| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Articles |
Reproductive Endocrinology Center, University of California, San Francisco, California 94143-0556
Address all correspondence and requests for reprints to: Dr. Michael K. Skinner, Department of Genetics and Cell Biology, Washington State University, Pullman Washington, 99164.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transferrin promoter was characterized and found to contain two critical response elements, designated Sertoli element 1 (SE1) and Sertoli element 2 (SE2). Through sequence analysis, SE2 was found to contain an E-box response element, which has been shown to respond to basic-helix-loop-helix (bHLH) transcription factors. The bHLH proteins are a class of transcription factors associated with the induction and progression of cell differentiation. bHLH proteins dimerize through the conserved helix-loop-helix region and bind DNA through the basic region. Nuclear extracts from Sertoli cells were found to cause an E-box gel shift when the cells were stimulated to differentiate in culture, but not under basal conditions. The SE2 gel shift of Sertoli nuclear extracts was competed with excess unlabeled SE2 or E-box DNA fragments. Several Sertoli nuclear proteins associate with the SE2 gel shifts, including 70-, 42-, and 25-kDa proteins. Therefore, the critical SE2 element in the transferrin promoter is an E-box element capable of binding bHLH transcription factors. The ubiquitously expressed E12 bHLH protein dimerizes with numerous cell-specific bHLH factors. A Western blot analysis demonstrated that E12 was present in Sertoli cell nuclear extracts and associated with the SE2 gel shift. A ligand blot of Sertoli cell nuclear extracts with radiolabeled E12 had apparent bHLH proteins when the cells were stimulated to differentiate. The E-box sequence in the SE2 fragment of the transferrin promoter was CATCTG and was similar in gel shifts to the consensus E-box elements (CANNTG) previously characterized. A bHLH inhibitory factor (Id) competed and inhibited formation of the Sertoli cell nuclear extract E-box gel shift. To extend this observation, Id protein was overexpressed in cultured Sertoli cells. A transferrin promoter chloramphenicol acetyltransferase construct was used to monitor Sertoli cell function. The presence of Id suppressed the activation of the promoter induced by Sertoli differentiation factors. Therefore, the inhibition of Sertoli bHLH factors by Id suppressed Sertoli cell differentiated function, as measured by transferrin expression. An E-box-chloramphenicol acetyltransferase construct was also found to be active in Sertoli cells when cells were induced to differentiate. Screening the computerized nucleotide data bases demonstrated that putative E-box response elements are present in the promoters of a large number of Sertoli cell differentiated genes.
In summary, a critical E-box response element has been identified in the transferrin promoter that can be activated by bHLH factors (e.g. E12) present in Sertoli cells. Inhibition of Sertoli bHLH factors by Id suppresses Sertoli cell differentiated function (i.e. transferrin expression), suggesting that bHLH transcription factors may be important in regulating Sertoli cell differentiated functions.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
bHLH proteins are a class of transcription factors previously shown to be involved in cell-specific transcriptional control in a number of tissues, including muscle and brain (22, 23, 24, 25). An example in muscle is a family of bHLH transcription factors (i.e. the MyoD family) that when expressed are sufficient to orchestrate the coordinated expression of most, if not all, muscle differentiated functions (26). Overexpression of MyoD-related genes can cause a fibroblast cell to turn into a muscle cell (27). Another example is NeuroD, which promotes neural cell differentiation and phenotype (28). These and a number of other observations have suggested that basic HLH transcription factors play important roles during development in many organs. An example relevant to the current study is the requirement for bHLH proteins in sex determination and gonadal development in Drosophila (29, 30). This observation provides additional support for the proposed hypothesis of an important role for bHLH factors in Sertoli cell differentiation.
The bHLH proteins have a conserved helix-loop-helix domain essential for dimerization of different bHLH proteins as well as a basic domain that mediates DNA binding to a common hexanucleotide sequence (CANNTG) known as the E-box. An inhibitory class of HLH proteins (Id) lacks the basic region and prevents DNA binding after dimerization with a bHLH protein (31, 32). Therefore, Id negatively regulates bHLH proteins by preventing them from binding to DNA. The bHLH proteins generally form heterodimers between ubiquitously expressed bHLH proteins, such as E12 or E47, and cell-specific bHLH proteins, such as MyoD for muscle development or NeuroD for neural development. The bHLH heterodimer formed will then bind to an E-box response element and promote cell- or tissue-specific gene expression. Often factors that influence cell proliferation will influence bHLH expression (33, 34). The results presented here suggest that hormones and a paracrine factor produced by peritubular cells may influence Sertoli cell differentiated function (e.g. Tf expression) through bHLH-type transcription factors.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids
The E-box-chloramphenicol acetyltransferase (CAT) reporter
plasmid was constructed by ligating the Tf E-box oligonucleotide
(CATCTG; 15 bp flanking on either side) at the HindIII site
in the pCAT enhancer (Promega, Madison, WI) plasmid. The -581-bp mouse
Tf (mTf)-CAT reporter plasmid (pUC8-CAT) and the human GH reporter
plasmid containing the -3.0 kilobase (kb) sequence of the mTf promoter
were provided by Dr. G. Stanley McKnight (University of Washington,
Seattle, WA). The CAT reporter plasmid used in the current study
containing -2.6-kb mTf promoter was constructed by ligating the 2-kb
upstream HindIII-HindIII fragment from the 3-kb
mTf promoter in the upstream HindIII site of -581 bp
mTf-CAT (21). The pREP Id-1S (Id-1 sense), pREP Id-1AS (Id-antisense),
and recombinant E12 were provided by Dr. Jay Cross (McGill University,
Montreal, Canada). The GST-Id-2 fusion plasmid was kindly provided by
Dr. Mark Israel (University of California-San Francisco).
Transfections and CAT assays
Sertoli cells cultured for 48 h were transfected with a
reporter gene construct by the calcium phosphate method coupled with
hyperosmotic shock (10% glycerol) as previously described (37) for
Sertoli cells (21). Various treatments were subsequently added, and
cells were incubated for an additional 72 h before harvesting for
CAT assays. Assay of CAT activity was performed with the
[14C]chloramphenicol conversion, as previously described
(21). The average conversion of CAT substrate for treated cells ranged
between 20–30% conversion. This assay was linear with the protein
concentration used.
Gel mobility shift assay
Gel shift assays were performed with nuclear extracts of
isolated Sertoli cells. The Sertoli cells were isolated as described
above and cultured in 150 x 20-mm tissue culture dishes
(Nunclon). The cells were treated after 48 h in culture with FSH
or S300; controls were not treated. After 72 h, the cells were
scrapped off the tissue culture dishes and washed once with PBS. The
nuclear extracts of these cells were then prepared as described by
Guillou et al. (38). Typically, 70–100 µg protein were
obtained from 108 plated cells. The 35S-labeled
nuclear protein was obtained by culturing the cells in Ham’s F-12
lacking cysteine and methionine. 35S-Labeled cysteine and
methionine were added, and the cells were cultured, and nuclear
extracts were prepared as described above. The double stranded DNA
probes used in gel retardation assays were the Tf E-box (CATCTG)
containing flanking sequence (CCGGGCTCCATCTGCAGCCT), muscle
creatine kinase (MCK) E-box (CACCTG) containing flanking sequence
(GATCCCCCCAACACCTGCTGCCTGA), mutated Tf E-box (CGCCGG)
containing flanking sequence (CGGGCTGCGCCGGGAGCCCGG),
mutated MCK E-box (CGCCGT) containing flanking sequence
(GATCCCCCCAACGCCGTCTGCCTGA), and the Sertoli element 2 (SE2)
fragment of the mTf promoter (between -1763 and -1514 bp). The single
stranded oligonucleotides were 5'-32P end-labeled with
[
-32P]ATP (150 µCi/µl; New England Nuclear,
Boston, MA) and polynucleotide kinase. The complementary
oligonucleotides were annealed, electrophoretically purified, and used
as probes in gel shift assays. The SE2 fragment was first
dephosphorylated with alkaline phosphatase and then phosphorylated
using [-32P]ATP (150 µCi/µl) and polynucleotide
kinase. The labeled fragment was electrophoretically purified and used
as a probe.
The gel retardation assay used was a modification of the protocol
described by Garner and Rezvin (39). The final reaction volume of 20
µl contained 0.5 ng (
50,000 cpm) 5'-32P-labeled double
stranded probe, 100 ng sonicated salmon sperm DNA, 2 µg poly(dI-dC)
(U.S. Biochemical Corp., Cleveland, OH), 20 µg BSA, 20 mM
HEPES (pH 8.0), 4 mM Tris (pH 7.9), 50 mM KCl,
600 µM EDTA and EGTA, 500 µM
dithiothreitol, and 5 µg Sertoli cell nuclear proteins. After
incubation at room temperature for 20 min, 5 µl of the reaction were
electrophoretically separated on a nondenaturing 5% polyacrylamide gel
in 0.5 x TBE. The gel was dried and autoradiographed. For the
competition experiments, excess unlabeled oligonucleotide was added in
the binding reaction. To analyze the number of proteins binding to the
Tf E-box, gel shift was performed using 35S-labeled nuclear
extracts from Sertoli cells treated with S300. The retarded gel shift
band was isolated, and the protein-DNA complexes within gel slices were
then resolved by SDS-PAGE and visualized by autoradiography.
Ligand and Western blots
Ten micrograms of Sertoli cell nuclear proteins were
size-fractionated on a 12% discontinuous SDS-polyacrylamide gel. The
proteins were then transferred to 0.2-µm nitrocellulose membranes
(BA83, Schleicher and Schuell, Keene, NH). These membranes were used
for ligand and Western blots.
Ligand blot.
A ligand blot using labeled E12 was used to
study the presence of bHLH proteins in Sertoli cell nuclear extracts.
The membrane was blocked with 5% milk-HBB buffer (20 mM
HEPES, pH 7.7; 5 mM MgCl2; 25 mM
NaCl; and 1 mM dithiothreitol) before probing with
recombinant -32P-labeled E12 in Hyb75 buffer (20
mM HEPES-KOH, pH 7.7; 75 mM KCl; 0.1
mM EDTA; 2.5 mM MgCl2; 1% milk; 1
mM dithiothreitol; and 0.05% Nonidet P-40). The
recombinant E12 fusion protein contained the bHLH domain of hamster sh
PAN-2 (amino acids 509–649 with mutations R554A and R556A) fused to a
heart muscle kinase recognition sequence (40). This E12 fusion protein
was phosphorylated by heart muscle kinase in the presence of
[-32P]ATP.
Western blot.
Western blot analysis using an antibody to
human E12 (SC 762, Santa Cruz Biotechnology, Santa Cruz, CA) was
performed to identify E12 in Sertoli cell nuclear extracts. The
membranes were probed for 3 h at room temperature with the E12
antibody. Antigen-antibody complexes were identified using an enhanced
chemiluminescence detection system (Amersham, Arlington Heights, IL)
according to the manufacturer’s instructions.
To determine whether E12 is one of the components of the complex binding to the E box during gel shifts, the retarded gel shift band was excised and loaded onto a 12% SDS-polyacrylamide gel. The size-fractionated proteins were then transferred to a 0.2-µm nitrocellulose membrane and probed with E12 antibody as indicated above.
Statistical analysis
All data were obtained from a minimum of three different
experiments unless otherwise stated. Each data point was converted to a
relative CAT activity, with the mean and SEM from multiple
experiments determined as indicated in the figure legends. Data were
analyzed by Student’s t test as indicated in the figure
legends.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
SE2 did not contain any other common response element sequences. A
comparison of the Tf E-box sequence to other known E-box sequences
(consensus CANNTG) revealed its presence in other promoters, such as
the c-fos promoter, which can respond to bHLH (41, 42). A
computerized data bank search revealed that putative E-box response
element sequences are present in the promoters of a number of Sertoli
cell-specific genes (Table 1). However, the functional
significance of these E-box elements remains to be determined. These
genes may have the ability to respond to bHLH proteins, but this needs
to be investigated.
|
|
, a gel shift was observed when a radiolabeled Tf E-box
oligonucleotide, including flanking region, was used as a probe in the
binding reaction with nuclear extracts from PModS (S300)- and
FSH-stimulated Sertoli cells. PModS (S300) is a gel filtration fraction
preparation of PModS from serum-free concentrated peritubular cell
secreted proteins that has been shown previously to dramatically
stimulate Sertoli cell differentiated functions (21). The presence of a
single shifted band suggests that FSH and PModS (S300) promote and
maintain the expression of Sertoli cell E-box binding proteins, which
will include bHLH proteins. A similar band shift was not observed in
untreated control Sertoli cells cultured in the absence of FSH or PModS
(S300). However, an Oct-1 gel shift was observed, demonstrating the
integrity of the nuclear extracts. The transcription factors that bind
an Oct-1 oligonucleotide are abundant and provide a useful procedure to
monitor the integrity of nuclear extracts and help normalize gel shift
data. As previously shown, Sertoli cell number and viability did not
change during the culture period whether cells were cultured in the
absence or presence of FSH or PModS (S300). An E-box gel shift was also
detected in the nuclear extracts of Sertoli cells freshly isolated from
20-day-old midpubertal rats (Fig. 2). Therefore, the lack of a gel
shift in control cultured Sertoli cells was due to an apparent loss of
bHLH proteins during culture. Sertoli cell differentiated functions are
known to decline in control untreated cultures (19, 20). The
specificity of the gel shift was determined by using excess unlabeled
Tf E-box oligonucleotide in the binding reaction. As shown in Fig. 3, the unlabeled Tf E-box oligo at a 100-fold molar
excess was able to completely abolish the observed gel shift.
Concentrations of unlabeled competitor less than a 100-fold molar
excess resulted in partial displacement (data not shown). Excess
unlabeled SE2 was also able to displace the gel shift observed with
labeled Tf E-box (Fig. 3A). As previously shown (21), the SE2 fragment
of the Tf promoter located at -1763 to -1514 bp was able to cause a
gel shift when incubated with nuclear extracts of Sertoli cells treated
with PModS (S300). This shift appeared to be due to the Tf E-box
sequence (CATCTG) present in SE2 between -1587 bp to -1582 bp.
Addition of excess unlabeled Tf E-box in the binding reaction abolished
the SE2 gel shift (Fig. 3B). Excess unlabeled Oct-1 had no effect on
the gel shift (data not shown). Taken together, the observations
suggest that the gel shift observed with SE2 is due to the Tf E-box
sequence. Whether the multiple bands in Fig. 3B were due to proteolytic
degradation of the nuclear extract or different protein shifts remains
to be determined; however, all were competed with the unlabeled
E-box.
|
|
). A control of isolating a comparable
band from a displaced gel shift was also run and showed no radiolabeled
proteins (data not shown). The width of the well and the salt
concentration needed to permit loading of sufficient amounts of sample
caused a distortion in the bands compared with crude extracts. The
E-box proteins detected were not prominent bands in the crude extract.
The observation suggests that multiple proteins appear to associate and
bind to the Tf E-box oligo nucleotide duplex. However, the specificity
of binding of these various proteins needs to be determined. A Western
blot of this gel with an E12 antibody revealed that the 70-kDa protein
was E12 (Fig. 4). A smaller 29-kDa band observed in the Western blot of
the crude extract was probably a proteolytic fragment of E-12 not
capable of binding the E-box. Recently, we also showed the presence of
E12 by reverse transcription-PCR in Sertoli cells using rat E12 primers
(data not shown). The 42- and 25-kDa proteins remain to be identified.
The bands observed at 14 kDa may be a proteolytic fragment of the
larger proteins and was not always detected. Observations from the SDS
gel imply that multiple proteins may be involved in the Tf E-box gel
shift.
|
, a number of different bands were observed,
indicating that Sertoli cells contain proteins that can dimerize with
E12. A control with denatured E12 showed no nonspecific binding (data
not shown). The demonstration of specific binding with displacement of
unlabeled E12 remains to be performed. This observation supports the
E-box gel shift data and also suggests that bHLH proteins may be
present in Sertoli cells.
|
, a gel shift was observed when either MCK E-box or Tf
E-box was used as probes, and the gel shifts could be displaced by
adding excess unlabeled MCK E-box or Tf E-box. This suggests that the
Sertoli bHLH proteins have binding properties to the Tf E-box similar
to those to the MCK E-box and further strengthens the observations that
the Tf E-box is active, and bHLH proteins are present in Sertoli
cells.
|
, these mutated
E-box oligonucleotide duplex DNA fragments could not promote a gel
shift with Sertoli cell nuclear extracts. The mutated E-box fragments
also could not displace the Sertoli bHLH gel shifts promoted with
intact Tf E-box or MCK E-box sequences (Fig. 7). Therefore, the
critical nucleotides in the (CANNTG) E-box consensus sequence are
functionally important for the Tf E-box sequence.
|
, the presence of the GST-Id inhibited the ability
of a Tf E-box gel shift to form. The GST-Id protein alone also did not
cause a gel shift, as expected. A control gel shift with Oct-1 was not
effected by the GST-Id construct. Therefore, the presence of Id can
prevent the Sertoli bHLH proteins from binding to the Tf E-box. This
information was then used to design an experiment to inhibit Sertoli
bHLH protein actions in vitro.
|
). Relative CAT activity is based
on levels of CAT in transfected control unstimulated cells set at 1.0.
When Id was overexpressed in the Sertoli cells, approximately a 50%
inhibition in the ability of PModS (S300) to activate Tf-CAT was
observed (Fig. 9). In contrast, the control antisense Id had no effect
on PModS (S300)-induced Tf-CAT activity. Similar observations were
found with FSH-stimulated Sertoli cells (Fig. 9). Therefore, the
presence of Id inhibited the Sertoli cell E-box binding proteins
(e.g. bHLH) from binding to the Tf E-box and activating the
Tf promoter.
|
). A CAT plasmid not
containing the E-box was also transfected as a control (data not
shown), and the CAT activity of this control plasmid was subtracted
from the CAT activity associated with the E-box CAT construct. The
stimulation of the E-box-CAT construct (Fig. 10) confirms that FSH and
PModS (S300) can induce the apparent production and/or activation of
Sertoli cell bHLH proteins and that the Sertoli cell bHLH proteins
identified are functionally active. This observation also supports a
role for bHLH proteins in the control of Sertoli cell differentiated
functions.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Sertoli cells have a large number of differentiated functions that generally increase to optimal levels during pubertal development. Previously, Tf expression was shown to be a useful marker of Sertoli cell differentiation and is stimulated by regulatory agents known to promote Sertoli cell differentiation (7). To investigate the transcriptional regulation of Sertoli cell differentiation, the promoters for various Sertoli cell genes have been analyzed, including the Tf promoter (15, 46, 47, 48, 49). Analysis of the proximal 600-bp human Tf promoter demonstrated a distinct regulation between hepatocytes and Sertoli cells (48, 49). The current study investigated the 3-kb mTf promoter and focused on two response elements previously shown to be critical, termed SE1 and SE2 (21, 45). Previously, the peritubular cell product PModS was found to promote a gel shift and activate SE1 and SE2 (21). In the current study, FSH was also found to promote a gel shift with SE2. Sequence analysis demonstrated that SE1 did not contain any known response element sequences (data not shown); however, SE2 was found to contain an E-box (CATCTG) sequence.
The E-box is the response element used by the bHLH class of transcription factors. The Sertoli cell nuclear extract SE2 gel shift could be displaced with a consensus E-box oligonucleotide. In addition, a consensus E-box oligonucleotide promoted a gel shift that could be displaced with SE2. A mutant E-box could not promote a gel shift or displace the SE2 or E-box gel shifts. Therefore, the E-box appears to be the response element in SE2 responsible for the gel shift and activation of the Tf promoter. Previously, deletion mutant analysis demonstrated that a promoter construct containing SE2 was the most active region in the Tf promoter (21). Whether SE2 may interact with other elements, such as SE1, remains to be investigated. Interestingly, a computerized data search of the promoter sequences of a number of other Sertoli differentiated genes demonstrated that putative E-box elements are present in all of those examined. This included embryonic genes, such as SRY and Mullerian inhibitory substance, and adult functional genes, such as androgen-binding protein and inhibin/activin. The demonstration of a critical E-box element in the Tf promoter as well as potential elements in other Sertoli cell genes led to the hypothesis that bHLH proteins may be involved in Sertoli cell differentiation.
The bHLH class of transcription factors has been shown to induce and regulate the differentiation of a number of tissues and cell types (22, 23, 24, 25). Examples include the MyoD family, which promotes muscle cell differentiation (22, 23, 26), and NeuroD, which promotes neural cell differentiation (28). Therefore, cell-specific bHLH proteins can promote cell-specific differentiation. The possibility that Sertoli cell differentiation may be influenced by bHLH proteins was initially investigated by identifying the presence of Sertoli cell bHLH proteins. The ability of Sertoli cell nuclear extracts to promote an E-box gel shift confirmed the presence of bHLH proteins in Sertoli cells. Both PModS (S300)- and FSH-treated Sertoli cells promoted an E-box gel shift, whereas control nontreated cultures had no gel shift. This observation supports a role for bHLH proteins in Sertoli cells, as both PModS (S300) and FSH influence Sertoli cell differentiation. The midpubertal 20-day-old rat Sertoli cells are differentiated in vivo, so they would be expected potentially to have bHLH proteins. Nuclear extracts from freshly isolated Sertoli cells did cause an E-box gel shift. Therefore, nontreated control cultured Sertoli cells appear to have lost the ability to produce the bHLH proteins that promote the gel shift. This correlates with the low level of differentiated function in control Sertoli cell cultures previously identified (19, 20, 21).
The E-box element in the Tf promoter was found to be nonpalindromic (CATCTG) compared with the E-box in MCK (CACCTG), which is palindromic. Previously, bHLH proteins have been classified according to the ability to bind specific E-box sequences (50, 51). Class A binds predominantly palindromic sequences (e.g. MyoD family), and class B binds predominantly nonpalindromic sequences (e.g. myc). Class C has unique structural properties in the bHLH domains involving the presence of proline residues (e.g. HES1 and Hairy) (51). The ability of the Sertoli cell bHLH proteins to bind the nonpalindromic Tf E-box in a similar manner as the palindromic MCK E-box suggests that the Sertoli bHLH proteins have both class A- and B-type bHLH binding properties. Further characterization of the Sertoli cell bHLH proteins is necessary to confirm the class to which these bHLH proteins belong.
The ligand blot suggested the presence of bHLH proteins in Sertoli cells and that FSH and PModS (S300) can stimulate the presence of E-12 binding proteins in Sertoli cells. The E-box gel shift contained at least three radiolabeled Sertoli cell nuclear proteins of 70, 42, and 25 kDa. Whether all of these proteins are bHLH proteins, whether some are not bHLH proteins but associate with the protein complex, and/or whether the small proteins are proteolytic products of the larger proteins remains to be investigated. Previously characterized bHLH proteins range from 15–50 kDa in size. The 70-kDa protein was probably E-12, as demonstrated in the Western blot. These observations imply that bHLH proteins are present in Sertoli cells, and they have the ability to heterodimerize with E12 and bind to an E-box.
The functional significance of Sertoli bHLH proteins was investigated with the use of the inhibitory bHLH protein Id. Id lacks a basic region, so upon dimerization with bHLH proteins, it prevents binding to DNA. Initial experiments with recombinant Id demonstrated that the presence of Id displaced the Sertoli cell bHLH proteins from the Tf E-box gel shift. Therefore, Id can act as an inhibitory bHLH protein in Sertoli cells. An expression plasmid was then transfected into Sertoli cells to overexpress Id. Overexpression of Id was found to inhibit the ability of both FSH and PModS (S300) to stimulate Sertoli cell differentiation, as measured with a Tf promoter-CAT construct. This provides direct evidence that the Sertoli bHLH proteins are involved in the promotion of Sertoli cell differentiation. An additional experiment used an E-box-CAT construct transfected into Sertoli cells. Both FSH and PModS (S300) stimulated the E-box CAT activity. Therefore, the E-box in Sertoli cells is active and induced when the cells are stimulated to differentiate.
Combined observations demonstrate that the bHLH proteins present in Sertoli cells have a functional role in regulating Sertoli cell differentiation, as measured by Tf gene expression. The current study provides information regarding the progression of Sertoli cell differentiation during pubertal development and the maintenance of differentiation in the adult. Whether bHLH proteins have an important role in embryonic Sertoli cell differentiation is currently under investigation. Characterization of the bHLH proteins in Sertoli cells is also currently under investigation. It will be of particular interest to detemine whether Sertoli cell-specific bHLH proteins are present and promote Sertoli cell differentiation. Further analysis of the Sertoli cell bHLH proteins and their roles in the induction, progression, and maintenance of differentiation is anticipated to provide insight into the transcriptional control of Sertoli cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 23, 1996.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  T. Muir, I. Sadler-Riggleman, and M. K. Skinner Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation Mol. Endocrinol., August 1, 2005; 19(8): 2164 - 2174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Chaudhary, I. Sadler-Riggleman, J. M. Ague, and M. K. Skinner The Helix-Loop-Helix Inhibitor of Differentiation (ID) Proteins Induce Post-Mitotic Terminally Differentiated Sertoli Cells to Re-Enter the Cell Cycle and Proliferate Biol Reprod, May 1, 2005; 72(5): 1205 - 1217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-Y. Li, G. Ram, K. Gast, X. Chen, K. Barasch, K. Mori, K. Schmidt-Ott, J. Wang, H.-C. Kuo, C. Savage-Dunn, et al. Detection of intracellular iron by its regulatory effect Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1547 - C1559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Scobey, C. A. Fix, and W. H. Walker The Id2 Transcriptional Repressor Is Induced by Follicle-stimulating Hormone and cAMP J. Biol. Chem., April 16, 2004; 279(16): 16064 - 16070. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Buzzard, N. G. Wreford, and J. R. Morrison Thyroid Hormone, Retinoic Acid, and Testosterone Suppress Proliferation and Induce Markers of Differentiation in Cultured Rat Sertoli Cells Endocrinology, September 1, 2003; 144(9): 3722 - 3731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. W. Braun, M.-N. Vo, and K. H. Kim Positive Regulation of Retinoic Acid Receptor Alpha by Protein Kinase C and Mitogen-Activated Protein Kinase in Sertoli Cells Biol Reprod, July 1, 2002; 67(1): 29 - 37. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Anway, D. S. Johnston, D. Crawford, and M. D. Griswold Identification of a Novel Retrovirus Expressed in Rat Sertoli Cells and Granulosa Cells Biol Reprod, October 1, 2001; 65(4): 1289 - 1296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chaudhary and M. K. Skinner Role of the Transcriptional Coactivator CBP/p300 in Linking Basic Helix-Loop-Helix and CREB Responses for Follicle-Stimulating Hormone-Mediated Activation of the Transferrin Promoter in Sertoli Cells Biol Reprod, August 1, 2001; 65(2): 568 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chaudhary, J. Johnson, G. Kim, and M. K. Skinner Hormonal Regulation and Differential Actions of the Helix-Loop-Helix Transcriptional Inhibitors of Differentiation (Id1, Id2, Id3, and Id4) in Sertoli Cells Endocrinology, May 1, 2001; 142(5): 1727 - 1736. [Abstract] [Full Text]
|
|
|
|
|
|
J. Chaudhary and M. K. Skinner Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells Mol. Endocrinol., May 1, 1999; 13(5): 774 - 786. [Abstract] [Full Text]
|
|
|
|
|
|
