help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinrichs, C.
Right arrow Articles by Baron, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinrichs, C.
Right arrow Articles by Baron, J.
Endocrinology Vol. 138, No. 12 5359-5365
Copyright © 1997 by The Endocrine Society


ARTICLES

Effects of Fasting on the Growth Plate: Systemic and Local Mechanisms1

Claudine Heinrichs, Michael Colli, Jack A. Yanovski2, Louisa Laue3, Noemi A. Gerstl, Angela D. Kramer, Jennifer A. Uyeda and Jeffrey Baron2

Developmental Endocrinology Branch, NICHD, NIH, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Jeffrey Baron, M.D., National Institutes of Health, Building 10, Room 10N262, 10 Center Drive MSC 1862, Bethesda, Maryland 20892-1862. E-mail: Baronj{at}cc1.nichd.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inadequate caloric intake inhibits longitudinal bone growth. This study was designed to investigate the mechanisms responsible for this suppression of growth plate function, focusing on the roles of systemic and local insulin-like growth factor 1 (IGF-1). Five week-old male rabbits were fasted for 48 h. Fasting significantly decreased proximal tibial growth velocity and growth plate width (both proliferative and hypertrophic zones). During the fast, systemic IGF-1 production was down-regulated. Serum IGF-1 levels and hepatic IGF-1 messenger RNA (mRNA) levels decreased despite increased GH levels. Serum levels of GH binding protein (a circulating fragment of the GH receptor) and hepatic GH receptor mRNA levels were not significantly changed. In contrast, the local, growth plate IGF-1 system appeared to be up-regulated. Growth plate GH receptor mRNA and IGF-1 mRNA levels were both increased during fasting.

We conclude that, in the rabbit, fasting induces a rapid depletion of growth plate chondrocytes and inhibition of longitudinal bone growth. These effects appear to be mediated by systemic endocrine mechanisms; circulating IGF-1 levels are diminished because of hepatic resistance to GH. In contrast, the local, paracrine IGF-1 system in growth plate does not appear to contribute to the growth inhibition but instead appears to be up-regulated by fasting.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LINEAR GROWTH is regulated, in part, by the action of insulin-like growth factor 1 (IGF-1) on the growth plate. GH stimulates both hepatic production of IGF-1, which increases circulating IGF-1 levels, and local production of IGF-1 in the growth plate (1, 2, 3). GH’s actions are mediated by a single high-affinity, membrane-associated receptor (4). GH receptors are expressed in many tissues, but the effects on linear growth are thought to involve primarily receptors in the liver and growth plate.

Inadequate caloric intake inhibits longitudinal bone growth (5, 6, 7). This suppression of growth plate function could arise from down-regulation of either systemic IGF-1 acting in an endocrine fashion or of local IGF-1 acting in a paracrine fashion. There is evidence that undernutrition does affect the systemic GH-IGF-1 system. In rats, fasting diminishes both GH production (8) and hepatic GH sensitivity (9, 10). The diminished GH sensitivity is characterized by decreases in hepatic GH receptor messenger RNA (mRNA) levels, GH binding, IGF-1 mRNA levels, and circulating IGF-1 levels (9, 10, 11, 12, 13). The nutritional regulation of rat hepatic IGF-1 production may be mediated by insulin (14) and by bioavaibility of amino acids (15). In humans, undernutrition may also induce a state of hepatic GH insensitivity. Circulating IGF-1 levels decrease as do levels of GH binding protein that represents a circulating fragment of the GH receptor (16). Unlike the rat, fasting humans have increased circulating GH levels (17, 18).

In contrast, there is little information about the effects of fasting on the local, growth plate IGF-1 system. Thus it is not known whether this system contributes to the inhibition of longitudinal growth during undernutrition. This study was therefore designed to investigate the mechanisms by which undernutrition suppresses longitudinal bone growth, focusing on the roles of systemic and local IGF-1. We hypothesized that growth plate, like liver, is rendered GH insensitive by fasting and that this decreased GH sensitivity contributes to the decreased linear growth associated with caloric deprivation. To test this hypothesis, we subjected growing rabbits to 48 h of fasting and measured the resulting GH receptor mRNA and IGF-1 mRNA levels in growth plate and, for comparison, in liver, kidney, and muscle. Serum GH, GH binding protein (GHBP), and IGF-1 levels were also measured. To confirm that the fast inhibited longitudinal bone growth, we measured tibial growth velocity and quantitated the histological changes at the growth plate.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
New Zealand White male rabbits were purchased from Hazleton Research Products (Denver, PA). The protocol was approved by the Animal Care and Use Committee, NICHD, NIH. The animals received National Institutes of Health Open Formula Rabbit Ration (NIH 32) and water ad libitum. At the age of 5 weeks, the animals were either allowed free access to food or fasted. Animals were killed by pentobarbital overdose. Two groups of animals (n = 8 per group) were used for the growth rate determination and histological examination, and three groups of animals (n = 6 per group) were used to measure serum GH, GHBP and mRNA levels.

Growth rate and histological effects were examined at 24 h and 48 h of fasting (n = 8 per group). The growth rate determined at 24 h does not represent an instantaneous growth rate but rather an average growth rate over the first day. To investigate the mechanisms affecting this growth rate, we therefore picked a time point (15 h) within this first 24-h time period. Similarly, to investigate mechanisms affecting the average growth during the second 24 h, we picked a time point (30 h) within that time period. Thus, an additional group of animals was studied at each of three time points: 0, 15, and 30 h of fasting (n = 6 per group). In these animals, serum GH, IGF-1, and GHBP were measured. Liver, kidney, and muscle samples were frozen in liquid nitrogen and stored at -80 C until RNA preparation. The distal femurs and proximal tibiae were isolated, cut longitudinally in half, fractured through the proximal tibial and distal femoral growth plates, and submerged for 4 min in a solution containing 4 M guanidine thiocyanate, 25 mM sodium citrate (pH 7.0), and 0.1 M 2-mercaptoethanol. The growth plate cartilage was then scraped from the underlying bone, frozen in liquid nitrogen, and stored at -80 C (19).

Growth rate determination
Before fasting, two metal pins (30 gauge; 5 mm in length) were placed in each proximal tibial metaphysis. For pin placement, the animals were sedated with im glycopyrolate (0.02 mg), ketamine hydrochloride (33 mg/kg), and xylazine (6.6 mg/kg) and given a single prophylactic im dose of penicillin-G (44,000 IU/kg). Using sterile technique, the pins were inserted percutaneously into the bony metaphysis. The pins were directed posteriorly, parallel to and several mm distal to the proximal tibial growth plate. Serial radiographs of the tibiae were obtained in duplicate after 0, 24, and 48 h of full feeding or fasting, as previously described (20). For each radiograph, animals were sedated with an intramuscular injection of ketamine hydrochloride (33 mg/kg) plus xylazine (6.6 mg/kg). The radiographs were examined under a dissecting microscope. Using a micrometer, we measured the distance between the more proximal pin and the proximal margin of the proximal tibial epiphysis (20). The observer was blinded to the dietary regimen.

Histological examination
After 48 h of full feeding or fasting, the animals were killed, and the proximal tibiae were prepared for histological examination. Serial 6-µm sections were cut parallel to the tibia and stained with Masson trichrome stain, as previously described (21). The stained tissue sections were examined by a single observer blinded to the dietary regimen.

GH, GHBP, and IGF-1 assays
Serum was obtained just before sacrifice for measurement of GH and GHBP. Rabbit serum GH hormone was measured using an RIA (Dr. A. F. Parlow, Pituitary Hormone and Antisera Center, Torrance, CA).

Total GHBP was measured in triplicate by an assay based on radioimmunoprecipitation of the GH/GHBP complex with an anti-GHBP antibody (Endocrine Sciences, Calabasas Hills, CA) as previously described (19, 22). Briefly, 25 µl of serum were incubated overnight at 4 C with excess [125I]hGH, and a monoclonal antibody (mAb) directed against the extracellular domain of the GH receptor (mAb 263) (23). The trimolecular complex (mAb 263-GHBP-[125I]hGH) was separated from the free [125I]hGH by precipitation with goat-antimouse immunoglobulin and polyethylene glycol. Normal rabbit serum has a GHBP concentration of 1340 pmol/liter with an association constant of 1.2 nM-1 (19). Ten nanograms per ml rabbit GH lowered the apparent GHBP concentration by 13%; 20 ng/ml rabbit GH lowered the apparent GHBP concentration by 26%. In each sample, GHBP measurements were corrected for endogenous rabbit GH.

Rabbit serum IGF-1 was measured after acid-ethanol extraction by RIA using a polyclonal antibody and IGF-II to block any residual IGFBPs (24).

RNA preparation
For liver, kidney and muscle samples, total RNA was prepared by homogenization in a guanidinium isothiocyanate solution (RNAzol, Cinna/Biotecx, Friendswood, TX), followed by phenol/chloroform extraction and 2-propanol precipitation. The growth plate tissue (50–100 mg) was homogenized in 0.5 ml of a solution containing 4 M guanidine thiocyanate, 25 mM sodium citrate (pH 7.0), and 0.1 M 2-mercaptoethanol. Samples were diluted with 1.5 ml of a solution containing 19 mM Tris-HCl (pH 7.0) and 0.72 g/liter proteinase K (ICN Biomedicals Inc., Aurora, OH). After a 20-min digestion at room temperature, the samples were extracted with 1 ml phenol and 1 ml chloroform. After collection of the aqueous phase, 0.2 ml 3 M sodium acetate (pH 5.2) and 2 ml 2-propanol were added. RNA was precipitated at -20 C for 3 h and collected by centrifugation (9, 500 x g for 30 min). The pellet was washed with 75% ethanol, dried, and resuspended in 200 µl water. An equal volume of 8 M LiCl was added. The RNA was reprecipitated at -20 C overnight and collected by centrifugation (10,700 x g for 30 min). After washing with 75% ethanol, the pellet was suspended in 30 µl 10 mM Tris (pH 7.6) and 1 mM EDTA. RNA concentration was approximated initially by measuring the absorbance at 260 nm. The integrity of RNA preparations was confirmed by visual inspection of ethidium bromide-stained 28S and 18S ribosomal RNA bands after electrophoresis of 15-µg total RNA through 1.25% agarose–2.2 M formaldehyde gels. Ribosomal RNA content was quantitated from a photograph of the ethidium bromide-stained gel by computer-assisted video densitometry using the program Image 1.49 (Dr. W. Rasband, NIH, Bethesda, MD; Ref.25). The intensity of the ribosomal band was proportional to the RNA content throughout the range used in these studies (data not shown).

Antisense RNA probes
The GH receptor RNA probe was transcribed from a 370-bp EcoRI/AccI fragment of the rabbit GH receptor complementary DNA (4; kindly provided by Dr. W. Wood, Genentech, South San Francisco, CA) subcloned into EcoRI- and AccI-digested pGEM-3Z (Promega, Madison, WI). The sequence encodes part of the extracellular domain, the transmembrane domain, and part of the intracellular domain of the receptor. This plasmid was linearized with HindIII, and, using T7 RNA polymerase, a 32P-labeled 404-base antisense riboprobe was transcribed, containing 370 bases complementary to the rabbit GH receptor mRNA and 34 bases corresponding to the vector.

To prepare a rabbit IGF-1 probe, exon 3 of the rabbit IGF-1 gene was amplified by PCR using as template rabbit genomic DNA, prepared from the liver of a New Zealand White rabbit. The oligonucleotide primers represented the first 21 bases and the last 21 bases of exon 3 of the human IGF-1 gene (5' primer ACAAGCCCACAGGGTATGGCT and 3' primer GACATGCCCAAGACCCAGAAG) (26). A single major product was purified, inserted into a plasmid pCRII (Invitrogen Corp, San Diego), and sequenced. The predicted amino acid sequence showed 96% identity with the human and rat IGF-1 exon 3 (26, 27). This fragment was subcloned in pGEM-4Z (Promega, Madison, WI). The plasmid was linearized with XbaI, and, using T7 RNA polymerase, a 32P-labeled approximately 320-bases antisense riboprobe was transcribed, containing approximately 175 bases complementary to the rabbit IGF-1 mRNA and approximately 145 bases corresponding to the vector.

RNase protection assay
Ten- to fifteen-microgram aliquots of total RNA were combined with 320,000 cpm of GH receptor and IGF-1 probes and hybridized at 45 C for 16 h as previously described (19). As an internal control for potential losses during processing, an equal amount (~3000 cpm) of 32P end-labeled, AviII-digested pGEM-3Z DNA (Promega, Madison, WI) (1.7 and 1.0 kb in size) was added to each RNA sample at the beginning of the assay. After RNase digestion, the protected probe was denatured and electrophoresed through 8% polyacrylamide-8 M urea gels. The bands corresponding to protected probes and to the pGEM-3Z fragments were quantitated by storage phosphor autoradiography using a PhosphorImager apparatus and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). RNA losses were not significantly different in the fasted vs. control groups (data not shown). Each assay was performed at least twice. The mean of the replicates was used for data analysis.

Statistical analysis
For each sample, the activity of the RNase-protected probe was normalized to the ribosomal RNA content and to the intensity of the corresponding pGEM-3Z bands. The mean GH receptor and IGF-1 mRNA levels of the control group in each experiment were set equal to 100%. Data are presented as mean ± SEM. Comparisons between fed and fasted rabbits were made, where appropriate, by ANOVA followed by posthoc Fisher protected least significant difference tests or by unpaired two-tailed Student’s t test with the Bonferroni correction. Data were log transformed before analysis, where appropriate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Longitudinal bone growth
During the 48-h fast, cumulative proximal tibial growth was significantly diminished compared with control animals (0.50 ± 0.02 vs. 0.37 ± 0.03 mm/day, P < 0.01; Fig. 1Go).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Cumulative proximal tibial growth (mean ± SEM) before and during fasting. One group received no food (day 0–2, n = 8, open symbols, dashed line) while the control group continued to feed ad libitum (n = 8, closed symbols, solid line). ** P < 0.01.

 
Histological examination
The total height of the proximal tibial growth plate was decreased by the 48-h fast compared with fed controls (510 ± 10 vs. 740 ± 40 µm, mean ± SEM, P < 0.002, Fig. 2Go). The number of proliferative chondrocytes per column was significantly decreased by fasting (38 ± 2 vs. 45 ± 2; P = 0.05) as was the number of hypertrophic chondrocytes per column (18 ± 1 vs. 23 ± 1; P < 0.001). Fasting also caused a decrease in the height of the terminal hypertrophic chondrocyte, i.e. the chondrocyte adjacent to the metaphyseal border (23 ± 1 vs. 30 ± 1 µm; P < 0.001).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Effect of 48-h fast on proximal tibial growth plate. Upper panel, heights of cartilaginous growth plates (mean ± SEM; n = 8 per group). Lower panel, number of chondrocytes per column in the proliferative and hypertrophic zones of the growth plate (mean; n = 8 per group). * P = 0.05; ** P < 0.002; *** P < 0.001.

 
Serum GH, IGF-1, and GHBP
Serum GH levels were significantly greater in fasted than fed animals (5 ± 2 vs. 27 ± 12 vs. 29 ± 7 ng/ml in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.02, Fig. 3AGo). The serum GHBP showed no significant differences among the three groups (1980 ± 250 vs. 2300 ± 270 vs. 2590 ± 400 pmol/liter in the fed, 15-h fast, 30-h fast groups, respectively; Fig. 3BGo). Serum IGF-1 decreased significantly after 15 and 30-h fasting compared with controls (353 ± 24 vs. 139 ± 30 vs. 105 ± 25 ng/ml in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.001, Fig. 3CGo).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Effect of fasting on serum GH, GHBP, and IGF-1 (mean ± SEM, n = 6 per group). Serum GH and IGF-1 were determined by RIA, and serum GHBP was determined by a radioimmunoprecipitation assay.

 
GH receptor mRNA
In growth plate, fasting significantly increased growth plate GH receptor mRNA levels compared with controls (100 ± 10% vs. 200 ± 12 vs. 197 ± 23 in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.001; Figs. 4Go and 5Go).



View larger version (88K):
[in this window]
[in a new window]
 
Figure 4. RNase protection assay of growth plate mRNA samples from fed and fasted rabbits. Ten micrograms of growth plate total RNA were hybridized with 32P-labeled rabbit GH receptor and IGF-1 riboprobes. After RNase digestion, samples were electrophoresed through a denaturing polyacrylamide gel, followed by autoradiography. Each lane represents a single animal. The pGEM-3Z fragments were included as an internal control for nucleic acid recovery. For example, lane 10 showed decreased pGEM-3Z fragments, indicating loss of nucleic acids during the assay. A 32P-labeled MspI digest of pBR322 DNA was used to produce size markers. The numbers on the left side of the autoradiograph indicate size in bases. Arrows indicate the predicted locations of the indicated polynucleotides. The construct used to generate the IGF-1 probe was made by PCR-amplifying the rabbit IGF-1 gene using rabbit genomic DNA as template. The primers used for the amplification represent the first 21 bases and the last 21 bases of exon 3 of the human IGF-1 gene. Thus, in the RNase protection assay, mismatch may occur between the resultant probe and cellular rabbit IGF-1 mRNA at the sites corresponding to these primers. Partial RNase digestion at these mismatches presumably produces the cluster of bands representing IGF-1 probe.

 


View larger version (50K):
[in this window]
[in a new window]
 
Figure 5. Effect of fasting on growth plate, liver, kidney, and muscle GH receptor mRNA levels (mean ± SEM, n = 6 per group). An RNase protection assay was performed and the bands quantitated by storage phosphor autoradiography. Results were normalized for ribosomal RNA content and pGEM 3Z recovery (see Materials and Methods). The mean GH receptor mRNA level of the control group was set equal to 100%.

 
In liver, neither 15- nor 30-h fasting significantly changed liver GH receptor mRNA levels (100 ± 7% vs. 85 ± 18 vs. 84 ± 10 in the fed, 15-h fast, 30-h fast groups, respectively; P = NS; Fig. 5Go).

In kidney, fasting did not significantly affect GH receptor mRNA levels (100 ± 4% vs. 97 ± 4 vs. 95 ± 6 in the fed, 15-h fast, 30-h fast groups, respectively; Fig. 5Go).

In muscle tissue, fasting significantly increased muscle GH receptor mRNA levels compared with controls (100 ± 15% vs. 221 ± 51 vs. 295 ± 41 in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.05; Fig. 5Go).

IGF-1 mRNA
In growth plate, IGF-1 mRNA levels were increased significantly in the group fasted for 15 h compared with controls (P < 0.02). The increase at 30 h did not reach statistical significance (100 ± 14% vs. 165 ± 15 vs. 128 ± 21 in the fed, 15-h fast, 30-h fast groups, respectively; Figs. 4Go and 6Go).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 6. Effect of fasting on growth plate, liver, kidney, and muscle IGF-1 mRNA levels (mean ± SEM, n = 6 per group). An RNase protection assay was performed and the bands quantitated by storage phosphor autoradiography. Results were normalized for ribosomal RNA content and pGEM 3Z recovery (see Materials and Methods). The mean IGF-1 mRNA level of the control group was set equal to 100%.

 
Liver IGF-1 mRNA levels did not change significantly after 15 h but decreased after 30 h fasting compared with controls (100 ± 13% vs. 82 ± 13 vs. 59 ± 12 in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.05; Fig. 6Go).

In the kidney, IGF-1 mRNA levels were very low and did not change after 15 h but decreased after 30 h fasting compared with the controls (100 ± 5% vs. 98 ± 7 vs. 76 ± 4 in the fed, 15-h fast, 30-h fast groups, respectively; P < 0.02; Fig. 6Go).

In the muscle, IGF-1 mRNA levels were very low and did not change after fasting compared with the controls (100 ± 11% vs. 130 ± 9 vs. 96 ± 9 in the fed, 15-h fast, 30-h fast groups, respectively; Fig. 6Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In 5-week-old rabbits, 48 h of fasting caused a decrease in the rate of longitudinal bone growth. The height of the growth plate was reduced as was the number of proliferative and hypertrophic chondrocytes per column and the height of the terminal hypertrophic chondrocyte. Fasting caused an increase in serum GH levels, no significant change in serum GHBP levels, and a decrease in serum IGF-1 levels. In the growth plate, both GH receptor mRNA levels and IGF-1 mRNA levels were increased by fasting. GH receptor mRNA levels were also increased in muscle but did not change significantly in liver or in kidney. IGF-1 mRNA levels were decreased in liver and kidney and unchanged in muscle.

Chronic undernutrition has previously been shown to inhibit longitudinal bone growth (5, 6, 7). Here we show that inhibition occurs after only 48 h of fasting. Growth rate is proportional to the number of proliferative chondrocyte divisions per unit time and to the height of the terminal hypertrophic chondrocyte (28). Thus, the observed decreases in the number of proliferative chondrocytes and in the height of the terminal hypertrophic chondrocytes may both have contributed to the decreased growth rate.

To explore the underlying mechanism, we measured serum GH, GHBP, and IGF-1. During the fast, serum GH levels increased and thus could not explain the growth inhibition. Serum GH levels also increase with undernutrition in humans, sheep, cows, and pigs (17, 29, 30, 31). Thus, in this respect, the rabbit provides a better model for human GH physiology than does the rat, which shows decreased serum GH levels with fasting (8). In this study, a single GH measurement was made in each animal. Because GH secretion is pulsatile in the rabbit (32), this value probably reflects a mean serum concentration but does not distinguish between changes in pulse amplitude or frequency. Although frequent GH sampling has not been reported for the rabbit during fasting, humans show increases in both pulse amplitude and frequency. The observed rabbit GH levels may also have been increased by the stress of blood drawing in both the fed and fasted groups.

In the current study, serum GHBP was not changed significantly by fasting. In humans, serum GHBP concentrations decrease with chronic dietary restriction (16), but not with acute fasting (33). A similar result has been observed in pigs, whereas rat GHBP falls with fasting (11, 34). However, rat GHBP derives from alternative splicing of the GH receptor gene, whereas in rabbits and humans, the GHBP is derived from the GH receptor by proteolytic cleavage (35). Because GHBP is the principal binding protein for GH, our data suggest that unbound GH is also increased during fasting in the rabbit.

Serum IGF-1 levels were significantly decreased during fasting. This decrease provides one mechanistic explanation for the inhibition in longitudinal bone growth and the histologic changes in the growth plate. The circulating IGF-1 levels were significantly decreased by 15 h of fasting, and yet the average growth velocity during the first day of fasting was only affected mildly, suggesting a lag time between the endocrine change and the cellular response. Since the liver is believed to be the principal source of circulating IGF-1 (36), the observed decrease in hepatic IGF-1 mRNA levels may be responsible for the decrease in circulating IGF-1 levels. The decreases in liver IGF-1 mRNA levels and in circulating IGF-1 levels occurred despite increased GH levels, suggesting that the liver is rendered GH resistant. Similar hepatic GH resistance has been observed in rats (7, 12, 13) and humans during fasting (17, 18).

In rats, this fasting-induced GH resistance is associated with decreased hepatic GH receptor mRNA expression (13). In contrast, we did not observe a significant change in hepatic GH receptor mRNA expression in the fasted rabbit. Similarly, GH receptor mRNA levels in bovine liver do not change with chronic caloric restriction (37). Thus, the mechanism of fasting-induced hepatic GH resistance may differ among mammalian species. While we did not measure GH receptor protein levels directly, the absence of change in the mRNA level and in the GHBP level (a proteolytic product of the GH receptor) indirectly suggest that the receptor density is not regulated by fasting of this duration in the rabbit.

In contrast to the systemic IGF-1 system, the local, growth plate IGF-1 system did not appear to be down-regulated. Neither GH receptor mRNA nor IGF-1 mRNA levels decreased with fasting in the growth plate, suggesting that the changes in the local growth plate GH receptor-IGF-1 system do not contribute to the inhibition in bone growth. To the contrary, both GH receptor mRNA and IGF-1 mRNA increased with fasting. We did not measure GH receptor expression at the protein level. However, GH receptor mRNA and protein levels correlate in other systems (38, 39). Thus, GH receptor protein expression may also be increased by fasting. A similar increase in GH receptor mRNA occurs with glucocorticoid excess, suggesting that these changes may represent a compensatory mechanism occurring in response to growth inhibition (19). Alternatively, fasting may have increased circulating glucocorticoid concentrations, thus inducing increased GHR and IGF-1 mRNA levels. Our data do not exclude the possibility that translation of IGF-1 transcript could be decreased or that local IGF-1 protein degradation could be increased during fasting. Alternatively, resistance to IGF-1 could develop through altered expression of IGF receptor or IGF binding proteins, thus contributing to the decreased growth rate.

The fasting-induced changes in GH receptor mRNA and IGF-1 mRNA levels in the kidney paralleled those observed in liver; GH receptor was unchanged, whereas IGF-1 mRNA decreased with the more prolonged fast, a result similar to that observed in the rat (13).

GH receptor mRNA levels in muscle increased with fasting with a magnitude and time course similar to that observed in growth plate. However, unlike growth plate, muscle IGF-1 mRNA did not significantly change during fasting. This pattern contrasts with that observed in the rat, in which both muscle GH receptor and IGF-1 mRNA decreased with fasting (12, 13). These data again emphasize that the nutritional regulation of this system is highly species specific.

We conclude that, in the rabbit, fasting induces a rapid depletion of growth plate chondrocytes and inhibition of longitudinal bone growth. Our data suggest that these effects are mediated by systemic endocrine mechanisms; circulating IGF-1 levels are diminished because of hepatic resistance to GH. In contrast, the local, paracrine IGF-1 system in growth plate does not appear to contribute to the growth inhibition but instead appears to be up-regulated by fasting.


    Acknowledgments
 
We thank Dr. A. F. Parlow, Pituitary Hormones and Antisera Center, for providing the reagents for rabbit GH assay.


    Footnotes
 
1 Supported in part by a grant from the European Society for Pediatric Endocrinology. Back

2 Commissioned Officers in the United States Public Health Service. Back

3 Deceased July 19, 1995. Back

Received April 21, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Salmon Jr WD, Daughaday WHJ 1957 A hormonally controlled serum factor which stimulates sulfate incorporation by cartilage in vitro. J Lab Clin Med 49:825–836[Medline]
  2. Nilsson A, Isgaard A, Lindahl A, Dahlstrom A, Skottner A, Isaksson OGP 1986 Regulation by growth hormone of number of chondrocytes containing IGF-1 in rat growth plate. Science 233:571–574[Abstract/Free Full Text]
  3. Isaksson OG, Lindahl A, Nilsson A, Isgaard J 1987 Mechanism of the stimulatory effect of growth hormone on longitudinal bone growth. Endocr Rev 8:426–438[Abstract/Free Full Text]
  4. Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI 1987 Growth hormone receptor and serum binding protein: purification, cloning and expression. Nature 330:537–543[CrossRef][Medline]
  5. Price DA, Wit JM, Van Buul-Offers S, Korteland-Van Male AM, Van Rooyen-Wehmeijer AKM, Hoogerbrugge C, Van Den Brande JL 1979 Serum somatomedin activity and cartilage metabolism in acutely fasted, chronically malnourished, and refed rats. Endocrinology 105:851–861[Abstract/Free Full Text]
  6. Allen LH 1995 Malnutrition and human function: a comparison of conclusions from the INCAP and nutrition CRSP studies. J Nutr [Suppl 4] 125:1119S–1126S
  7. Thissen JP, Ketelslegers JM, Underhood LE 1994 Nutritional regulation of the insulin-like growth factors. Endocr Rev 15:80–101[Abstract/Free Full Text]
  8. Tannenbaum GS, Rorstad O, Brazeau P 1979 Effects of prolonged food deprivation on the ultradian growth hormone rhythm and immunoreactive somatostatin tissue levels in the rats. Endorinology 104:1733–1738[Abstract/Free Full Text]
  9. Maes M, Underwood LE, Ketelslegers JM 1983 Plasma somatomedin-C in fasted and refed rats: close relationship with changes in liver somatogenic but not lactogenic binding sites. J Endocrinol 97:243–252[Abstract/Free Full Text]
  10. Straus DS, Takemoto CD 1990 Effects of fasting on insulin-like growth factor-1 and growth hormone receptor mRNA levels and IGF-1 gene transcription in rat liver. Mol Endocrinol 4:91–100[Abstract/Free Full Text]
  11. Mulumba N, Massa G, Ketelslegers J-M, Maes M 1991 Ontogeny and nutritional regulation of the serum growth-hormone-binding protein in the rat. Acta Endocrinol (Copenh) 125:409–415[Abstract/Free Full Text]
  12. Lowe WL, Adamo M, Roberts CT, LeRoith D 1989 Regulation by fasting of rat insulin-like growth factor I and its receptor. Effects on gene expression and binding. J Clin Invest 84:619–626
  13. Bornfeldt KE, Arnqvist HJ, Enberg B, Mathews LS, Norstedt G 1989 Regulation of insulin-like growth factor-1 and growth hormone receptor gene expression by diabetes and nutritional state in rat tissues. J Endocrinol 122:651–656[Abstract/Free Full Text]
  14. Phillips LS, Goldstein S, Pao CI 1991 Nutrition and Somatomedin XXVI. Molecular Regulation of IGF-1 by insulin in cultured rat hepatocytes. Diabetes 40:1525–1530[Abstract]
  15. Maiter D, Fliesen T, Underwood LE, Maes M, Gerard G, Davenport ML, Ketelslegers JM 1989 Dietary protein restriction decreases insulin-like growth factor-1 independent of insulin and liver growth hormone binding. Endocrinology 124:2604–2611[Abstract/Free Full Text]
  16. Counts DR, Gwirtsman H, Carlsson LMS, Lesem M, Cutler GB 1992 The effect of anorexia nervosa and refeeding on growth hormone-binding protein, the insulin-like growth factors (IGFs), and the IGF-binding proteins. J Clin Endocrinol Metab 75:762–767[Abstract]
  17. Ho KY, Veldhuis JD, Johnson ML, Furlanetto R, Evans WS, Alberti KGMM, Thorner MO 1988 Fasting enhances growth hormone secretion and amplifies the complex rhythms of growth hormone secretion in man. J Clin Invest 81:968–975
  18. Bang P, Brismar K, Rosenfeld RG, Hall K 1994 Fasting affects serum insulin-like growth factors (IGFs) and IGF-binding proteins differently in patients with noninsulin-dependent diabetes mellitus vs. healthy nonobese and obese subjects. J Clin Endocrinol 78:960–967[Abstract]
  19. Heinrichs C, Yanovski JA, Roth AH, Yu YM, Domené HM, Yano K, Cutler GB, Baron J 1994 Dexamethasone increases growth hormone receptor messenger ribonucleic acid levels in liver and growth plate. Endocrinology 135:1113–1118[Abstract]
  20. Baron J, Huang Z, Oerter KE, Bacher JD, Cutler Jr GB 1992 Dexamethasone acts locally to inhibit longitudinal bone growth in rabbits. Am J Physiol 263:E489–E492
  21. Baron J, Oerter Klein K, Yanoski JA, Novosad JA, Bacher JD, Bolander ME, Cutler Jr GB 1994 Induction of growth plate cartilage ossification by basic fibroblast growth factor. Endocrinology 135:2790–2793[Abstract]
  22. Stene M, Dawson K, Martha P, Reiter E, Holcomb J 1992 Clinical availability of a rapid monoclonal-based assay for the high affinity GH binding protein. Program of the 74th Annual Meeting of The Endocrine Society, San Antonio, Texas, 1992, p 170 (Abstract 474)
  23. Barnard R, Quick P, Waters MJ 1989 Characterization of the growth hormone-binding protein of human serum using a panel of monoclonal antibodies. J Endocrinol 123:327–332[Abstract/Free Full Text]
  24. Breier BH, Gallaher BW, Gluckman PD 1991 Radioimmunoassay for insulin-like growth factor-I: solutions to some potential problems and pitfalls. J Endocrinol 128:347–357[Abstract/Free Full Text]
  25. Correa-Rotter R, Mariash CN, Rosenberg ME 1992 Loading and transfer control for Northern hybridization. BioTechniques 12:154–157[Medline]
  26. Rotwein P, Pollok KM, Didier DK, Krivi GG 1986 Organization and sequence of the human insulin-like growth factor I gene. J Biol Chem 261:4828–4832[Abstract/Free Full Text]
  27. Shimatsu A, Rotwein P 1987 Mosaic evolution of the insulin-like growth factors. J Biol Chem 262:7894–7900[Abstract/Free Full Text]
  28. Sissons HA 1955 Experimental study on the effect of local radiation on bone growth. In: Mitchell JS, Holmes BE, Smith CL (eds) Progress in Radiobiology. Oliver and Boyd, Edinburgh, pp 436–452
  29. Thomas GB, Mercer JE, Karalis T, Rao A, Cummins JT, Clarke IJ 1990 Effects of restricted feeding on the concentrations of growth hormone (GH), gonadotropins, and prolactin (PRL) in plasma, and on the amounts of messenger ribonucleic acid for GH, gonadotropin subunits, and PRL in the pituitary glands of adult ovariectomized ewes. Endocrinology 126:1361–1367[Abstract/Free Full Text]
  30. Breier BH, Bass JJ, Butler JH, Gluckman PD 1986 The somatotrophic axis in young steers: influence of nutritional status on pulsatile release of growth hormone and circulating concentrations of insulin-like growth factor-1. J Endocrinol 11:209–215
  31. Buonomo FC, Baile CA 1991 Influence of nutrition deprivation on insulin-like growth factor 1, somatotropin, and metabolic hormones in swine. J Anim Sci 69:755–760[Abstract]
  32. Chiara K, Minamitani N, Kaji H, Kodama H, Kita T, Fujita T 1983 Human pancreatic growth hormone-releasing factor stimulates release of growth hormone in conscious unrestrained male rabbits. Endocrinology 113:2081–2085[Abstract/Free Full Text]
  33. Ho-PJ, Gesundheit N, Wong WL, Huang SH, Friberg RD, Barkan AL 1995 Dynamic changes of growth hormone-binding protein concentrations in normal men and patients with acromegaly: effects of short-term fasting. Metabolism 44:667–672[CrossRef][Medline]
  34. Mullins TM, Davis SL 1992 Assessment of factors regulating growth hormone binding protein in pigs. J Anim Sci 70:2741–2745[Abstract]
  35. Sotiropoulos A, Goujon L, Simonin G, Kelly PA, Postel-Vinay MC, Finidori J 1993 Evidence for generation of the growth hormone-binding protein through proteolysis of growth hormone membrane receptor. Endocrinology 132:1863–1865[Abstract/Free Full Text]
  36. Schwander JC, Hauri C, Zapf J, Froesch ER 1983 Synthesis and secretion of insulin-like growth factor and its binding protein by the perfused rat liver. Endocrinology 113:297–305[Abstract/Free Full Text]
  37. Hayden JM, Williams JE, Collier RJ, Krivi GG, Anthony RV Growth hormone receptor binding, and mRNA abundance in bovine hepatic tissue is not affected by chronic dietary restriction or refeeding Program of the 74th Annual Meeting of The Endocrine Society, San Antonio, Texas, 1992, p 222 (Abstract 681)
  38. Fliesen T, Maiter D, Gerard G, Underwood LE, Maes M, Ketelslegers JM 1989 Reduction of serum insulin-like growth factor-1 by dietary protein restriction is age dependent. Pediatr Res 26:415–419[Medline]
  39. VandeHaar MJ, Moats-Staats BM, Davenport ML, Walker JL, Ketelslegers JM, Sharma BK, Underwood LE 1991 Reduced serum concentrations of insulin-like growth factor-1(IGF-1) in protein-restricted growing rats are accompanied by reduced IGF-1 mRNA levels in liver and skeletal muscle. J Endocrinol 130:305–312[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Clin PharmacolHome page
K. C. Lasseter, L. Shaughnessy, D. Cummings, J. C. Pezzullo, W. Wargin, R. Gagnon, J. Oliva, and G. Kosutic
Ghrelin Agonist (TZP-101): Safety, Pharmacokinetics and Pharmacodynamic Evaluation in Healthy Volunteers: A Phase I, First-in-Human Study
J. Clin. Pharmacol., February 1, 2008; 48(2): 193 - 202.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Baron
Growth Hormone Therapy in Childhood: Titration Versus Weight-Based Dosing?
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2436 - 2438.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. C. R. Prickett, G. K. Barrell, M. Wellby, T. G. Yandle, A. M. Richards, and E. A. Espiner
Response of plasma CNP forms to acute anabolic and catabolic interventions in growing lambs
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1395 - E1400.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. M. Luque, Z. H. Huang, B. Shah, T. Mazzone, and R. D. Kineman
Effects of leptin replacement on hypothalamic-pituitary growth hormone axis function and circulating ghrelin levels in ob/ob mice
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E891 - E899.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Luque, S. Park, and R. D. Kineman
Severity of the Catabolic Condition Differentially Modulates Hypothalamic Expression of Growth Hormone-Releasing Hormone in the Fasted Mouse: Potential Role of Neuropeptide Y and Corticotropin-Releasing Hormone
Endocrinology, January 1, 2007; 148(1): 300 - 309.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Gat-Yablonski, T. Ben-Ari, B. Shtaif, O. Potievsky, O. Moran, R. Eshet, G. Maor, Y. Segev, and M. Phillip
Leptin Reverses the Inhibitory Effect of Caloric Restriction on Longitudinal Growth
Endocrinology, January 1, 2004; 145(1): 343 - 350.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. Nilsson, J. Falk, E. M. Ritzen, J. Baron, and L. Savendahl
Raloxifene Acts as an Estrogen Agonist on the Rabbit Growth Plate
Endocrinology, April 1, 2003; 144(4): 1481 - 1485.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. M. Naranjo, S. Yakar, M. Sanchez-Gomez, A. U. Perez, J. Setser, and D. LERoith
Protein Calorie Restriction Affects Nonhepatic IGF-I Production and the Lymphoid System: Studies Using the Liver-Specific IGF-I Gene-Deleted Mouse Model
Endocrinology, June 1, 2002; 143(6): 2233 - 2241.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
N. Nagaya, M. Kojima, M. Uematsu, M. Yamagishi, H. Hosoda, H. Oya, Y. Hayashi, and K. Kangawa
Hemodynamic and hormonal effects of human ghrelin in healthy volunteers
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2001; 280(5): R1483 - R1487.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
A.B. Ballinger, C. Camacho-Hubner, and N.M. Croft
Growth failure and intestinal inflammation
QJM, March 1, 2001; 94(3): 121 - 125.
[Full Text] [PDF]


Home page
GutHome page
A B Ballinger, O Azooz, T El-Haj, S Poole, and M J G Farthing
Growth failure occurs through a decrease in insulin-like growth factor 1 which is independent of undernutrition in a rat model of colitis
Gut, May 1, 2000; 46(5): 695 - 700.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. J. Bollag, Q. Zhong, P. Phillips, L. Min, L. Zhong, R. Cameron, A. L. Mulloy, H. Rasmussen, F. Qin, K. H. Ding, et al.
Osteoblast-Derived Cells Express Functional Glucose-Dependent Insulinotropic Peptide Receptors
Endocrinology, March 1, 2000; 141(3): 1228 - 1235.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinrichs, C.
Right arrow Articles by Baron, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinrichs, C.
Right arrow Articles by Baron, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals