schaefer G, Akita RW, Lofgren JA, Fitzpatrick VD, Nuijens A, Fendly BM, Cerione RA, Vandlen RL, Carraway KL 1994 Coexpression of erbB2 and erbB3 proteins reconstitutes a high affinity receptor for heregulin. J Biol Chem 269:14661–14665[Abstract/Free Full Text]
  5. Plowman GD, Whitney GS, Neubauer MG, Green JM, McDonald VL, Todaro GJ, Shoyab M 1990 Molecular cloning and expression of an additional epidermal growth factor receptor-related gene. Proc Natl Acad Sci USA 87:4905–4909[Abstract/Free Full Text]
  6. Kraus MH, Issing W, Miki T, Popescu NC, Aaronson SA 1989 Isolation and characterization of ERBB3, a third member of the ERBB/epidermal growth factor receptor family: evidence for overexpression in a subset of human mammary tumors. Proc Natl Acad Sci USA 86:9193–9197[Abstract/Free Full Text]
  7. Marte BM, Graus-Porta D, Jeschke M, Fabbro D, Hynes NE, Taverna D 1995 NDF/heregulin activates MAP kinase and p70/p85 S6 kinase during proliferation or differentiation of mammary epithelial cells. Oncogene 10:167–175[Medline]
  8. Ram TG, Kokeny KE, Dilts CA, Ethier SP 1995 Mitogenic activity of neu differentiation factor/heregulin mimics that of epidermal growth factor and insulin-like growth factor-I in human mammary epithelial cells. J Cell Physiol 163:589–596[CrossRef][Medline]
  9. Holmes WE, Sliwkowski MX, Akita RW, Henzel WJ, Lee J, Park JW, Yansura D, Abadi N, Raab H, Lewis GD, Shepard HM, Kuang W, Wood WI, Goeddel DV, Vandlen RL 1992 Identification of heregulin, a specific activator of p185erbB2. Science 256:1205–1210[Abstract/Free Full Text]
  10. Graus-Porta D, Beerli RR, Hynes NE 1995 Single-chain antibody-mediated intracellular retention of ErbB-2 impairs Neu differentiation factor and epidermal growth factor signaling. Mol Cell Biol 15:1182–1191[Abstract]
  11. Pietras RJ, Arboleda J, Reese DM, Wongvipat N, Pegram MD, Ramos L, Gorman CM, Parker MG, Sliwkowski MX, Slamon DJ 1995 HER-2 tyrosine kinase pathway targets estrogen receptor and promotes hormone-independent growth in human breast cancer cells. Oncogene 10:2435–2446[Medline]
  12. Bacus SS, Huberman E, Chin D, Kiguchi K, Simpson S, Lippman M, Lupu R 1992 A ligand for the erbB-2 oncogene product (gp30) induces differentiation of human breast cancer cells. Cell Growth Differ 3:401–411[Abstract]
  13. Bacus SS, Gudkov AV, Zelnick CR, Chin D, Stern R, Stancovski I, Peles E, Ben-Baruch N, Farbstein H, Lupu R, Wen D, Sela M, Yarden Y 1993 Neu differentiation factor (heregulin) induces expression of intercellular adhesion molecule 1: implications for mammary tumors. Cancer Res 53:5251–5261[Abstract/Free Full Text]
  14. Peles E, Bacus SS, Koski RA, Lu HS, Wen D, Ogden SG, Ben Levy R, Yarden Y 1992 Isolation of the Neu/Her2 stimulatory ligand: a 44-kd glycoprotein that induces differentiation of mammary tumor cells. Cell 69:205–216[CrossRef][Medline]
  15. Wen D, Peles E, Cupples R, Suggs SV, Bacus SS, Luo Y, Trail G, Hu S, Silbiger SM, Ben Levy R, Koski RA, Lu HS, Yarden Y 1992 Neu differentiation factor: a transmembrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell 69:559–572[CrossRef][Medline]
  16. Falls DL, Rosen KM, Corfas G, Lane WS, Fischbach GD 1993 ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family. Cell 72:801–815[CrossRef][Medline]
  17. Marchionni MA, Goodearl ADJ, Chen MS, Bermingham-McDonogh O, Kirk C, Hendricks M, Danehy F, Misumi D, Sudhalter J, Kobayashi K, Wroblewski D, Lynch C, Baldassare M, Hiles I, Davis JB, Hsuan JJ, Totty NF, Otsu M, McBurney RN, Waterfield MD, Stroobant P, Gwynne D 1993 Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system. Nature 362:312–318[CrossRef][Medline]
  18. Levi ADO, Bunge RP, Lofgren JA, Meima L, Hefti F, Nikolics K, Sliwkowski MX 1995 The influence of heregulins on human Schwann cell proliferation. J Neurosci 15:1329–1340[Abstract]
  19. Dong Z, Brennan A, Liu N, Yarden Y, Lefkowitz G, Mirsky R, Jessen KR 1995 Neu differentiation factor is a neuron-glia signal and regulates survival, proliferation, and maturation of rat Schwann cell precursors. Neuron 15:585–596[CrossRef][Medline]
  20. Marikovsky M, Lavi S, Pinkas-Kramarski R, Karunagaran D., Liu N, Wen D, Yarden Y 1995 ErbB-3 mediates differential mitogenic effects of NDF/heregulin isoforms on mouse keratinocytes. Oncogene 10:1403–1411[Medline]
  21. Richman RA, Claus TH, Pilkis SJ, Friedman DL 1976 Hormonal stimulation of DNA synthesis in primary cultures of adult rat hepatocytes. Proc Natl Acad Sci USA 73:3589–3593[Abstract/Free Full Text]
  22. McGowan JA, Strain AJ, Bucher NLR 1981 DNA synthesis in primary cultures of adult rat hepatocytes in a defined medium: effects of epidermal growth factor, insulin, glucagon, and cyclic-AMP. J Cell Physiol 108:353–363[CrossRef][Medline]
  23. O’Brien RM, Granner DK 1996 Regulation of gene expression by insulin. Physiol Rev 76:1109–1161[Abstract/Free Full Text]
  24. Cheatham B, Kahn CR 1995 Insulin action and the insulin signaling network. Endocr Rev [Review]16:117–142
  25. Russell WE 1988 Transforming growth factor beta (TGF-beta) inhibits hepatocyte DNA synthesis independently of EGF binding and EGF receptor autophosphorylation. J Cell Physiol 135:253–261[CrossRef][Medline]
  26. Kreamer BL, Staecker JL, Sawada N, Sattler GL, Hsia MT, Pitot HC 1986 Use of a low-speed, iso-density percoll centrifugation method to increase the viability of isolated rat hepatocyte preparations. In Vitro Cell Dev Biol 22:201–211[Medline]
  27. Woscholski R, Kodaki T, Mckinnon M, Waterfield MD, Parker PJ 1994 A comparison of demethoxyviridin and wortmannin as inhibitors of phosphatidyl 3-kinase. FEBS Lett 342:109–114[CrossRef][Medline]
  28. Heyworth CM, Houslay MD 1983 Insulin exerts actions through a distinct species of guanine nucleotide regulatory protein: inhibition of adenylate cyclase. Biochem J 214:547–552[Medline]
  29. Marchmont RJ, Houslay MD 1980 Insulin trigger, cyclic AMP-dependent activation and phosphorylation of a plasma membrane cyclic AMP phosphodiesterase. Nature 286:904–906[CrossRef][Medline]
  30. Bitensky MW, Russell V, Robertson W 1968 Evidence for separate epinephrine and glucagon responsive adenyl cyclase systems in rat liver. Biochem Biophys Res Commun 31:706–712[CrossRef][Medline]
  31. Cooper DR, Hernandez H, Kuo JY, Farese RV 1990 Insulin increases the synthesis of phospholipid and diacylglycerol and protein kinase C activity in rat hepatocytes. Arch Biochem Biophys 276:486–494[CrossRef][Medline]
  32. Wilkinson SE, Hallam TJ 1994 Protein kinase C: is its pivotal role in cellular activation over-stated? Trends Pharmacol Sci 15:53–57[CrossRef][Medline]
  33. Merritt JE, Moores KE, Evans AT, Sharma P, Evans FJ, MacPhee CH 1993 Involvement of calcium in modulation of neutrophil function by phorbol esters that activate protein kinase C isotypes and related enzymes. Biochem J 289:919–926
  34. Quentmeier A, Daneschmand H, Klein H, Unthan-Fechner K, Probst I 1993 Insulin-mimetic actions of phorbol ester in cultured adult rat hepatocytes. Lack of phorbol-ester-elicited inhibition of the insulin signal. Biochem J 289:549–555
  35. Okada T, Sakuma L, Fukui Y, Hazeki O, Ui M 1994 Blockage of chemotactic peptide-induced stimulation of neutrophils by wortmannin as a result of selective inhibition of phosphatidylinositol 3-kinase. J Biol Chem 269:3563–3567[Abstract/Free Full Text]
  36. Vlahos CJ, Matter WF, Hui KY, Brown RF 1994 A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269:5241–5248[Abstract/Free Full Text]
  37. Cheatham B, Vlahos CJ, Cheatham L, Wang L, Blenis J, Kahn CR 1994 Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14:4902–4911[Abstract/Free Full Text]
  38. Price DJ, Grove JR, Calvo V, Avruch J, Bierer BE 1992 Rapamycin-induced inhibition of the 70-kilodalton S6 protein kinase. Science 257:973–977[Abstract/Free Full Text]
  39. Kashimata M, Hiramatsu M, Minami N 1987 Effect of streptozotocin-induced diabetes on epidermal growth factor receptors in rat liver plasma membrane. Biochim Biophys Acta 923:496–500[Medline]
  40. Freidenberg GR, Klein HH, Kladde MP, Cordera R, Olefsky JM 1986 Regulation of epidermal growth factor receptor number and phosphorylation by fasting in rat liver. J Biol Chem 261:752–757[Abstract/Free Full Text]
  41. Posternak T, Weimann G 1974 The preparation of acylated derivatives of cyclic nucleotides. Methods Enzymol 38:399–409[Medline]
  42. Farese RV, Konda TS, Davis JS, Standaert ML, Pollet RJ, Cooper DR 1987 Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis. Science 236:586–589[Abstract/Free Full Text]
  43. Saltiel AR, Sherline P, Fox JA 1987 Insulin-stimulated diacylglycerol production results from the hydrolysis of a novel phosphatidylinositol glycan. J Biol Chem 262:1116–1121[Abstract/Free Full Text]
  44. Blackshear PJ, Nemenoff RA, Hovis JG, Halsey DL, Stumpo DJ, Huang JK 1987 Insulin action in normal and protein kinase C-deficient rat hepatoma cells. Effects on protein phosphorylation, protein kinase activities, and ornithine decarboxylase activities and messenger ribonucleic acid levels. Mol Endocrinol 1:44–52[Abstract/Free Full Text]
  45. Bandyopadhyay G, Standaert ML, Zhao L, Yu B, Avignon A, Galloway L, Karnam P, Moscat P, Farese RV 1997 Activation of protein kinase C ({alpha}, ß, and {zeta}) by insulin in 3T3/L1 cells. J Biol Chem 272:2551–2558[Abstract/Free Full Text]
  46. Mizuno K, Noda K, Ueda Y, Hanaki H, Saido TC, Ikuta T, Kuroki T, Tamaoki T, Hirai S, Osada S, Ohno S 1995 UCN-01, an anti-tumor drug, is a selective inhibitor of the conventional PKC subfamily. FEBS Lett 359:259–261[CrossRef][Medline]
  47. White MF, Kahn CR 1994 The insulin signaling system. J Biol Chem 269:1–4[Free Full Text]
  48. Carpenter CL, Duckworth BC, Auger KR, Cohen B, Schaffhausen BS, Cantley LC 1990 Purification and characterization of phosphoinositide 3-kinase from rat liver. J Biol Chem 265:19704–19711[Abstract/Free Full Text]
  49. Burgering BMT, Coffer PJ 1995 Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 376:599–602[CrossRef][Medline]
  50. Rameh LE, Chen CS, Cantley LC 1995 Phosphatidylinositol (3, 4, 5)P3 Interacts with SH2 Domains and Modulates PI 3-kinase Association with Tyrosine-phosphorylated Proteins. Cell 83:821–830[CrossRef][Medline]
  51. Chung J, Kuo CJ, Crabtree GR, Blenis J 1992 Rapamycin-FKBP specifically blocks growth-dependent activation of and signaling by the 70 kd S6 protein kinases. Cell 69:1227–1236[CrossRef][Medline]
  52. Terada N, Patel HR, Takase K, Kohno K, Nairn AC, Gelfand EW 1994 Rapamycin selectively inhibits translation of mRNAs encoding elongation factors and ribosomal proteins. Proc Natl Acad Sci USA 91:11477–11481[Abstract/Free Full Text]
  53. Jefferies HB, Reinhard C, Kozma SC, Thomas G 1994 Rapamycin selectively represses translation of the "polypyrimidine tract" mRNA family. Proc Natl Acad Sci USA 91:4441–4445[Abstract/Free Full Text]
  54. Kuo CJ, Chung J, Fiorentino DF, Flanagan WM, Blenis J, Crabtree GR 1992 Rapamycin selectively inhibits interleukin-2 activation of p70 S6 kinase. Nature 358:70–73[CrossRef][Medline]
  55. Osawa H, Sutherland C, Robey RB, Printz RL, Granner DK 1996 Analysis of the signaling pathway involved in the regulation of hexokinase II gene transcription by insulin. J Biol Chem 271:16690–16694[Abstract/Free Full Text]
  56. Sutherland C, O’Brien RM, Granner DK 1996 New connections in the regulation of PEPCK gene expression by insulin. Philosophical Transactions of the Royal Society of London - Series B: Biol Sci [Review] 351:191–199



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. A. Scheving, R. Buchanan, M. A. Krause, X. Zhang, M. C. Stevenson, and W. E. Russell
Dexamethasone modulates ErbB tyrosine kinase expression and signaling through multiple and redundant mechanisms in cultured rat hepatocytes
Am J Physiol Gastrointest Liver Physiol, September 1, 2007; 293(3): G552 - G559.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. A. Scheving, L. Zhang, M. C. Stevenson, E. S. Kwak, and W. E. Russell
The emergence of ErbB2 expression in cultured rat hepatocytes correlates with enhanced and diversified EGF-mediated signaling.
Am J Physiol Gastrointest Liver Physiol, July 1, 2006; 291(1): G16 - G25.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
I. H. Koumakpayi, J.-S. Diallo, C. Le Page, L. Lessard, M. Gleave, L. R. Begin, A.-M. Mes-Masson, and F. Saad
Expression and Nuclear Localization of ErbB3 in Prostate Cancer.
Clin. Cancer Res., May 1, 2006; 12(9): 2730 - 2737.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. N. Kholodenko, O. V. Demin, G. Moehren, and J. B. Hoek
Quantification of Short Term Signaling by the Epidermal Growth Factor Receptor
J. Biol. Chem., October 15, 1999; 274(42): 30169 - 30181.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carver, R. S.
Right arrow Articles by Russell, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carver, R. S.
Right arrow Articles by Russell, W. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals