Endocrinology Vol. 138, No. 2 667-675
Copyright © 1997 by The Endocrine Society
Role of Basic-Helix-Loop-Helix Transcription Factors in Sertoli Cell Differentiation: Identification of an E-Box Response Element in the Transferrin Promoter1
Jaideep Chaudhary,
Andrea S. Cupp and
Michael K. Skinner
Reproductive Endocrinology Center, University of California, San
Francisco, California 94143-0556
Address all correspondence and requests for reprints to: Dr. Michael K. Skinner, Department of Genetics and Cell Biology, Washington State University, Pullman Washington, 99164.
 |
Abstract
|
|---|
Sertoli cells are critical for testicular function and maintenance of
the spermatogenic process. The induction of Sertoli cell
differentiation in the embryo promotes testicular development and male
sex determination. The progression of Sertoli cell differentiation
during puberty promotes the onset of spermatogenesis. The maintenance
of optimal Sertoli cell differentiation in the adult is required for
spermatogenesis to proceed. The current study was designed to
investigate the transcriptional regulation of Sertoli cell
differentiation through the analysis of a previously identified marker
of differentiation, transferrin gene expression. Sertoli cells produce
transferrin to transport iron to developing spermatogenic cells
sequestered within the blood-testis barrier.
The transferrin promoter was characterized and found to contain two
critical response elements, designated Sertoli element 1 (SE1) and
Sertoli element 2 (SE2). Through sequence analysis, SE2 was found to
contain an E-box response element, which has been shown to respond to
basic-helix-loop-helix (bHLH) transcription factors. The bHLH proteins
are a class of transcription factors associated with the induction and
progression of cell differentiation. bHLH proteins dimerize through the
conserved helix-loop-helix region and bind DNA through the basic
region. Nuclear extracts from Sertoli cells were found to cause an
E-box gel shift when the cells were stimulated to differentiate in
culture, but not under basal conditions. The SE2 gel shift of Sertoli
nuclear extracts was competed with excess unlabeled SE2 or E-box DNA
fragments. Several Sertoli nuclear proteins associate with the SE2 gel
shifts, including 70-, 42-, and 25-kDa proteins. Therefore, the
critical SE2 element in the transferrin promoter is an E-box element
capable of binding bHLH transcription factors. The ubiquitously
expressed E12 bHLH protein dimerizes with numerous cell-specific bHLH
factors. A Western blot analysis demonstrated that E12 was present in
Sertoli cell nuclear extracts and associated with the SE2 gel shift. A
ligand blot of Sertoli cell nuclear extracts with radiolabeled E12 had
apparent bHLH proteins when the cells were stimulated to differentiate.
The E-box sequence in the SE2 fragment of the transferrin promoter was
CATCTG and was similar in gel shifts to the consensus E-box elements
(CANNTG) previously characterized. A bHLH inhibitory factor (Id)
competed and inhibited formation of the Sertoli cell nuclear extract
E-box gel shift. To extend this observation, Id protein was
overexpressed in cultured Sertoli cells. A transferrin promoter
chloramphenicol acetyltransferase construct was used to monitor Sertoli
cell function. The presence of Id suppressed the activation of the
promoter induced by Sertoli differentiation factors. Therefore, the
inhibition of Sertoli bHLH factors by Id suppressed Sertoli cell
differentiated function, as measured by transferrin expression. An
E-box-chloramphenicol acetyltransferase construct was also found to be
active in Sertoli cells when cells were induced to differentiate.
Screening the computerized nucleotide data bases demonstrated that
putative E-box response elements are present in the promoters of a
large number of Sertoli cell differentiated genes.
In summary, a critical E-box response element has been identified in
the transferrin promoter that can be activated by bHLH factors
(e.g. E12) present in Sertoli cells. Inhibition of
Sertoli bHLH factors by Id suppresses Sertoli cell differentiated
function (i.e. transferrin expression), suggesting that
bHLH transcription factors may be important in regulating Sertoli cell
differentiated functions.
 |
Introduction
|
|---|
THE SERTOLI cells (1, 2) form the basal and
apical surface of the seminiferous tubule and provide the
cytoarchitectural arrangements for the developing germinal cells (3).
Tight junctional complexes between the Sertoli cells contribute to the
maintenance of a blood-testis barrier (4) and create a unique
environment within the tubule (5). Due to the blood-testis barrier,
Sertoli cells produce a number of transport proteins to deliver
nutrients to germ cells (6), including transferrin (Tf) to transport
iron (7). As the Sertoli cell differentiates during pubertal
development, differentiated functions, such as Tf expression, increase
and are optimal in the adult to maintain testicular function. Although
a number of factors have been shown to influence Sertoli differentiated
function, the transcriptional regulation of Sertoli cell
differentiation has not been rigorously investigated. Several genes
that are apparently involved in initial determination of Sertoli cell
fate are SRY (8), Wilms tumor antigen (9), and possibly Pax-2 (10),
but the specific mechanisms and factors involved in detemination of the
fate of the Sertoli cell are unknown. FSH has a role in the progression
of Sertoli differentiation and can regulate genes through cAMP response
elements (11) as well as promote immediate early genes, such as
c-fos (12, 13, 14). Another approach has been to examine the
regulation of promoters of Sertoli cell-specific genes, such as Tf
(15), FSH receptor (16), and androgen-binding protein (17). However,
Sertoli cell-specific transcription factors and response elements
remain to be fully elucidated. PModS is a testicular paracrine factor
produced by peritubular myoid cells (18, 19) that has been shown to
influence Sertoli cell differentiated function (19, 20). Recently, a
PModS preparation has been shown to act on the Sertoli cell by inducing
c-fos expression involving the serum response element of the
c-fos promoter and intermediate transcription factors acting
at unique response elements on the Tf promoter (21). The current study
characterized these Tf promoter response elements and investigated the
intermediate transcription factors. One of the response elements on the
Tf promoter was identified as an E-box sequence that binds
basic-helix-loop-helix (bHLH) transcription factors.
bHLH proteins are a class of transcription factors previously shown to
be involved in cell-specific transcriptional control in a number of
tissues, including muscle and brain (22, 23, 24, 25). An example in muscle is a
family of bHLH transcription factors (i.e. the MyoD family)
that when expressed are sufficient to orchestrate the coordinated
expression of most, if not all, muscle differentiated functions (26).
Overexpression of MyoD-related genes can cause a fibroblast cell to
turn into a muscle cell (27). Another example is NeuroD, which promotes
neural cell differentiation and phenotype (28). These and a number of
other observations have suggested that basic HLH transcription factors
play important roles during development in many organs. An example
relevant to the current study is the requirement for bHLH proteins in
sex determination and gonadal development in Drosophila (29, 30). This observation provides additional support for the proposed
hypothesis of an important role for bHLH factors in Sertoli cell
differentiation.
The bHLH proteins have a conserved helix-loop-helix domain essential
for dimerization of different bHLH proteins as well as a basic domain
that mediates DNA binding to a common hexanucleotide sequence (CANNTG)
known as the E-box. An inhibitory class of HLH proteins (Id) lacks the
basic region and prevents DNA binding after dimerization with a bHLH
protein (31, 32). Therefore, Id negatively regulates bHLH proteins by
preventing them from binding to DNA. The bHLH proteins generally form
heterodimers between ubiquitously expressed bHLH proteins, such as E12
or E47, and cell-specific bHLH proteins, such as MyoD for muscle
development or NeuroD for neural development. The bHLH heterodimer
formed will then bind to an E-box response element and promote cell- or
tissue-specific gene expression. Often factors that influence cell
proliferation will influence bHLH expression (33, 34). The results
presented here suggest that hormones and a paracrine factor produced by
peritubular cells may influence Sertoli cell differentiated function
(e.g. Tf expression) through bHLH-type transcription
factors.
 |
Materials and Methods
|
|---|
Cell preparation and culture
Sertoli cells were isolated from the testis of 20-day-old rats
by sequential enzymatic digestion (35) with a modified procedure
described by Tung et al. (36). Decapsulated testis fragments
were digested first with trypsin (1.5 mg/ml; Life Technologies,
Gaithersburg, MD) to remove the interstitial cells and then with
collagenase (1 mg/ml type I; Sigma Chemical Co., St. Louis, MO) and
hyaluronidase (1 mg/ml; Sigma). Sertoli cells were then plated under
serum-free conditions in 24-well Falcon plates (Falcon Plastics,
Oxnard, CA) at 1 x 106 cells/well. Cells were
maintained in a 5% CO2 atmosphere in Hams F-12 medium
(Life Technologies) with 0.01% BSA at 32 C. Sertoli cell were left
untreated (control) or treated with either FSH (100 ng/ml; oFSH-16,
National Pituitary Agency) or PModS (S300; 50 µg/ml). These optimal
concentrations of FSH and PModS (S300) have previously been shown to
dramatically stimulate cultured Sertoli cell differentiated function
(19, 20). The cells were cultured under serum-free conditions for a
maximum of 5 days, with a medium change and treatment after 48 h
of culture. Cell number and viability did not change during culture in
the absence or presence of treatment (19, 20).
Plasmids
The E-box-chloramphenicol acetyltransferase (CAT) reporter
plasmid was constructed by ligating the Tf E-box oligonucleotide
(CATCTG; 15 bp flanking on either side) at the HindIII site
in the pCAT enhancer (Promega, Madison, WI) plasmid. The -581-bp mouse
Tf (mTf)-CAT reporter plasmid (pUC8-CAT) and the human GH reporter
plasmid containing the -3.0 kilobase (kb) sequence of the mTf promoter
were provided by Dr. G. Stanley McKnight (University of Washington,
Seattle, WA). The CAT reporter plasmid used in the current study
containing -2.6-kb mTf promoter was constructed by ligating the 2-kb
upstream HindIII-HindIII fragment from the 3-kb
mTf promoter in the upstream HindIII site of -581 bp
mTf-CAT (21). The pREP Id-1S (Id-1 sense), pREP Id-1AS (Id-antisense),
and recombinant E12 were provided by Dr. Jay Cross (McGill University,
Montreal, Canada). The GST-Id-2 fusion plasmid was kindly provided by
Dr. Mark Israel (University of California-San Francisco).
Transfections and CAT assays
Sertoli cells cultured for 48 h were transfected with a
reporter gene construct by the calcium phosphate method coupled with
hyperosmotic shock (10% glycerol) as previously described (37) for
Sertoli cells (21). Various treatments were subsequently added, and
cells were incubated for an additional 72 h before harvesting for
CAT assays. Assay of CAT activity was performed with the
[14C]chloramphenicol conversion, as previously described
(21). The average conversion of CAT substrate for treated cells ranged
between 2030% conversion. This assay was linear with the protein
concentration used.
Gel mobility shift assay
Gel shift assays were performed with nuclear extracts of
isolated Sertoli cells. The Sertoli cells were isolated as described
above and cultured in 150 x 20-mm tissue culture dishes
(Nunclon). The cells were treated after 48 h in culture with FSH
or S300; controls were not treated. After 72 h, the cells were
scrapped off the tissue culture dishes and washed once with PBS. The
nuclear extracts of these cells were then prepared as described by
Guillou et al. (38). Typically, 70100 µg protein were
obtained from 108 plated cells. The 35S-labeled
nuclear protein was obtained by culturing the cells in Hams F-12
lacking cysteine and methionine. 35S-Labeled cysteine and
methionine were added, and the cells were cultured, and nuclear
extracts were prepared as described above. The double stranded DNA
probes used in gel retardation assays were the Tf E-box (CATCTG)
containing flanking sequence (CCGGGCTCCATCTGCAGCCT), muscle
creatine kinase (MCK) E-box (CACCTG) containing flanking sequence
(GATCCCCCCAACACCTGCTGCCTGA), mutated Tf E-box (CGCCGG)
containing flanking sequence (CGGGCTGCGCCGGGAGCCCGG),
mutated MCK E-box (CGCCGT) containing flanking sequence
(GATCCCCCCAACGCCGTCTGCCTGA), and the Sertoli element 2 (SE2)
fragment of the mTf promoter (between -1763 and -1514 bp). The single
stranded oligonucleotides were 5'-32P end-labeled with
[
-32P]ATP (150 µCi/µl; New England Nuclear,
Boston, MA) and polynucleotide kinase. The complementary
oligonucleotides were annealed, electrophoretically purified, and used
as probes in gel shift assays. The SE2 fragment was first
dephosphorylated with alkaline phosphatase and then phosphorylated
using [
-32P]ATP (150 µCi/µl) and polynucleotide
kinase. The labeled fragment was electrophoretically purified and used
as a probe.
The gel retardation assay used was a modification of the protocol
described by Garner and Rezvin (39). The final reaction volume of 20
µl contained 0.5 ng (
50,000 cpm) 5'-32P-labeled double
stranded probe, 100 ng sonicated salmon sperm DNA, 2 µg poly(dI-dC)
(U.S. Biochemical Corp., Cleveland, OH), 20 µg BSA, 20 mM
HEPES (pH 8.0), 4 mM Tris (pH 7.9), 50 mM KCl,
600 µM EDTA and EGTA, 500 µM
dithiothreitol, and 5 µg Sertoli cell nuclear proteins. After
incubation at room temperature for 20 min, 5 µl of the reaction were
electrophoretically separated on a nondenaturing 5% polyacrylamide gel
in 0.5 x TBE. The gel was dried and autoradiographed. For the
competition experiments, excess unlabeled oligonucleotide was added in
the binding reaction. To analyze the number of proteins binding to the
Tf E-box, gel shift was performed using 35S-labeled nuclear
extracts from Sertoli cells treated with S300. The retarded gel shift
band was isolated, and the protein-DNA complexes within gel slices were
then resolved by SDS-PAGE and visualized by autoradiography.
Ligand and Western blots
Ten micrograms of Sertoli cell nuclear proteins were
size-fractionated on a 12% discontinuous SDS-polyacrylamide gel. The
proteins were then transferred to 0.2-µm nitrocellulose membranes
(BA83, Schleicher and Schuell, Keene, NH). These membranes were used
for ligand and Western blots.
Ligand blot.
A ligand blot using labeled E12 was used to
study the presence of bHLH proteins in Sertoli cell nuclear extracts.
The membrane was blocked with 5% milk-HBB buffer (20 mM
HEPES, pH 7.7; 5 mM MgCl2; 25 mM
NaCl; and 1 mM dithiothreitol) before probing with
recombinant
-32P-labeled E12 in Hyb75 buffer (20
mM HEPES-KOH, pH 7.7; 75 mM KCl; 0.1
mM EDTA; 2.5 mM MgCl2; 1% milk; 1
mM dithiothreitol; and 0.05% Nonidet P-40). The
recombinant E12 fusion protein contained the bHLH domain of hamster sh
PAN-2 (amino acids 509649 with mutations R554A and R556A) fused to a
heart muscle kinase recognition sequence (40). This E12 fusion protein
was phosphorylated by heart muscle kinase in the presence of
[
-32P]ATP.
Western blot.
Western blot analysis using an antibody to
human E12 (SC 762, Santa Cruz Biotechnology, Santa Cruz, CA) was
performed to identify E12 in Sertoli cell nuclear extracts. The
membranes were probed for 3 h at room temperature with the E12
antibody. Antigen-antibody complexes were identified using an enhanced
chemiluminescence detection system (Amersham, Arlington Heights, IL)
according to the manufacturers instructions.
To determine whether E12 is one of the components of the complex
binding to the E box during gel shifts, the retarded gel shift band was
excised and loaded onto a 12% SDS-polyacrylamide gel. The
size-fractionated proteins were then transferred to a 0.2-µm
nitrocellulose membrane and probed with E12 antibody as indicated
above.
Statistical analysis
All data were obtained from a minimum of three different
experiments unless otherwise stated. Each data point was converted to a
relative CAT activity, with the mean and SEM from multiple
experiments determined as indicated in the figure legends. Data were
analyzed by Students t test as indicated in the figure
legends.
 |
Results
|
|---|
Previous analysis of the 3-kb mTf promoter and its deletion
mutants suggested that an upstream 1-kb fragment between -2.5 to -1.5
kb may have an important role in the Sertoli cell-specific expression
of the Tf gene (21). Within this 1-kb region, two potential
cis-acting elements were identified, termed SE1 and SE2,
that complexed Sertoli cell nuclear proteins when the cells were
stimulated with differentiation factors. To further analyze these
response elements, the mTf promoter was sequenced. Interestingly, a
nonpalindrome E-box sequence (CATCTG), termed Tf E-box, was identified
in SE2 located between -1587 and -1582 bp (Fig. 1
).
SE2 did not contain any other common response element sequences. A
comparison of the Tf E-box sequence to other known E-box sequences
(consensus CANNTG) revealed its presence in other promoters, such as
the c-fos promoter, which can respond to bHLH (41, 42). A
computerized data bank search revealed that putative E-box response
element sequences are present in the promoters of a number of Sertoli
cell-specific genes (Table 1
). However, the functional
significance of these E-box elements remains to be determined. These
genes may have the ability to respond to bHLH proteins, but this needs
to be investigated.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. Sequence of SE2 of the mTf promoter. SE2 is
located between -1763 and -1514 bp upstream of the transcriptional
start site on the promoter. The relation to SE1 and the cAMP response
element (CRE) is shown. The E-box response element (CATCTG) located in
SE2 is underlined.
|
|
To address the question of whether bHLH proteins are present in Sertoli
cells, gel shift experiments were initially performed. As shown in Fig. 2
, a gel shift was observed when a radiolabeled Tf E-box
oligonucleotide, including flanking region, was used as a probe in the
binding reaction with nuclear extracts from PModS (S300)- and
FSH-stimulated Sertoli cells. PModS (S300) is a gel filtration fraction
preparation of PModS from serum-free concentrated peritubular cell
secreted proteins that has been shown previously to dramatically
stimulate Sertoli cell differentiated functions (21). The presence of a
single shifted band suggests that FSH and PModS (S300) promote and
maintain the expression of Sertoli cell E-box binding proteins, which
will include bHLH proteins. A similar band shift was not observed in
untreated control Sertoli cells cultured in the absence of FSH or PModS
(S300). However, an Oct-1 gel shift was observed, demonstrating the
integrity of the nuclear extracts. The transcription factors that bind
an Oct-1 oligonucleotide are abundant and provide a useful procedure to
monitor the integrity of nuclear extracts and help normalize gel shift
data. As previously shown, Sertoli cell number and viability did not
change during the culture period whether cells were cultured in the
absence or presence of FSH or PModS (S300). An E-box gel shift was also
detected in the nuclear extracts of Sertoli cells freshly isolated from
20-day-old midpubertal rats (Fig. 2
). Therefore, the lack of a gel
shift in control cultured Sertoli cells was due to an apparent loss of
bHLH proteins during culture. Sertoli cell differentiated functions are
known to decline in control untreated cultures (19, 20). The
specificity of the gel shift was determined by using excess unlabeled
Tf E-box oligonucleotide in the binding reaction. As shown in Fig. 3
, the unlabeled Tf E-box oligo at a 100-fold molar
excess was able to completely abolish the observed gel shift.
Concentrations of unlabeled competitor less than a 100-fold molar
excess resulted in partial displacement (data not shown). Excess
unlabeled SE2 was also able to displace the gel shift observed with
labeled Tf E-box (Fig. 3A
). As previously shown (21), the SE2 fragment
of the Tf promoter located at -1763 to -1514 bp was able to cause a
gel shift when incubated with nuclear extracts of Sertoli cells treated
with PModS (S300). This shift appeared to be due to the Tf E-box
sequence (CATCTG) present in SE2 between -1587 bp to -1582 bp.
Addition of excess unlabeled Tf E-box in the binding reaction abolished
the SE2 gel shift (Fig. 3B
). Excess unlabeled Oct-1 had no effect on
the gel shift (data not shown). Taken together, the observations
suggest that the gel shift observed with SE2 is due to the Tf E-box
sequence. Whether the multiple bands in Fig. 3B
were due to proteolytic
degradation of the nuclear extract or different protein shifts remains
to be determined; however, all were competed with the unlabeled
E-box.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 2. A Tf E-box (Tf-E-box) gel shift with Sertoli cell
nuclear extracts from control unstimulated cells, PModS (S300)- or
FSH-treated cells, and freshly isolated Sertoli cells from 20-day-old
rats (Fresh). Right, The gel shift with the Tf-E-box;
left, the gel shift with Oct-1 oligonucleotide to
confirm nuclear extract integrity. The gel shift is representative of a
minimum of three different experiments.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Figure 3. A, A Tf E-box (E-box) gel shift with Sertoli cell
nuclear extracts from PModS (S300)-treated cells. The gel shift was
displaced with excess unlabeled E-box oligonucleotide duplex DNA or SE2
(200-bp) DNA fragment. The molar ratio of unlabeled excess DNA fragment
is indicated. The gel is a representation of a minimum of three
different experiments. B, An SE2 gel shift with Sertoli cell nuclear
extracts from PModS (S300)-treated cells. The gel shift was displaced
with excess unlabeled Tf E-box (Tf-E-box) with the molar excess
indicated. The gels are representative of a minimum of three different
experiments.
|
|
To characterize the E-box binding proteins in the gel shift, the
proteins associated with the Sertoli cell E-box gel shift were
examined. The gel shift was performed with [35S]cysteine-
and [35S]methionine-radiolabeled nuclear extracts from
Sertoli cells. The shifted band from the gel shift experiment was
isolated and loaded onto a 12% polyacrylimide-SDS gel. A fluorograph
of the gel revealed three consistently detected proteins of 70, 42, and
25 kDa (Fig. 4
). A control of isolating a comparable
band from a displaced gel shift was also run and showed no radiolabeled
proteins (data not shown). The width of the well and the salt
concentration needed to permit loading of sufficient amounts of sample
caused a distortion in the bands compared with crude extracts. The
E-box proteins detected were not prominent bands in the crude extract.
The observation suggests that multiple proteins appear to associate and
bind to the Tf E-box oligo nucleotide duplex. However, the specificity
of binding of these various proteins needs to be determined. A Western
blot of this gel with an E12 antibody revealed that the 70-kDa protein
was E12 (Fig. 4
). A smaller 29-kDa band observed in the Western blot of
the crude extract was probably a proteolytic fragment of E-12 not
capable of binding the E-box. Recently, we also showed the presence of
E12 by reverse transcription-PCR in Sertoli cells using rat E12 primers
(data not shown). The 42- and 25-kDa proteins remain to be identified.
The bands observed at 14 kDa may be a proteolytic fragment of the
larger proteins and was not always detected. Observations from the SDS
gel imply that multiple proteins may be involved in the Tf E-box gel
shift.

View larger version (68K):
[in this window]
[in a new window]
|
Figure 4. A, The radiolabeled (35S-Cys/met)
Sertoli cell nuclear extract proteins that associate with a Tf-E-box
gel shift electrophoretically separated on a SDS gel and fluorographed.
The gel shift-associated proteins are shown in lane 1 (wide
lane), and the total nuclear extract is shown in lane 2. B,
Western blot analysis of Sertoli cell nuclear extracts (lane 1) and the
retarded band of the gel shift assay (lane 2; see Fig. 2 ) using
antibody to human E12. The molecular size in kilodaltons is shown at
the left. The gel is representative of three different
experiments.
|
|
An alternate procedure to identify bHLH proteins in Sertoli cells
involved a ligand blot with a radiolabeled bHLH protein. The Sertoli
cell nuclear extracts were electrophoretically separated on an SDS gel,
blotted onto nitrocellulose, and probed with recombinant radiolabeled
E12. E12 is a ubiquitously expressed bHLH protein found in many tissues
and forms heterodimers with cell-specific bHLH proteins. As shown in
Fig. 5
, a number of different bands were observed,
indicating that Sertoli cells contain proteins that can dimerize with
E12. A control with denatured E12 showed no nonspecific binding (data
not shown). The demonstration of specific binding with displacement of
unlabeled E12 remains to be performed. This observation supports the
E-box gel shift data and also suggests that bHLH proteins may be
present in Sertoli cells.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 5. An E12 radiolabeled ligand blot of Sertoli cell
nuclear extract proteins electrophoretically separated on a SDS gel and
autoradiographed. The Sertoli cell nuclear extracts were isolated from
control untreated (Cont) and PModS (S300)-treated cells. The molecular
size (kilodaltons) is listed at the left. The gel is
representative of three different experiments.
|
|
The Tf E-box has the E-box consensus sequence, but is not palindromic
like the more classical CACCTG or CAGCTG found in the enhancer of MCK
(43) and troponin-1 (44). To investigate whether the bHLH binding
properties to the classical (CACCTG) E-box of MCK are similar to those
of the Tf (CATCTG) E-box, gel shifts were performed in which the MCK
E-box, including flanking region, was used as a probe, and excess
unlabeled Tf E-box was added in the binding reaction. As shown in Fig. 6
, a gel shift was observed when either MCK E-box or Tf
E-box was used as probes, and the gel shifts could be displaced by
adding excess unlabeled MCK E-box or Tf E-box. This suggests that the
Sertoli bHLH proteins have binding properties to the Tf E-box similar
to those to the MCK E-box and further strengthens the observations that
the Tf E-box is active, and bHLH proteins are present in Sertoli
cells.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 6. A gel shift with Tf-E-box or MCK-E-box with
Sertoli cell nuclear extracts from cells treated with PModS (S300).
Excess unlabeled Tf-E-box (Tf) or MCK-E-box (MCK) is indicated and
displaced the gel shift. The gel is representative of three different
experiments.
|
|
Further analysis of the specificity of the Sertoli cell E-box gel shift
used a mutated E-box (CGCCGG) that had alterations in the critical
(CANNTG) E-box sequence. This was performed with both the Tf E-box and
MCK E-box sequences. As shown in Fig. 7
, these mutated
E-box oligonucleotide duplex DNA fragments could not promote a gel
shift with Sertoli cell nuclear extracts. The mutated E-box fragments
also could not displace the Sertoli bHLH gel shifts promoted with
intact Tf E-box or MCK E-box sequences (Fig. 7
). Therefore, the
critical nucleotides in the (CANNTG) E-box consensus sequence are
functionally important for the Tf E-box sequence.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 7. An E-box (E-box) gel shift with Sertoli cell
nuclear extracts from PModS (S300)-treated cells. The Tf-E-box (Tf)
caused a gel shift that could not be displaced with mutated Tf-E-box
(Tf*E-box) or mutated MCK-E-box (MCK*E-box). The mutant Tf E-box (Tf*)
or MCK-E-box (MCK*) also did not cause a gel shift. The gel is
representative of two different experiments.
|
|
To investigate the functional significance of bHLH proteins in Sertoli
cells, the inhibitory bHLH protein Id was used. Recombinant Id protein
was produced in a glutathione transferase (GST) fusion protein
bacterial system. The recombinant GST-Id protein was added to the
binding reaction of a Sertoli E-box gel shift experiment. As shown in
Fig. 8
, the presence of the GST-Id inhibited the ability
of a Tf E-box gel shift to form. The GST-Id protein alone also did not
cause a gel shift, as expected. A control gel shift with Oct-1 was not
effected by the GST-Id construct. Therefore, the presence of Id can
prevent the Sertoli bHLH proteins from binding to the Tf E-box. This
information was then used to design an experiment to inhibit Sertoli
bHLH protein actions in vitro.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 8. A Tf E-box gel shift with Sertoli cell nuclear
extracts from cells treated with PModS (S300) and incubated in the
absence (S300) or presence of GST-Id (S300+GST-Id). GST-Id alone did
not cause a gel shift. The data are representative of two different
experiments.
|
|
To assess the functional significance of bHLH proteins in Sertoli cell
differentiation, the Sertoli cells were cultured and transfected with a
Tf promoter CAT construct (Tf-CAT) as a marker of Sertoli cell
differentiation. The cells were also cotransfected with an Id
expression plasmid driven by the retroviral RSV promoter to overexpress
Id in the Sertoli cells. As a control, both sense Id that generates a
functional protein and antisense Id that generates a nonfunctional
protein were used. As expected, PModS (S300) stimulated the Tf-CAT
activity, reflecting its ability to promote Sertoli cell
differentiation (Fig. 9
). Relative CAT activity is based
on levels of CAT in transfected control unstimulated cells set at 1.0.
When Id was overexpressed in the Sertoli cells, approximately a 50%
inhibition in the ability of PModS (S300) to activate Tf-CAT was
observed (Fig. 9
). In contrast, the control antisense Id had no effect
on PModS (S300)-induced Tf-CAT activity. Similar observations were
found with FSH-stimulated Sertoli cells (Fig. 9
). Therefore, the
presence of Id inhibited the Sertoli cell E-box binding proteins
(e.g. bHLH) from binding to the Tf E-box and activating the
Tf promoter.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 9. The expression of a Tf promoter-CAT (Tf-CAT)
construct in Sertoli cells cultured in the absence (Control) or
presence of PModS (S300) or FSH. CAT activity is expressed as the
relative CAT activity based on the CAT activity in control untreated
cultures, which was set at 1.0. The cells were transfected with Tf-CAT
alone or with Tf-CAT plus Id-sense (Id-S) or Id-antisense (Id-AS)
expression plasmids. This is the mean ± SEM from
three different experiments, performed in duplicate. **,
P < 0.01; ***, P < 0.001
(statistically significant difference from Tf-CAT alone within the
treatment group).
|
|
Another experiment to assess the functional significance of bHLH
proteins in Sertoli cells involved the transient transfection of an
E-box CAT construct. CAT activity is under the control of the E-box and
the binding of bHLH proteins. Cultured Sertoli cells were treated with
regulatory agents to monitor the E-box CAT activity. As found with the
Tf promoter CAT construct above, both FSH and PModS (S300) stimulated
E-box CAT activity (Fig. 10
). A CAT plasmid not
containing the E-box was also transfected as a control (data not
shown), and the CAT activity of this control plasmid was subtracted
from the CAT activity associated with the E-box CAT construct. The
stimulation of the E-box-CAT construct (Fig. 10
) confirms that FSH and
PModS (S300) can induce the apparent production and/or activation of
Sertoli cell bHLH proteins and that the Sertoli cell bHLH proteins
identified are functionally active. This observation also supports a
role for bHLH proteins in the control of Sertoli cell differentiated
functions.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 10. The expression of an E-box-CAT construct (p-CAT
Enh E-box) in Sertoli cells cultured in the absence (Control) or
presence of FSH (FSH) or PModS (S300). CAT activity is expressed as the
relative CAT activity based on that in control untreated cultures,
which was set at 1.0. A representative of three experiments is
presented. ***, P < 0.001 (statistically
significant difference from E-box CAT activity in control cultures).
|
|
 |
Discussion
|
|---|
During embryonic development the Sertoli cells are derived from a
mesenchymal to epithelial transition in the bipotential gonad. This
initial induction of Sertoli cell differentiation involving SRY is one
of the first steps in male sex determination and testicular
development. Subsequently, the Sertoli cells form sex cords and produce
essential components, such as Mullerian inhibitory substance, to
promote male reproductive tract development. After embryonic
development, the Sertoli cells prepubertally are in a growth phase and
maintain a low level of differentiated function. The progression of
Sertoli cell differentiation is promoted at the onset of puberty.
Differentiated functions increase to an optimal level that is
maintained in the adult to control testicular function and the process
of spermatogenesis. Whether the induction of Sertoli cell
differentiation during embryonic development is distinct or involves
similar mechanisms as the progression and maintenance of
differentiation during pubertal development and in the adult remains to
be elucidated. The current study used midpubertal rat Sertoli cells
and, thus, directly relates to the progression and maintenance of
Sertoli cell differentiation. Future studies will be required to make
comparisons with the induction of differentiation in the embryo. A
preliminary experiment, however, demonstrated that bHLH proteins were
present in the embryonic testis using the SE2 gel shift (45).
Sertoli cells have a large number of differentiated functions that
generally increase to optimal levels during pubertal development.
Previously, Tf expression was shown to be a useful marker of Sertoli
cell differentiation and is stimulated by regulatory agents known to
promote Sertoli cell differentiation (7). To investigate the
transcriptional regulation of Sertoli cell differentiation, the
promoters for various Sertoli cell genes have been analyzed, including
the Tf promoter (15, 46, 47, 48, 49). Analysis of the proximal 600-bp human Tf
promoter demonstrated a distinct regulation between hepatocytes and
Sertoli cells (48, 49). The current study investigated the 3-kb mTf
promoter and focused on two response elements previously shown to be
critical, termed SE1 and SE2 (21, 45). Previously, the peritubular cell
product PModS was found to promote a gel shift and activate SE1 and SE2
(21). In the current study, FSH was also found to promote a gel shift
with SE2. Sequence analysis demonstrated that SE1 did not contain any
known response element sequences (data not shown); however, SE2 was
found to contain an E-box (CATCTG) sequence.
The E-box is the response element used by the bHLH class of
transcription factors. The Sertoli cell nuclear extract SE2 gel shift
could be displaced with a consensus E-box oligonucleotide. In addition,
a consensus E-box oligonucleotide promoted a gel shift that could be
displaced with SE2. A mutant E-box could not promote a gel shift or
displace the SE2 or E-box gel shifts. Therefore, the E-box appears to
be the response element in SE2 responsible for the gel shift and
activation of the Tf promoter. Previously, deletion mutant analysis
demonstrated that a promoter construct containing SE2 was the most
active region in the Tf promoter (21). Whether SE2 may interact with
other elements, such as SE1, remains to be investigated. Interestingly,
a computerized data search of the promoter sequences of a number of
other Sertoli differentiated genes demonstrated that putative E-box
elements are present in all of those examined. This included embryonic
genes, such as SRY and Mullerian inhibitory substance, and adult
functional genes, such as androgen-binding protein and inhibin/activin.
The demonstration of a critical E-box element in the Tf promoter as
well as potential elements in other Sertoli cell genes led to the
hypothesis that bHLH proteins may be involved in Sertoli cell
differentiation.
The bHLH class of transcription factors has been shown to induce and
regulate the differentiation of a number of tissues and cell types
(22, 23, 24, 25). Examples include the MyoD family, which promotes muscle cell
differentiation (22, 23, 26), and NeuroD, which promotes neural cell
differentiation (28). Therefore, cell-specific bHLH proteins can
promote cell-specific differentiation. The possibility that Sertoli
cell differentiation may be influenced by bHLH proteins was initially
investigated by identifying the presence of Sertoli cell bHLH proteins.
The ability of Sertoli cell nuclear extracts to promote an E-box gel
shift confirmed the presence of bHLH proteins in Sertoli cells. Both
PModS (S300)- and FSH-treated Sertoli cells promoted an E-box gel
shift, whereas control nontreated cultures had no gel shift. This
observation supports a role for bHLH proteins in Sertoli cells, as both
PModS (S300) and FSH influence Sertoli cell differentiation. The
midpubertal 20-day-old rat Sertoli cells are differentiated in
vivo, so they would be expected potentially to have bHLH proteins.
Nuclear extracts from freshly isolated Sertoli cells did cause an E-box
gel shift. Therefore, nontreated control cultured Sertoli cells appear
to have lost the ability to produce the bHLH proteins that promote the
gel shift. This correlates with the low level of differentiated
function in control Sertoli cell cultures previously identified
(19, 20, 21).
The E-box element in the Tf promoter was found to be nonpalindromic
(CATCTG) compared with the E-box in MCK (CACCTG), which is palindromic.
Previously, bHLH proteins have been classified according to the ability
to bind specific E-box sequences (50, 51). Class A binds predominantly
palindromic sequences (e.g. MyoD family), and class B binds
predominantly nonpalindromic sequences (e.g.
myc). Class C has unique structural properties in the bHLH
domains involving the presence of proline residues (e.g.
HES1 and Hairy) (51). The ability of the Sertoli cell bHLH proteins to
bind the nonpalindromic Tf E-box in a similar manner as the palindromic
MCK E-box suggests that the Sertoli bHLH proteins have both class A-
and B-type bHLH binding properties. Further characterization of the
Sertoli cell bHLH proteins is necessary to confirm the class to which
these bHLH proteins belong.
The ligand blot suggested the presence of bHLH proteins in Sertoli
cells and that FSH and PModS (S300) can stimulate the presence of E-12
binding proteins in Sertoli cells. The E-box gel shift contained at
least three radiolabeled Sertoli cell nuclear proteins of 70, 42, and
25 kDa. Whether all of these proteins are bHLH proteins, whether some
are not bHLH proteins but associate with the protein complex, and/or
whether the small proteins are proteolytic products of the larger
proteins remains to be investigated. Previously characterized bHLH
proteins range from 1550 kDa in size. The 70-kDa protein was probably
E-12, as demonstrated in the Western blot. These observations imply
that bHLH proteins are present in Sertoli cells, and they have the
ability to heterodimerize with E12 and bind to an E-box.
The functional significance of Sertoli bHLH proteins was investigated
with the use of the inhibitory bHLH protein Id. Id lacks a basic
region, so upon dimerization with bHLH proteins, it prevents binding to
DNA. Initial experiments with recombinant Id demonstrated that the
presence of Id displaced the Sertoli cell bHLH proteins from the Tf
E-box gel shift. Therefore, Id can act as an inhibitory bHLH protein in
Sertoli cells. An expression plasmid was then transfected into Sertoli
cells to overexpress Id. Overexpression of Id was found to inhibit the
ability of both FSH and PModS (S300) to stimulate Sertoli cell
differentiation, as measured with a Tf promoter-CAT construct. This
provides direct evidence that the Sertoli bHLH proteins are involved in
the promotion of Sertoli cell differentiation. An additional experiment
used an E-box-CAT construct transfected into Sertoli cells. Both FSH
and PModS (S300) stimulated the E-box CAT activity. Therefore, the
E-box in Sertoli cells is active and induced when the cells are
stimulated to differentiate.
Combined observations demonstrate that the bHLH proteins present in
Sertoli cells have a functional role in regulating Sertoli cell
differentiation, as measured by Tf gene expression. The current study
provides information regarding the progression of Sertoli cell
differentiation during pubertal development and the maintenance of
differentiation in the adult. Whether bHLH proteins have an important
role in embryonic Sertoli cell differentiation is currently under
investigation. Characterization of the bHLH proteins in Sertoli cells
is also currently under investigation. It will be of particular
interest to detemine whether Sertoli cell-specific bHLH proteins are
present and promote Sertoli cell differentiation. Further analysis of
the Sertoli cell bHLH proteins and their roles in the induction,
progression, and maintenance of differentiation is anticipated to
provide insight into the transcriptional control of Sertoli cells.
 |
Acknowledgments
|
|---|
We thank Urvashi Patel, Linda Miyashiro, and Betty Chu for
technical assistance, and Julia Barfield and Pamela Garay-Kobuchi for
assistance with the preparation of the manuscript. We thank Jay Cross
(McGill University) for the gift of the Id expression plasmids, Mark
Israel (University of California-San Francisco) for the gift of the
GST-Id plasmid, and Stan McKnight (University of Washington-Seattle)
for the gift of the 3-kb mTf promoter construct.
 |
Footnotes
|
|---|
1 This work was supported by NIH Grant HD-20583 (to M.K.S.), a
Rockefeller Foundation Postdoctoral Fellowship (to J.C.), a USDA
postdoctoral fellowship (to A.C.), and the University of California-San
Francisco Reproductive Endocrinology Center (Grant HD-11979). 
Received August 23, 1996.
 |
References
|
|---|
-
Skinner MK 1991 Cell-cell interactions in the
testis. Endocr Rev 12:4577[Abstract/Free Full Text]
-
Sertoli E 1865 On the existence of special
branched cells in the seminiferous tubule of the human testes.
Morgangni 7:3139
-
Fawcett DW 1975 The ultrastructure and functions
of the Sertoli cell. In: Greep RO, Hamilton EW (eds) Handbook of
Physiology, vol 5, sect 7. American Physiology Society, Washington DC,
pp 2255
-
Setchell BP, Waites GMH 1975 The blood testis
barrier. In: Greep RO, Hamilton EW (eds) Handbook of Physiology,
vol 5, sect 7. American Physiology Society, Washington DC, pp
143172
-
Waites GMH, Gladwell RT 1982 Physiological
significance of fluid secretion in the testis and blood-testis barrier.
Physiol Rev 62:624671[Free Full Text]
-
Griswold MD 1988 Protein secretions of Sertoli
cells. Int Rev Cytol 110:133156[Medline]
-
Skinner MK, Griswold MD 1980 Sertoli cells
synthesize and secrete transferrin-like protein. J Biol Chem 255:95239525[Abstract/Free Full Text]
-
Koopman P, Gubbey J, Vivian N, Goodfellow P,
Lovell-Badge R 1991 Male development of chromosomally female mice
transgenic for Sry. Nature 351:117121[CrossRef][Medline]
-
Kreidberg J, Sariola H, Loring J, Maeda M, Pelletier J,
Housman D, Jaenisch R 1993 WT-1 is required for early kidney
development. Cell 74:679691[CrossRef][Medline]
-
Dressler G, Wilkinson JE, Rothenpieler UW, Patterson LT,
Williams-Simons L, Westphal H 1993 Deregulation of
Pax-2 expression in transgenic mice generates severe kidney
abnormalities. Nature 362:65[CrossRef][Medline]
-
Foulkes NS, Mellström B, Benusiglio E,
Sassone-Corsi P 1992 Developmental switch of CREM function during
spermatogenesis: from antagonist to activator. Nature 355:8084[CrossRef][Medline]
-
Hamil KG, Conti M, Shimasaki S, Hall SH 1994 Follicle-stimulating hormone regulation of AP-1: inhibition of
c-jun and stimulation of jun-B gene transcription
in the rat Sertoli cell. Mol Cell Endocrinol 99:269277[CrossRef][Medline]
-
Hall SH, Joseph DR, French FS, Conti M 1988 Follicle-stimulating hormone induces transient expression of the
protooncogene c-fos in primary Sertoli cell cultures. Mol
Endocrinol 2:5561[Abstract/Free Full Text]
-
Smith EP, Hall SH, Monaco L, French FS, Wilson EM, Conti
M 1989 A rat Sertoli cell factor similar to basic fibroblast
growth factor increases c-fos messenger ribonucleic acid in
cultured Sertoli cells. Mol Endocrinol 3:954961[Abstract/Free Full Text]
-
Idzerda R, Behringer R, Theisen M, Huggenuik J, McKnight
G, Brinster R 1989 Expression from the transferrin gene promoter
in transgenic mice. Mol Cell Biol 9:51545162[Abstract/Free Full Text]
-
Heckert L, Griswold M 1993 Expression of the FSH
receptor in the testis. Recent Prog Horm Res 48:6177
-
Sullivan P, Wang Y, Joseph D 1993 Identification of
an alternate promoter in the rat androgen-binding protein/sex
hormone-binding globulin gene that regulates synthesis of a messenger
RNA encoding a protein with altered function. Mol Endocrinol 7:702715[Abstract/Free Full Text]
-
Skinner MK, Fritz IB 1985 Testicular peritubular
cells secrete a protein under androgen control that modulates Sertoli
cell functions. Proc Natl Acad Sci USA 82:114118[Abstract/Free Full Text]
-
Skinner MK, Fetterolf PM, Anthony CT 1988 Purification of a paracrine factor, P-Mod-S, produced by testicular
peritubular cells that modulates Sertoli cell function. J Biol
Chem 263:28842890[Abstract/Free Full Text]
-
Anthony CJ, Rosselli M, Skinner MK 1991 Actions of
the testicular paracrine factor (P-Mod-S) on Sertoli cell transferrin
secretion throughout pubertal development. Endocrinology 129:353360[Abstract/Free Full Text]
-
Whaley PD, Chaudhary J, Cupp A, Skinner MK 1995 Role of specific response elements of the c-fos promoter and
involvement of intermediate transcription factor(s) in the induction of
Sertoli cell differentiation (transferrin promoter activation) by the
testicular paracrine factor PModS. Endocrinology 136:30463053[Abstract]
-
Edmondson DG, Olson EN 1993 Helix-loop-helix
proteins as regulators of muscle-specific transcription. J Biol
Chem 268:755758[Free Full Text]
-
Edmondson DG, Cheng T-C, Cserjesi P, Chakraborty T,
Olson EN 1992 Analysis of the myogenin promoter reveals an
indirect pathway for positive autoregulation mediated by the
muscle-specific enhancer factor MEF-2. Mol Cell Biol 12:36653677[Abstract/Free Full Text]
-
Ishibash M, Moriyoshi K, Sasai Y, Shiota K, Nakanishi S,
Kageyama R 1994 Persistent expression of helix-loop-helix factor
HES-1 prevents mammalian neural differentiation in the central nervous
system. EMBO J 8:17991805
-
Metz R, Ziff E 1991 The helix-loop-helix protein
rE12 and the C/EBP-related factor rNFIL-6 bind to neighboring sites
within the c-fos serum response element. Oncogene 6:21652178[Medline]
-
Tapscott SJ, Weintraub H 1991 MyoD and the
regulation of myogenesis by helix-loop-helix proteins. J Clin
Invest 87:11331138
-
Choi J, Costa ML, Mermelstein CS, Chagas C, Holtzer S,
Holtzer H 1990 MyoD converts primary dermal fibroblasts,
chendroblasts, smooth muscle and retinal pigmented epithelial cells
into striated mononucleated myoblasts and multinucleated myotubules.
Dev Biol 87:79887992
-
Lee JL, Hollenberg SM, Snider L, Turner DL, Lipnick N,
Weintraub H 1995 Conversion of Xenopus ectoderm into
neurons by NeuroD a basic helix-loop-helix protein. Nature 268:836844
-
Granadino B, Santamaria P, Sanchez L 1993 Sex
determination in the germ line of Drosophila melanogaster:
activation of the gene Sex-lethal. Development 118:813816[Abstract]
-
Erickson JW, Cline TW 1993 A bZIP protein,
sisterless-a, collaborates with bHLH transcription factors early in
Drosophila development to determine sex. Genes Dev 7:16881702[Abstract/Free Full Text]
-
Jen Y, Weintraub H, Benezza R 1992 Overexpression
of Id protein inhibits the muscle differentiation program: in
vivo association of Id with E2A proteins. Genes Dev 6:14661479[Abstract/Free Full Text]
-
Benzera R, Davis RL, Lockshon D, Turner DL, Weintraub
H 1990 The protein Id: a negative regulator of helix-loop-helix
DNA binding proteins. Cell 61:4959[CrossRef][Medline]
-
Miner JH, Wold BJ 1991 c-myc inhibition
of MyoD and myogenin-initiated myogenic differentiation. Mol Cell Biol 11:284251[Abstract/Free Full Text]
-
Lassar AB, Thayer MJ, Overell RW, Weintraub H 1989 Transformation by activated ras or fos prevents
myogenesis by inhibiting expression of MyoD1. Cell 58:65967[CrossRef][Medline]
-
Dorrington JH, Roller NF, Fritz IB 1975 Effects of
follicle-stimulating hormone on cultures of Sertoli cell preparations.
Mol Cell Endocrinol 3:5770[CrossRef][Medline]
-
Tung PS, Skinner MK, Fritz IB 1984 Fibronectin
synthesis is a marker for peritubular cell contaminants in Sertoli cell
enriched cultures. Biol Reprod 30:199211[Abstract]
-
Kingston RE, Chen CA, Okayama H 1993 Calcium
phosphate transfection. In: Ausabel FA, Brent R, Kingston RE, Moore DD,
Seidman JG, Smith JA, Struhl K (eds) Current Protocols in Molecular
Biology. Greene and Wiley-Interscience, New York, pp 9.1.19.1.3
-
Guillou F, Zakin MM, Part D, Boissier F, Schaeffer
E 1991 Sertoli cell specific expression of the human transferrin
gene. J Biol Chem 266:98769884[Abstract/Free Full Text]
-
Garner MM, Rezvin A 1981 A gel electrophoresis
method of quantifying the binding of proteins to specific DNA regions:
application to components of the Escherichia cell lactose
operon regulatory system. Nucleic Acids Res 9:30473059[Abstract/Free Full Text]
-
Quertermous EE, Hidai H, Blaner MA, Quertermous T 1996 Cloning and characterization of a basic helix-loop-helix protein
expressed in early mesoderm and the developing somites. Proc Natl Acad
Sci USA 91:70667070[Abstract/Free Full Text]
-
Trouche D, Grigoriev M, Lenormand JL, Robin P,
Leibovitch SA, Sassone-Corsi P, Harel-Bellan A 1993 Repression of
c-fos promoter by MyoD on muscle cell differentiation.
Nature 363:7982[CrossRef][Medline]
-
Trouche D, Masutani H, Groisman R, Robin P, Lenormand
JL, Harel-Bellan A 1995 Myogenin binds to and represses
c-fos promoter. FEBS Lett 361:140144[CrossRef][Medline]
-
Apone S, Hauschka SD 1995 Muscle gene E-box control
elements: evidence for quantitatively different transcriptional
activities and the binding of distinct regulatory factors. J Biol
Chem 270:2142021427[Abstract/Free Full Text]
-
Yutzey KE, Konieczny SF 1992 Different E-box
regulatory sequences are functionally distinct when placed within the
context of the troponin 1 enhancer. Nucleic Acids Res 51055113
-
Chaudhary J, Skinner MK 1995 Transcriptional
regulation of Sertoli cell differentiation (transferrin promoter
activation) during testicular development. Dev Genet 16:114118[CrossRef][Medline]
-
Cohen GN, Zakin MM 1988 Interactions of the DNA
binding proteins with the 5' region of the human transferrin gene.
J Biol Chem 263:1018010185[Abstract/Free Full Text]
-
Schaeffer E, Boissier F, Py MC, Cohen GN, Zakin MM 1989 Cell specific expression of the human transferrin gene. J
Biol Chem 264:71537160[Abstract/Free Full Text]
-
Schaffer E, Guillou F, Part D, Zakin M 1993 A
different combination of transcription factors modulates the expression
of the human transferrin promoter in liver and Sertoli cells. J
Biol Chem 268:2339923408[Abstract/Free Full Text]
-
Guillou F, Zakin MM, Part D, Boissier Schaeffer E 1991 Sertoli cell specific expression of the human transferrin gene.
J Biol Chem 266:98769884
-
Dang CV, Dolde C, Gillison ML, Kato GJ 1992 Discrimination between related DNA sites by a single amino acid residue
of Myc-related basic-helix-loop-helix proteins. Proc Natl Acad Sci USA 89:599602[Abstract/Free Full Text]
-
Ohsako S, Hyer J, Panganiban G, Oliver I, Caudy M 1994 Hairy function as a DNA-binding helix-loop-helix repressor of
Drosophila sensory organ formation. Genes Dev 8:27432755[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. A. Wood and W. H. Walker
USF1/2 Transcription Factor DNA-Binding Activity Is Induced During Rat Sertoli Cell Differentiation
Biol Reprod,
January 1, 2009;
80(1):
24 - 33.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Muir, I. Sadler-Riggleman, and M. K. Skinner
Role of the Basic Helix-Loop-Helix Transcription Factor, Scleraxis, in the Regulation of Sertoli Cell Function and Differentiation
Mol. Endocrinol.,
August 1, 2005;
19(8):
2164 - 2174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chaudhary, I. Sadler-Riggleman, J. M. Ague, and M. K. Skinner
The Helix-Loop-Helix Inhibitor of Differentiation (ID) Proteins Induce Post-Mitotic Terminally Differentiated Sertoli Cells to Re-Enter the Cell Cycle and Proliferate
Biol Reprod,
May 1, 2005;
72(5):
1205 - 1217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Li, G. Ram, K. Gast, X. Chen, K. Barasch, K. Mori, K. Schmidt-Ott, J. Wang, H.-C. Kuo, C. Savage-Dunn, et al.
Detection of intracellular iron by its regulatory effect
Am J Physiol Cell Physiol,
December 1, 2004;
287(6):
C1547 - C1559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Scobey, C. A. Fix, and W. H. Walker
The Id2 Transcriptional Repressor Is Induced by Follicle-stimulating Hormone and cAMP
J. Biol. Chem.,
April 16, 2004;
279(16):
16064 - 16070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Buzzard, N. G. Wreford, and J. R. Morrison
Thyroid Hormone, Retinoic Acid, and Testosterone Suppress Proliferation and Induce Markers of Differentiation in Cultured Rat Sertoli Cells
Endocrinology,
September 1, 2003;
144(9):
3722 - 3731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Braun, M.-N. Vo, and K. H. Kim
Positive Regulation of Retinoic Acid Receptor Alpha by Protein Kinase C and Mitogen-Activated Protein Kinase in Sertoli Cells
Biol Reprod,
July 1, 2002;
67(1):
29 - 37.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Anway, D. S. Johnston, D. Crawford, and M. D. Griswold
Identification of a Novel Retrovirus Expressed in Rat Sertoli Cells and Granulosa Cells
Biol Reprod,
October 1, 2001;
65(4):
1289 - 1296.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chaudhary and M. K. Skinner
Role of the Transcriptional Coactivator CBP/p300 in Linking Basic Helix-Loop-Helix and CREB Responses for Follicle-Stimulating Hormone-Mediated Activation of the Transferrin Promoter in Sertoli Cells
Biol Reprod,
August 1, 2001;
65(2):
568 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chaudhary, J. Johnson, G. Kim, and M. K. Skinner
Hormonal Regulation and Differential Actions of the Helix-Loop-Helix Transcriptional Inhibitors of Differentiation (Id1, Id2, Id3, and Id4) in Sertoli Cells
Endocrinology,
May 1, 2001;
142(5):
1727 - 1736.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Chaudhary and M. K. Skinner
Basic Helix-Loop-Helix Proteins Can Act at the E-Box within the Serum Response Element of the c-fos Promoter to Influence Hormone-Induced Promoter Activation in Sertoli Cells
Mol. Endocrinol.,
May 1, 1999;
13(5):
774 - 786.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Chaudhary, G. Kim, and M. K. Skinner
Expression of the Basic Helix-Loop-Helix Protein REB{alpha} in Rat Testicular Sertoli Cells
Biol Reprod,
May 1, 1999;
60(5):
1244 - 1250.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Chaudhary and M. K. Skinner
E-Box and Cyclic Adenosine Monophosphate Response Elements Are Both Required for Follicle-Stimulating Hormone-Induced Transferrin Promoter Activation in Sertoli Cells
Endocrinology,
March 1, 1999;
140(3):
1262 - 1271.
[Abstract]
[Full Text]
|
 |
|