help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catlin, E. A.
Right arrow Articles by Teixeira, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catlin, E. A.
Right arrow Articles by Teixeira, J.
Endocrinology Vol. 138, No. 2 790-796
Copyright © 1997 by The Endocrine Society


Articles

Müllerian Inhibiting Substance Inhibits Branching Morphogenesis and Induces Apoptosis in Fetal Rat Lung1

Elizabeth A. Catlin, Valerie C. Tonnu, Ronald G. Ebb, Bella A. Pacheco, Thomas F. Manganaro, Robert M. Ezzell, Patricia K. Donahoe and Jose Teixeira

Pediatric Surgical Research Laboratory, Massachusetts General Hospital, and the Department of Surgery, Harvard Medical School; the Neonatology Unit, Pediatric Service, Massachusetts General Hospital (E.A.C.); and the Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02114

Address all correspondence and requests for reprints to: Elizabeth A. Catlin, M.D., Neonatology Unit, Pediatric Service, Founders House 442, Massachusetts General Hospital, Fruit Street, Boston, Massachusetts 02114. E-mail: catline{at}a1.mgh.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Müllerian inhibiting substance (MIS) is a glycoprotein hormone required for normal male reproductive tract development; it is presumed to signal through a heteromeric complex of type I and type II receptors. MIS exposure produces a paracrine-mediated regression of the embryonic Müllerian duct with histological changes consistent with apoptosis. MIS has also been shown to inhibit fetal lung development in vitro and in vivo, although the mechanism of this inhibition is unknown. The primordial lung and gonad are anatomically proximate on embryonic day 13.5, raising the possibility of a paracrine-mediated influence of MIS in male embryos on lung as well as MIS effecting dissolution of the Müllerian duct. We hypothesized that a negative regulatory event(s) might occur in the lung, as occurs in the duct, at the onset of MIS protein expression; thus, apoptosis and branching morphogenesis were studied in explanted fetal rat lungs incubated with proteolytically activated MIS. MIS exposure resulted in reduced total lung bud number as well as lung perimeter length. Explanted lungs exposed to MIS also exhibited numerous apoptotic bodies. To assess whether this MIS-induced phenomenon in lung might be mediated by the MIS type II receptor (MIS RII), reverse transcriptase-PCR performed on multiple fetal rat lung RNA samples using oligonucleotide primers designed from the 3'-untranslated region of rat MIS RII complementary DNA showed a product of the expected size that when sequenced was nearly identical to rat MIS RII. Northern blot analysis using polyadenylated fetal rat lung RNA and a 3'-MIS RII probe revealed a 2-kilobase transcript that was also seen in testicular messenger RNA. These studies show that the putative ligand binding receptor for MIS is expressed in embryonic lung, where MIS negatively modulates branching and activates apoptosis. We speculate that the mechanism of MIS-induced inhibition of lung development in the male fetus begins with MIS binding to the MIS RII, followed by a signaling cascade resulting in delayed airway branching temporally associated with enhanced apoptosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MÜLLERIAN inhibiting substance (MIS), also known as anti-Müllerian hormone, is a glycoprotein hormone required for normal male reproductive organogenesis that belongs to the transforming growth factor (TGFß) family of growth and differentiation factors (1). Sertoli cells of the testis produce MIS by the seventh week of gestation in humans and by day 13 of gestation in rats; paracrine-mediated exposure of the adjacent embryonic Müllerian duct to MIS results in dramatic regression of this epithelial-mesenchymal unit (the anlagen of the uterus, fallopian tubes, and upper vagina). Müllerian ductal regression effected by a nonsteroidal factor, as first described by Jost (2), is a classic example of apoptosis (3, 4), characterized histologically by an initial increase in lysosomes within the Müllerian duct cells, degradation of basement membranes, loss of cell polarity and orientation, and finally, degeneration and phagocytosis of epithelial and mesenchymal cells (3, 5).

The male-specific embryonic expression of MIS provides a potential link to explore in sexually dimorphic developmental disease states, because in addition to its paracrine effects, MIS is a circulating hormone present in nanomolar concentrations in newborn male serum (6, 7). An important cause of infant morbidity and mortality, the neonatal respiratory distress syndrome, characterized by insufficient pulmonary surfactant, is one such sexually dimorphic disease occurring more often and with greater lethality in premature newborn males than in females (8, 9). We have previously shown that MIS is a negative regulatory factor in fetal rat lung biochemical maturation and that MIS binds in a punctate pattern to the cell surface and is trafficked internally in explanted developing lung, consistent with specific adsorptive endocytosis (10, 11, 12). Exposure of fetal lungs in culture as well as in vivo after transuterine delivery of MIS results in delayed accumulation of the major glycerophospholipid of pulmonary surfactant, disaturated phosphatidylcholine (10, 11).

We hypothesized that inhibitory regulatory event(s) in lung morphogenesis might occur with the onset of MIS protein expression by the testis, noting that the remarkable anatomical proximity of the embryonic testis to the developing lung would facilitate paracrine effects by MIS (Fig. 1Go). To address this question, branching morphogenesis and apoptosis in rat lung primordia exposed to MIS in an organ culture model were studied. The putative MIS type II receptor (MIS RII), as a partner in a heteromeric complex of type I and type II single transmembrane serine/threonine kinase receptors, has been cloned, and by in situ hybridization localizes strongly to the embryonic Müllerian duct (13, 14, 15). To determine whether the MIS RII, which in the TGFß paradigm is the ligand-binding form conferring specificity to the heteromeric receptor complex, was present in this responsive tissue (fetal lung), its expression was assessed by reverse transcriptase-PCR (RT-PCR) and Northern blot analyses.



View larger version (96K):
[in this window]
[in a new window]
 
Figure 1. The urogenital ridge and primordial lung are proximate on embryonic day 13.5. Magnified anterior view (x44) of a 13.5-day-old rat embryo showing the location of the primitive lung and urogenital ridge containing gonad and Müllerian and Wolffian ducts, which is schematically represented on the right. Scale bar = 1 mm.

 

    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials and general methods
Recombinant human MIS was produced, purified, and proteolytically activated on plasmin beads (Calbiochem, La Jolla, CA) as previously described (16, 17). Thirty and 300 nM MIS concentrations were studied because a 30-nM concentration of MIS represents the midpoint of the standardized urogenital ridge MIS bioassay (18), and this concentration has been previously studied in fetal lung explants (12). Circulating concentrations of MIS in neonatal male serum approach 1 nM; local concentrations of MIS secreted in vivo by the testis have not been measured. The log10 higher dose of 300 nM was chosen because paracrine-mediated exposure of MIS to the lung and duct make such local concentrations conceivable. Timed pregnant Sprague-Dawley rats were obtained from Holtzman (Madison, WI), and gestation day 0.5 was defined as the morning after mating. Isotopes were purchased from DuPont-New England Nuclear (Boston, MA); restriction and modifying enzymes were obtained from Promega (Madison, WI), except for Superscript II, which was obtained from Life Technologies (Grand Island, NY). Chemicals were purchased from Fisher Scientific (Fairlawn, NJ) or Sigma Chemical Co. (St. Louis, MO) unless otherwise noted. Female FBS was obtained from Aires Scientific/Biologos (Richardson, TX). Oligonucleotides were prepared in the Reproductive Sciences Center core facility at Massachusetts General Hospital. Standard recombinant DNA techniques were used (19). DNA sequence analysis was performed with MacVector software (Oxford Molecular Group, Campbell, CA). All animal studies were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals, with institutional approval on 11–15-95 under accession no. 93–4250.

In vivo
The retrothorax and retroperitoneum of a 13.5-day gestation rat embryo were studied using transmitted light after removing liver, pancreas, stomach, and bowel, then photographed with special attention paid to the proximity of the upper extent of the gonad to the primordial lung.

Organ culture
Rat lungs (13.5 days gestation) were removed en bloc using a dissecting microscope and placed on a 2% agarose drop cut to a thickness of 1.5–2.0 mm suspended on a stainless steel wire grid in a Falcon no. 3037 culture dish (Becton Dickinson, Lincoln Park, NJ). Culture dishes contained 1 ml CMRL culture medium with 10% female FBS, 2.5 µg amphotericin B, 1 mM glutamine, and 2 mM ascorbic acid and were maintained in a 37 C incubator in 95% air-5% CO2 with 80% humidity. Explants were randomized and viewed live and unstained at x40 magnification (Microstar-110 microscope, American Optical, Buffalo, NY), and the outline of the airways and splanchnic mesenchyme were drawn according to the methods of Massoud et al. (20) using the camera lucida attachment (American Optical). These outlines were scanned, digitized (Applescan, version 1.0.2, Apple Computer) and analyzed (NIH Image, version 1.37) to quantitate the area and perimeter of branching airways and lung mesenchyme; total lung bud number was also recorded. The entire explant and left lung of experimental and control explants were analyzed on days 0 and 4. After 24 h of equilibration, media from experimental and control cultures were rapidly aspirated and replaced with fresh culture medium only, culture medium containing 30 or 300 nM MIS, or culture medium with 20 mM HEPES or PBS added equal to the volume of the added MIS. This process was repeated at 24-h intervals, and the experiment was terminated after 96 h. Statistical analyses of the differences in lung branching parameters over the study period were performed using the Scheffe’s S post-hoc test for one-factor ANOVA (SuperANOVA, Abacus Concepts, Berkeley, CA). Significance was assigned for P < 0.05. The SEM was used to represent the data dispersion.

Apoptosis analysis
Embryonic day 13.5 lungs were explanted and randomized to MIS or control groups as described above. Urogenital ridges were removed according to the standard bioassay protocol (18) and similarly incubated with or without bioactive MIS. Tissues were fixed in 10% formalin, embedded in paraffin, and deparaffinized in two 5-min washes of xylene and two 5-min washes of 100% ethanol, and washed 3 min each in 95% and 70% ethanol. We used in situ nonisotopic end-labeling methodology for detection of DNA fragmentation; the manufacturer’s instructions for the Oncor Apoptag In Situ Apoptosis Detection Kit: Peroxidase were followed, except that the proteinase K concentration used was 10 µg/ml.

Northern analyses
Total RNA was prepared by homogenization in guanidinium thiocyanate and centrifuged through a CsCl cushion (21). Polyadenylated [poly(A)+] RNA was prepared with the Poly A Tract system from Promega. Poly(A)+-enriched RNA (10 µg) samples were denatured with dimethylsulfoxide and glyoxal at 65 C, separated in a 1.5% agarose gel, blotted overnight onto nylon membranes, and either baked at 80 C in a vacuum oven or UV cross-linked (19). Blots were prehybridized with 100 µg/ml sonicated salmon sperm DNA in 50% formamide hybridization solution for 2 h at 65 C. Complementary RNA probes of both full-length rat MIS RII and a 3'-PCR fragment from the untranslated region of the rat MIS RII complementary DNA (cDNA) (13, 14) were prepared with [{alpha}-32P]CTP. Blots were hybridized overnight at 65 C with 1 x 107 cpm/ml probe, then washed with 0.1 x SSC (1 x SSC = 150 mM sodium chloride and 15 mM sodium citrate)-0.1% SDS at 65 C and exposed on radiographic film with intensifying screens at -70 C.

RT-PCR
RT-PCR was carried out on total lung RNA, as described by Erlich (22) with slight modification. One to 5 µg fetal rat lung RNA collected at various gestational ages were reverse transcribed into cDNA using Superscript II according to manufacturer’s suggestions. The RT product was then subjected to 30 cycles of PCR with Pyrostase thermostable DNA polymerase (Molecular Genetic Resources, Tampa, FL) using a Robocycler (Stratagene, La Jolla, CA) with the following program: 1-min denaturing at 94 C, 1-min annealing at 50 C, and 72 C extension for 1 min. The PCR primers used were 20-mers designed using the rat MIS RII cDNA sequence (13, 14) and included a 3'-set of primers flanking a 349-bp fragment spanning 1571–1920 bp (CCCTGGCTTATCCTCAGGTG, GAGTGGGAATCTTGCTTTAT). The PCR products were separated by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, visualized with a UV transilluminator, and photographed. PCR fragments were isolated from the gel with Geneclean (BIO 101, Vista, CA) and cloned into pCRII (Invitrogen, San Diego, CA) for sequencing analysis by the Sanger dideoxy method (23) with modified T7 polymerase (24) and reagents purchased from Amersham (Arlington Heights, IL)/U.S. Biochemical Corp. (Cleveland, OH).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inspection of the anatomical relationship between embryonic rat lung rudiments and male gonads was performed (Fig. 1Go); these organs were found to be juxtaposed from approximately days 13.5–15 of gestation.

The lung bud count is a direct quantification of branching morphogenesis, and the increase in lung bud number from days 0–4 represents changes in branching, thus increasing complexity and advancing differentiation. The outlines of airways and splanchnic mesenchyme in fetal lung explants generated with the camera lucida drawing attachment at the termination of a typical 4-day experiment are shown in Fig. 2Go. In Fig. 3Go we have plotted the changes in lung bud count over the study period under the described conditions. Exposure to 30 nM MIS produced a visible decrease in total lung bud number, with a mean reduction in bud count of 22% compared to that in controls. Exposure to 300 nm MIS caused a marked inhibition of branching, decreasing total lung bud number by 52.8% (P = 0.0009), 48.6% (P = 0.0498), and 52.6% (P = 0.0005) compared to that in PBS, HEPES, and medium only controls, respectively. PBS and HEPES controls were both studied because each has been used as a vehicle buffer for MIS, and with variable volumes of buffer used to deliver the MIS it was necessary to exclude a buffer effect on branching. The medium only group was included to study branching in a MIS-free and MIS vehicle-free milieu. Similar reductions in branching were measured for left lung incubated with 300 nM MIS, i.e. 58.9%, 52.9%, and 52.5%, compared that for PBS, HEPES, and medium only controls, respectively. Sample groups consisted of a minimum of 5 replicates and a maximum of 13.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Camera lucida drawings of lung explants after 4 days in culture. Representative diagrams of the outline of branching airways and splanchnic mesenchyme of day 4 lung cultures explanted on day 13.5 of gestation and incubated with buffers (PBS and HEPES), medium only, or 30 or 300 nM MIS. Note the decreased airway complexity apparent in the explant culture exposed to 300 nM MIS.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. MIS reduces lung bud number. Explanted lung bud count at the termination of the 4-day experiment is decreased with daily exposure to 30 and 300 nM MIS compared that with exposure to daily changes of PBS and HEPES buffers or to medium only. The change in bud count refers to the number of buds at the start of the study subtracted from the number at the end of the study. Groups represent the mean of a minimum of 5 replicated experiments and a maximum of 13. Bars represent ± SEM. See text for P value comparisons of MIS-treated to buffer- or medium-exposed lung explants.

 
Explanted lung perimeter length, another measure of increasing complexity, or lung branching was inhibited by the addition of 300 nM MIS compared to the effect of PBS, HEPES, or medium alone [by 38.6% (P = 0.0051), 39.6% (P = 0.0263), and 41.5% (P = 0.0005), respectively; data not shown]. Mesenchyme area, mesenchyme perimeter, and total lung area are parameters representing lung growth, as contrasted with advancing differentiation. Each of these measurements remained similar between MIS-treated groups and control groups over the study period (data not shown).

To determine whether the MIS-mediated inhibition of lung development might also be associated with apoptosis, we assayed lungs in organ culture treated with or without 30 nM MIS as described above for apoptotic bodies (Fig. 4Go). Embryonic day 13.5 female urogenital ridges treated with and without 30 nM MIS were used as controls to determine 1) the number of cells undergoing apoptosis within and adjacent to the Müllerian duct as a positive control, and from that, 2) what numbers of apoptotic bodies might be expected in the MIS-treated lungs. The in situ apoptosis detection assay used labels cells where DNA fragmentation has generated multiple 3'-hydroxy DNA ends with terminal deoxynucleotidyl transferase. This nonisotopic DNA extension is then localized with an antidigoxigenin antibody peroxidase conjugate. Apoptotic bodies were observed in the urogenital ridges treated with MIS, where they were specifically localized, as expected, in the regressing Müllerian ducts. In contrast, brown apoptotic bodies were observed dispersed throughout sections from explanted lungs treated with MIS.



View larger version (139K):
[in this window]
[in a new window]
 
Figure 4. Localization of apoptotic bodies in MIS-exposed urogenital ridge and lung explants. A and B show a urogenital ridge from a 13.5-day gestation rat incubated for 3 days with 30 nM MIS. Note the brown apoptotic bodies (arrows) within the regressed Müllerian duct. B is a high magnification view of A. D and E show a day 13.5 gestation urogenital ridge incubated for 3 days without MIS. Note the patent, unaffected Müllerian duct (arrows). E is a high magnification view of D. Lung explants were removed on day 13.5 and incubated for 3 days with (C) or without (F) 30 nM MIS. Note the numerous brown apoptotic bodies (arrows) present in the MIS-treated lung shown in C. Bar (in F) = 40 µm for A, C, D, and F; and 20 µm for B and E.

 
To determine whether the MIS RII was expressed in rat fetal lung, as a likely mechanism of MIS-mediated inhibition of lung development is through ligand binding of the MIS RII and subsequent downstream signaling, we used RT-PCR with primers from the rat MIS RII 3'-untranslated region. Results consistently revealed a 349-bp product in male and female fetal lung samples as well as in samples of testis, which were used as positive controls (Fig. 5Go). As expected, controls lacking template showed no PCR products. Subsequently, the 349-bp RT-PCR product from fetal rat lung was cloned, sequenced, and found to be nearly identical to rat MIS RII (data not shown). The two nucleotide sequence differences found in this cDNA fragment from the 3'-untranslated region are presumed to be minor and may reflect polymorphism or proofreading errors by the polymerase.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 5. RT-PCR in fetal rat lung using MIS RII primers. Photograph of a 1.5% agarose gel showing the RT-PCR-generated 349-bp fragment of rat MIS RII in fetal lung samples. Gestational ages of male and female fetal lungs are shown. Control lanes include: positive (+), postnatal rat testis; negative (-), primers in the absence of template; and GAPDH, glyceraldehyde phosphate dehydrogenase gene amplified in rat testis (T) and fetal rat lung (L). Markers, in kilobases, are shown on the left.

 
Northern blot analyses were then performed to confirm the RT-PCR results and assess the size of the transcript(s) for rat MIS RII in fetal lung. Northern analysis was performed using poly(A)+-enriched fetal rat lung, fetal liver, adult lung, and postnatal testicular RNA and a riboprobe from the 3'-untranslated region of rat MIS RII cDNA that revealed a distinct 2-kilobase band in fetal lung (Fig. 6Go). The messenger RNA (mRNA) in male and female fetal rat lung (lanes 2 and 3), which hybridized to the MIS RII cDNA probe under stringent washing conditions, migrated through the gel to the same position as that observed for testis mRNA (lane 1), indicating that the transcripts were of the same size and thus likely to represent the same hybridizable mRNA species. The signal in fetal lung was found to be as high as 30% of that found in samples of poly(A)+ testis when analyzed by a Molecular Dynamics PhosphorImager (Sunnyvale, CA).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. Northern blot hybridized with MIS RII fragment. Northern blot of postnatal testis mRNA (lane 1), 19.5-day gestation male lung mRNA (lane 2), 19.5-day gestation female lung mRNA (lane 3), 19.5-day gestation fetal liver mRNA (lane 4), and adult lung mRNA (lane 5) probed with a MIS RII 3'-end fragment riboprobe and exposed for 30 min.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Development of the mammalian lung begins as an outgrowth from the ventral foregut; airway patterning proceeds by repetitive branching of epithelial buds with formation of clefts. Paracrine and autocrine factors have been proposed as signals directing this process, and data exist supporting such a role for TGFß1 (25), epidermal growth factor (EGF) (26), and fibroblast growth factor (27). In this report we present data supporting a role for MIS, a male-specific paracrine and endocrine factor in the embryo, as an inhibitor of branching morphogenesis in lungs of embryonic males, in a pattern suggesting dose dependence. This finding is pertinent given the delayed lung development noted in fetal males of several species, including rabbits, rats, and humans (8, 9, 28, 29), and complements previous evidence of delayed biochemical maturation in MIS-exposed lungs (10, 11), and observations that pulmonary cytodifferentiation progresses in concert with airway branching (30). Both branching morphogenesis and epithelial differentiation are blocked in transgenic embryos expressing a dominant negative fibroblast growth factor receptor targeted to lung (27). This phenotype and the cumulative findings of MIS exposure in embryonic lung described here and previously (10, 11) are consistent with developmental connections, mediated in part by signaling molecules, between anatomical airway patterning and pulmonary cellular differentiation. The sex-specific embryonic expression of MIS and the male disadvantage in pulmonary development recognized in several mammalian species makes the inhibitory effects induced by MIS on lung development potentially physiologically relevant.

The concentration of MIS required to inhibit branching morphogenesis in these studies is high. Whether daily MIS exposure is required to impair branching is not known. Only one initial dose of MIS is required for the standardized urogenital ridge bioassay (18), and only one initial MIS dose (resulting in delayed pulmonary surfactant accumulation 48 and 72 h later) was used in studies in which fetal rats were injected in vivo with nanomolar concentrations of MIS (11). It is conceivable, therefore, that a single MIS dose may be sufficient to produce the effects measured, rather than daily dosing of MIS or continued anatomical proximity of testis and lung. If an initial paracrine MIS exposure is sufficient to cause a delay in branching morphogenesis, then further high dose exposure later in gestation might be unnecessary. We previously reported that recombinant MIS in concentrations of 45–450 pM incubated with gestation day 17.5 fetal rat lung cultures delayed accumulation of the major glycerophospholipid of pulmonary surfactant (10). Inhibition of branching by higher dose MIS (early in gestation, when testis and lung are anatomically close) combined with data showing impaired surfactant accumulation later in gestation by lower dose MIS support the hypothesis that MIS contributes to the male disadvantage in respiratory distress syndrome, in that higher dose paracrine MIS exposure is conceivable when testis and lung are proximate and lower dose MIS exposure is ongoing at concentrations approaching 1 nM in embryonic human male serum from week 7 throughout gestation.

MIS induces changes characteristic of programmed cell death in the Müllerian duct (3, 5), and here we demonstrate by in situ end-labeling methodology that apoptosis is, as expected, activated there. In addition, to correlate with the findings of diminished branching morphogenesis and differentiation (10, 11), we now report that apoptosis is induced to a considerable degree in embryonic lungs incubated with MIS. Similarly, another TGFß family member, bone morphogenetic protein-4, when targeted to and overexpressed in lung, produces abnormal morphogenesis, including grossly small lungs, delayed cytodifferentiation, and proliferation of mesenchymal cells with an increase in cell death (31). Apoptosis or programmed cell death is an evolutionarily conserved process that directs embryonic development and regulates cell numbers. Whether MIS-induced apoptosis in lung and its effects on branching morphogenesis are functionally linked is unknown. Extrinsic signals known to activate the cell death program include bone morphogenetic protein signaling (32), cell damage caused by viral infection and ionizing radiation, expression of oncogenes, removal of growth factors (4), and, as presented here, MIS exposure.

The presence of the MIS RII in fetal rat lung is consistent with a role in the measured inhibitory effect(s) of the MIS ligand and suggests that those effects are mediated in part by this receptor. The rat MIS RII is a serine/threonine kinase receptor with a single transmembrane domain belonging to the TGFß type II receptor family (13, 14). By analogy to the mechanism of action of the TGFß receptors (33), it was expected that the MIS RII would reside in the plasma membrane of MIS-responsive fetal lung cells to bind ligand, next forming a complex with type I receptors and so initiating a signaling cascade (34). We previously reported confocal imaging evidence of specific cell surface binding and uptake of an MIS-fluorescent antibody sandwich in explanted fetal rat lungs (12). Recent Northern analyses of human fetal lung mRNA hybridized with a riboprobe from human MIS RII cDNA (35) confirm the expression of this receptor in human fetal lung tissue (Catlin, E. A., unpublished) and further support the possible relevance of these findings to the neonatal male disadvantage in the respiratory distress syndrome. Definitive proof, however, that a functional ligand-receptor unit exists, as implied in the adsorptive endocytosis results seen on confocal imaging (12), given the presence of MIS RII in fetal lung combined with high local concentrations as well as circulating MIS ligand in fetal males, awaits further studies.

A second speculation is that MIS-mediated inhibition of branching morphogenesis involves EGF, which produces a dose-dependent stimulation of fetal lung branching in vitro (26). We have previously reported that MIS inhibits EGF receptor phosphorylation in fetal rat lung (36). Also, Warburton and colleagues showed that a specific EGF receptor kinase antagonist (tyrphostin) causes concentration-dependent inhibition of branching (26); thus, MIS and EGF may function as antagonists during the secondary embryonic induction of lung branching. In addition, male fetal rabbit lung explants have been reported to be resistant to EGF-mediated surfactant stimulation during a window of time, suggesting the presence of a male-specific endogenous inhibitor (37).

It is conceivable that the MIS ligand might bind to other TGFß family receptors, activating downstream pathways and resulting in branching inhibition. TGFß1 has recently been shown to inhibit branching morphogenesis and n-myc expression in fetal lung in a dose-dependent manner (25), and the TGFß type II receptor is expressed as early as gestation day 16 in fetal rat lung (38). Arguing against this proposed mechanism is the evidence that radiolabeled MIS does not bind to TGFß type II receptor-transfected COS cells (14, 15), and signaling for TGFß family members requires the kinase domains of both type I and type II receptors (33); thus, the presence of the MIS type II receptor would be expected to be required for signaling. However, the exact mechanisms and conditions of receptor cross-talk are unknown and certainly could involve cell specificity or be regulated by pairing of ligand-specific type II receptors with different type I receptors (39).

The cumulative findings described here, including detection of the MIS RII in fetal rat lung, suggest that paracrine MIS, secreted from the embryonic testis to the neighboring lung rudiment, or circulating serum MIS binds to developing lung via its receptor, initiating a signal transduction cascade that results in inhibition of airway branching and perhaps cytodifferentiation. This process in the lung coincides with the developmental event of MIS-initiated programmed cell death in the male Müllerian duct. Growth and/or differentiation arrest has been observed in MIS-treated A431 cells (40), a human cell line that binds MIS (17). The downstream events elicited by MIS binding are largely unknown, but we do know that MIS decreases EGF receptor autophosphorylation in A431 membranes (41), that EGF receptor phosphorylation in fetal rat lung membranes is similarly inhibited (36), and that apoptosis is activated by MIS in lung as well as in the Müllerian duct. It is tempting to speculate that paracrine as well as endocrine MIS may play a role in the delicate balance of stimulatory and inhibitory factors that influence the developing lung, and that MIS under certain circumstances, such as premature birth of the fetus, could contribute to impaired male lung development and the male disadvantage, as commonly observed, in the neonatal respiratory distress syndrome.


    Acknowledgments
 
We thank Jay J. Schnitzer, David T. MacLaughlin, and Liz Perkins for helpful discussions and suggestions, and Mary Kenneally for expert technical advice.


    Footnotes
 
1 This work was supported by NIH Grant R29-HL-46198 (to E.A.C.), a March of Dimes-Birth Defects Foundation grant, NIH NCI Grant CA-17393 (to P.K.D.), a grant from the American Cancer Society (to R.M.E.), an Individual National Research Service Award (to J.T.), and Reproductive Sciences Center Grant P30-HD-28138. Back

Received August 16, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Massague’ J, Attisano L, Wrana JL 1994 The TGF-ß family and its composite receptors. Trends Cell Biol 4:172–178[CrossRef][Medline]
  2. Jost A 1947 Recherches sur la differenciation sexuelle de l’embryon de lapin. Arch Anat Microsc Morphol Exp 36:271–315
  3. Price JM, Donahoe PK, Ito Y, Hendren WH 1977 Programmed cell death in the Müllerian duct induced by Müllerian inhibiting substance. Am J Anat 149:353–376[CrossRef][Medline]
  4. Steller H 1995 Mechanisms and genes of cellular suicide. Science 267:1445–1449[Abstract/Free Full Text]
  5. Trelstad RL, Hayashi A, Hayashi K, Donahoe PK 1982 The epithelial-mesenchymal interface of the male rat Müllerian duct: loss of basement membrane integrity and ductal regression. Dev Biol 92:27–40[CrossRef][Medline]
  6. Hudson PL, Dougas I, Donahoe PK, Cate RL, Epstein J, Pepinsky RB, MacLaughlin DT 1990 An immunoassay to detect human Müllerian in-hibiting substance in males and females during normal development. J Clin Endocrinol Metab 70:16–22[Abstract/Free Full Text]
  7. Lee MM, Donahoe PK, Hasegawa T, Silverman B, Crist GB, Best S, Hasegawa Y, Noto RA, Schoenfeld D, MacLaughlin DT 1996 Müllerian inhibiting substance in humans: normal levels from infancy to adulthood. J Clin Endocrinol Metab 81:571–576[Abstract]
  8. Miller HC, Futrakul P 1968 Birth weight, gestational age and sex as determining factors in the incidence of respiratory distress syndrome of prematurely born infants. J Pediatr 72:628–635[CrossRef][Medline]
  9. Torday JS, Nielsen HC, Fencl M, Avery ME 1981 Sex differences in fetal lung maturation. Am Rev Respir Dis 123:205–208[Medline]
  10. Catlin EA, Manganaro TF, Donahoe PK 1988 Müllerian inhibiting substance depresses accumulation in vitro of disaturated phosphatidylcholine in fetal rat lung. Am J Obstet Gynecol 159:1299–1303[Medline]
  11. Catlin EA, Powell SM, Manganaro TF, Hudson PL, Ragin RC, Epstein J, Donahoe PK 1990 Sex-specific fetal lung development and Müllerian inhibiting substance. Am Rev Respir Dis 141:466–470[Medline]
  12. Catlin EA, Ezzell RM, Donahoe PK, Manganaro TF, Ebb RG, MacLaughlin DT 1992 Müllerian inhibiting substance binding and uptake. Dev Dyn 193:295–299[Medline]
  13. Baarends WM, van Helmond MJL, Post M, van der Schoot PJCM, Hoogerbrugge JW, de Winter JP, Uilenbroek JTJ, Karels B, Wilming LG, Meijers JHC, Themmen APN, Grootegoed JA 1994 A novel member of the transmembrane serine/threonine kinase receptor family is specifically expressed in the gonads and in mesenchymal cells adjacent to the Müllerian duct. Development 120:189–197[Abstract]
  14. Teixeira J, He WW, Shah PC, Morikawa N, Lee MM, Catlin EA, Hudson PL, Wing J, MacLaughlin DT, Donahoe PK 1996 Developmental expression of a candidate Müllerian inhibiting substance type II receptor. Endocrinology 137:160–165[Abstract]
  15. di Clemente N, Wilson C, Faure E, Boussin L, Carmillo P, Tizard R, Picard J-Y, Vigier B, Josso N, Cate R 1994 Cloning, expression, and alternative splicing of the receptor for anti-Müllerian hormone. Mol Endocrinol 8:1006–1020[Abstract/Free Full Text]
  16. Ragin RC, Donahoe PK, Kenneally MK, Ahmad MF, MacLaughlin DT 1992 Human Müllerian inhibiting substance: enhanced purification imparts biochemical stability and restores antiproliferative effects. Protein Expr Purif 3:236–245[CrossRef][Medline]
  17. Catlin EA, Ezzell RM, Donahoe PK, Gustafson ML, Son EV, MacLaughlin DT 1993 Identification of a receptor for human Müllerian inhibiting substance. Endocrinology 133:3007–3013[Abstract/Free Full Text]
  18. Donahoe PK, Ito Y, Hendren III WH 1977 A graded organ culture assay for the detection of Müllerian inhibiting substance. J Surg Res 23:141–148[CrossRef][Medline]
  19. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning–A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor
  20. Massoud EAS, Sekhon HS, Rotschild A, Puterman ML, Matsui R, Thurlbeck WM 1993 In vitro branching morphogenesis of the fetal rat lung. Pediatr Pulmonol 15:89–97[Medline]
  21. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299[CrossRef][Medline]
  22. Erlich HA 1989 PCR technology. In: Principles and Applications for DNA Amplification. Stockton Press, pp 000–000
  23. Sanger F, Niklen S, Coulson AR 1977 DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  24. Taber S, Richardson CC 1987 DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA 14:4767–4771
  25. Serra R, Pelton RW, Moses HL 1994 TGF-ß1 inhibits branching morphogenesis and n-myc expression in lung bud organ cultures. Development 120:2153–2161[Abstract]
  26. Warburton D, Seth R, Shum L, Horcher PG, Hall FL, Werb Z, Slavkin HC 1992 Epigenetic role of epidermal growth factor expression and signaling in embryonic mouse lung morphogenesis. Dev Biol 149:123–133[CrossRef][Medline]
  27. Peters K, Werner S, Liao X, Wert S, Whitsett J, Williams L 1994 Targeted expression of a dominant negative FGF receptor blocks branching morphogenesis and epithelial differentiation of the mouse lung. EMBO J 13:3296–3301[Medline]
  28. Nielsen HC, Torday JS 1981 Sex differences in fetal rabbit pulmonary surfactant production. Pediatr Res 15:1245–1247[Medline]
  29. Floros J, Nielsen HC, Torday JS 1987 Dihydrotestosterone blocks fetal lung fibroblast-pneumonocyte factor at a pretranslational level. J Biol Chem 262:13592–13598[Abstract/Free Full Text]
  30. Slavkin HC, Johnson R, Oliver P, Bringas P, Don-Wheeler G, Mayo M, Whitsett J 1989 Lamellar body formation precedes pulmonary surfactant apoprotein expression during embryonic mouse lung development in vivo and in vitro. Differentiation 41:223–236[CrossRef][Medline]
  31. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BLM 1996 Evidence from normal expression and targeted misexpression that bone morphogenetic protein-4 (BMP-4) plays a role in mouse embryonic lung morphogenesis. Development 122:1693–1702[Abstract]
  32. Zou H, Niswander L 1996 Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272:738–741[Abstract]
  33. Wrana JL, Attisano L, Wieser R, Ventura F, Massague J 1994 Mechanism of activation of the TGF-ß receptor. Nature 340:341–347[CrossRef]
  34. Teixeira J, Donahoe PK 1996 Molecular biology of MIS and its receptors. J Androl 17:336–341[Abstract/Free Full Text]
  35. Imbeaud S, Faure E, Lamarre I, Mattei MG, di Clemente N, Tizard R, Carre-Eusebe D, Belville C, Tragethon L, Tonkin C, Nelson J, McAuliffe M, Bidart JM, Lababidi A, Josso N, Cate RL, Picard J-Y 1995 Insensitivity to anti-Müllerian hormone due to a mutation in the human anti-Müllerian hormone receptor. Nat Genet 11:382–388[CrossRef][Medline]
  36. Catlin EA, Uitvlugt ND, Donahoe PK, Powell DM, Hayashi M, MacLaughlin DT 1992 Müllerian inhibiting substance blocks epidermal growth factor receptor phosphorylation in fetal rat lung membranes. Metabolism 40:1178–1184[CrossRef]
  37. Klein JM, Nielsen HC 1992 Sex-specific differences in rabbit fetal lung maturation in response to epidermal growth factor. Biochim Biophys Acta 1133:121–126[Medline]
  38. Zhao Y, Young SL 1995 Expression of transforming growth factor-ß type II receptor in rat lung is regulated during development. Am J Physiol 269:L419–L426
  39. He WW, Gustafson ML, Hirobe S, Donahoe PK 1993 Developmental expression of four novel serine/threonine kinase receptors homologous to the activin/transforming growth factor-beta type II receptor family. Dev Dyn 196:133–142[Medline]
  40. MacLaughlin DT, Hudson PL, Graciano AL, Kenneally MK, Ragin RC, Manganaro TF, Donahoe PK 1992 Müllerian duct regression and anti-proliferative bioactivities of Müllerian inhibiting substance reside in its carboxy-terminal domain. Endocrinology 131:291–296[Abstract/Free Full Text]
  41. Maggard MA, Catlin EA, Hudson PL, Donahoe PK, MacLaughlin DT 1996 Reduction of epidermal growth factor receptor phosphorylation by activated Müllerian inhibiting substance is vanadate sensitive. Metabolism 45:190–195[CrossRef][Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
Q.-a. Yuan, H. H. Simmons, M. K. Robinson, M. Russeva, W. A. Marasco, and G. P. Adams
Development of engineered antibodies specific for the Mullerian inhibiting substance type II receptor: a promising candidate for targeted therapy of ovarian cancer.
Mol. Cancer Ther., August 1, 2006; 5(8): 2096 - 2105.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Zhan, A. Fujino, D. T. MacLaughlin, T. F. Manganaro, P. P. Szotek, N. A. Arango, J. Teixeira, and P. K. Donahoe
Mullerian inhibiting substance regulates its receptor/SMAD signaling and causes mesenchymal transition of the coelomic epithelial cells early in Mullerian duct regression
Development, June 15, 2006; 133(12): 2359 - 2369.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Salva, M. P. Hardy, X.-f. Wu, C. M. Sottas, D. T. MacLaughlin, P. K. Donahoe, and M. M. Lee
Mullerian-Inhibiting Substance Inhibits Rat Leydig Cell Regeneration after Ethylene Dimethanesulphonate Ablation
Biol Reprod, March 1, 2004; 70(3): 600 - 607.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. Teixeira, S. Maheswaran, and P. K. Donahoe
Mullerian Inhibiting Substance: An Instructive Developmental Hormone with Diagnostic and Possible Therapeutic Applications
Endocr. Rev., October 1, 2001; 22(5): 657 - 674.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. R. Clarke, Y. Hoshiya, S. E. Yi, X. Liu, K. M. Lyons, and P. K. Donahoe
Mullerian Inhibiting Substance Signaling Uses a Bone Morphogenetic Protein (BMP)-Like Pathway Mediated by ALK2 and Induces Smad6 Expression
Mol. Endocrinol., June 1, 2001; 15(6): 946 - 959.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
E. A. McGee, R. Smith, N. Spears, M. W. Nachtigal, H. Ingraham, and A. J.W. Hsueh
Mullerian Inhibitory Substance Induces Growth of Rat Preantral Ovarian Follicles
Biol Reprod, January 1, 2001; 64(1): 293 - 298.
[Abstract] [Full Text]


Home page
DevelopmentHome page
S Allard, P Adin, L Gouedard, N di Clemente, N Josso, M. Orgebin-Crist, J. Picard, and F Xavier
Molecular mechanisms of hormone-mediated Mullerian duct regression: involvement of beta-catenin
Development, January 8, 2000; 127(15): 3349 - 3360.
[Abstract] [PDF]


Home page
EndocrinologyHome page
J. A. Visser, A. McLuskey, M. Verhoef-Post, P. Kramer, J. A. Grootegoed, and A. P. N. Themmen
Effect of Prenatal Exposure to Diethylstilbestrol on Mullerian Duct Development in Fetal Male Mice
Endocrinology, October 1, 1998; 139(10): 4244 - 4251.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. L. Segev, T. U. Ha, T. T. Tran, M. Kenneally, P. Harkin, M. Jung, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran
Mullerian Inhibiting Substance Inhibits Breast Cancer Cell Growth through an NFkappa B-mediated Pathway
J. Biol. Chem., September 8, 2000; 275(37): 28371 - 28379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. U. Ha, D. L. Segev, D. Barbie, P. T. Masiakos, T. T. Tran, D. Dombkowski, M. Glander, T. R. Clarke, H. K. Lorenzo, P. K. Donahoe, et al.
Mullerian Inhibiting Substance Inhibits Ovarian Cell Growth through an Rb-independent Mechanism
J. Biol. Chem., November 17, 2000; 275(47): 37101 - 37109.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. L. Segev, Y. Hoshiya, M. Hoshiya, T. T. Tran, J. L. Carey, A. E. Stephen, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran
Mullerian-inhibiting substance regulates NF-kappa B signaling in the prostate in vitro and in vivo
PNAS, January 8, 2002; 99(1): 239 - 244.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catlin, E. A.
Right arrow Articles by Teixeira, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catlin, E. A.
Right arrow Articles by Teixeira, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals