| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Articles |
Pediatric Surgical Research Laboratory, Massachusetts General Hospital, and the Department of Surgery, Harvard Medical School; the Neonatology Unit, Pediatric Service, Massachusetts General Hospital (E.A.C.); and the Department of Pediatrics, Harvard Medical School, Boston, Massachusetts 02114
Address all correspondence and requests for reprints to: Elizabeth A. Catlin, M.D., Neonatology Unit, Pediatric Service, Founders House 442, Massachusetts General Hospital, Fruit Street, Boston, Massachusetts 02114. E-mail: catline{at}a1.mgh.harvard.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The male-specific embryonic expression of MIS provides a potential link to explore in sexually dimorphic developmental disease states, because in addition to its paracrine effects, MIS is a circulating hormone present in nanomolar concentrations in newborn male serum (6, 7). An important cause of infant morbidity and mortality, the neonatal respiratory distress syndrome, characterized by insufficient pulmonary surfactant, is one such sexually dimorphic disease occurring more often and with greater lethality in premature newborn males than in females (8, 9). We have previously shown that MIS is a negative regulatory factor in fetal rat lung biochemical maturation and that MIS binds in a punctate pattern to the cell surface and is trafficked internally in explanted developing lung, consistent with specific adsorptive endocytosis (10, 11, 12). Exposure of fetal lungs in culture as well as in vivo after transuterine delivery of MIS results in delayed accumulation of the major glycerophospholipid of pulmonary surfactant, disaturated phosphatidylcholine (10, 11).
We hypothesized that inhibitory regulatory event(s) in lung
morphogenesis might occur with the onset of MIS protein expression by
the testis, noting that the remarkable anatomical proximity of the
embryonic testis to the developing lung would facilitate paracrine
effects by MIS (Fig. 1
). To address this question,
branching morphogenesis and apoptosis in rat lung primordia exposed to
MIS in an organ culture model were studied. The putative MIS type II
receptor (MIS RII), as a partner in a heteromeric complex of type I and
type II single transmembrane serine/threonine kinase receptors, has
been cloned, and by in situ hybridization localizes strongly
to the embryonic Müllerian duct (13, 14, 15). To determine whether
the MIS RII, which in the TGFß paradigm is the ligand-binding form
conferring specificity to the heteromeric receptor complex, was present
in this responsive tissue (fetal lung), its expression was assessed by
reverse transcriptase-PCR (RT-PCR) and Northern blot analyses.
|
| Materials and Methods |
|---|
|
|
|---|
In vivo
The retrothorax and retroperitoneum of a 13.5-day gestation rat
embryo were studied using transmitted light after removing liver,
pancreas, stomach, and bowel, then photographed with special attention
paid to the proximity of the upper extent of the gonad to the
primordial lung.
Organ culture
Rat lungs (13.5 days gestation) were removed en bloc
using a dissecting microscope and placed on a 2% agarose drop cut to a
thickness of 1.52.0 mm suspended on a stainless steel wire grid in a
Falcon no. 3037 culture dish (Becton Dickinson, Lincoln Park, NJ).
Culture dishes contained 1 ml CMRL culture medium with 10% female FBS,
2.5 µg amphotericin B, 1 mM glutamine, and 2
mM ascorbic acid and were maintained in a 37 C incubator in
95% air-5% CO2 with 80% humidity. Explants were
randomized and viewed live and unstained at x40 magnification
(Microstar-110 microscope, American Optical, Buffalo, NY), and the
outline of the airways and splanchnic mesenchyme were drawn according
to the methods of Massoud et al. (20) using the camera
lucida attachment (American Optical). These outlines were scanned,
digitized (Applescan, version 1.0.2, Apple Computer) and analyzed (NIH
Image, version 1.37) to quantitate the area and perimeter of branching
airways and lung mesenchyme; total lung bud number was also recorded.
The entire explant and left lung of experimental and control explants
were analyzed on days 0 and 4. After 24 h of equilibration, media
from experimental and control cultures were rapidly aspirated and
replaced with fresh culture medium only, culture medium containing 30
or 300 nM MIS, or culture medium with 20 mM
HEPES or PBS added equal to the volume of the added MIS. This process
was repeated at 24-h intervals, and the experiment was terminated after
96 h. Statistical analyses of the differences in lung branching
parameters over the study period were performed using the Scheffes S
post-hoc test for one-factor ANOVA (SuperANOVA, Abacus
Concepts, Berkeley, CA). Significance was assigned for
P < 0.05. The SEM was used to represent
the data dispersion.
Apoptosis analysis
Embryonic day 13.5 lungs were explanted and randomized to MIS or
control groups as described above. Urogenital ridges were removed
according to the standard bioassay protocol (18) and similarly
incubated with or without bioactive MIS. Tissues were fixed in 10%
formalin, embedded in paraffin, and deparaffinized in two 5-min washes
of xylene and two 5-min washes of 100% ethanol, and washed 3 min each
in 95% and 70% ethanol. We used in situ nonisotopic
end-labeling methodology for detection of DNA fragmentation; the
manufacturers instructions for the Oncor Apoptag In Situ
Apoptosis Detection Kit: Peroxidase were followed, except that the
proteinase K concentration used was 10 µg/ml.
Northern analyses
Total RNA was prepared by homogenization in guanidinium
thiocyanate and centrifuged through a CsCl cushion (21). Polyadenylated
[poly(A)+] RNA was prepared with the Poly A Tract system
from Promega. Poly(A)+-enriched RNA (10 µg) samples were
denatured with dimethylsulfoxide and glyoxal at 65 C, separated in a
1.5% agarose gel, blotted overnight onto nylon membranes, and either
baked at 80 C in a vacuum oven or UV cross-linked (19). Blots were
prehybridized with 100 µg/ml sonicated salmon sperm DNA in 50%
formamide hybridization solution for 2 h at 65 C. Complementary
RNA probes of both full-length rat MIS RII and a 3'-PCR fragment from
the untranslated region of the rat MIS RII complementary DNA (cDNA)
(13, 14) were prepared with [
-32P]CTP. Blots were
hybridized overnight at 65 C with 1 x 107 cpm/ml
probe, then washed with 0.1 x SSC (1 x SSC = 150
mM sodium chloride and 15 mM sodium
citrate)-0.1% SDS at 65 C and exposed on radiographic film with
intensifying screens at -70 C.
RT-PCR
RT-PCR was carried out on total lung RNA, as described by Erlich
(22) with slight modification. One to 5 µg fetal rat lung RNA
collected at various gestational ages were reverse transcribed into
cDNA using Superscript II according to manufacturers suggestions. The
RT product was then subjected to 30 cycles of PCR with Pyrostase
thermostable DNA polymerase (Molecular Genetic Resources, Tampa, FL)
using a Robocycler (Stratagene, La Jolla, CA) with the following
program: 1-min denaturing at 94 C, 1-min annealing at 50 C, and 72 C
extension for 1 min. The PCR primers used were 20-mers designed using
the rat MIS RII cDNA sequence (13, 14) and included a 3'-set of primers
flanking a 349-bp fragment spanning 15711920 bp
(CCCTGGCTTATCCTCAGGTG, GAGTGGGAATCTTGCTTTAT). The PCR products were
separated by electrophoresis in a 1.5% agarose gel, stained with
ethidium bromide, visualized with a UV transilluminator, and
photographed. PCR fragments were isolated from the gel with Geneclean
(BIO 101, Vista, CA) and cloned into pCRII (Invitrogen, San Diego, CA)
for sequencing analysis by the Sanger dideoxy method (23) with modified
T7 polymerase (24) and reagents purchased from Amersham (Arlington
Heights, IL)/U.S. Biochemical Corp. (Cleveland, OH).
| Results |
|---|
|
|
|---|
The lung bud count is a direct quantification of branching
morphogenesis, and the increase in lung bud number from days 04
represents changes in branching, thus increasing complexity and
advancing differentiation. The outlines of airways and splanchnic
mesenchyme in fetal lung explants generated with the camera lucida
drawing attachment at the termination of a typical 4-day experiment are
shown in Fig. 2
. In Fig. 3
we have
plotted the changes in lung bud count over the study period under the
described conditions. Exposure to 30 nM MIS produced a
visible decrease in total lung bud number, with a mean reduction in bud
count of 22% compared to that in controls. Exposure to 300 nm MIS
caused a marked inhibition of branching, decreasing total lung bud
number by 52.8% (P = 0.0009), 48.6%
(P = 0.0498), and 52.6% (P = 0.0005)
compared to that in PBS, HEPES, and medium only controls, respectively.
PBS and HEPES controls were both studied because each has been used as
a vehicle buffer for MIS, and with variable volumes of buffer used to
deliver the MIS it was necessary to exclude a buffer effect on
branching. The medium only group was included to study branching in a
MIS-free and MIS vehicle-free milieu. Similar reductions in branching
were measured for left lung incubated with 300 nM MIS,
i.e. 58.9%, 52.9%, and 52.5%, compared that for PBS,
HEPES, and medium only controls, respectively. Sample groups consisted
of a minimum of 5 replicates and a maximum of 13.
|
|
To determine whether the MIS-mediated inhibition of lung development
might also be associated with apoptosis, we assayed lungs in organ
culture treated with or without 30 nM MIS as described
above for apoptotic bodies (Fig. 4
). Embryonic day 13.5
female urogenital ridges treated with and without 30 nM MIS
were used as controls to determine 1) the number of cells undergoing
apoptosis within and adjacent to the Müllerian duct as a positive
control, and from that, 2) what numbers of apoptotic bodies might be
expected in the MIS-treated lungs. The in situ apoptosis
detection assay used labels cells where DNA fragmentation has generated
multiple 3'-hydroxy DNA ends with terminal deoxynucleotidyl
transferase. This nonisotopic DNA extension is then localized with an
antidigoxigenin antibody peroxidase conjugate. Apoptotic bodies were
observed in the urogenital ridges treated with MIS, where they were
specifically localized, as expected, in the regressing Müllerian
ducts. In contrast, brown apoptotic bodies were observed dispersed
throughout sections from explanted lungs treated with MIS.
|
|
|
| Discussion |
|---|
|
|
|---|
The concentration of MIS required to inhibit branching morphogenesis in these studies is high. Whether daily MIS exposure is required to impair branching is not known. Only one initial dose of MIS is required for the standardized urogenital ridge bioassay (18), and only one initial MIS dose (resulting in delayed pulmonary surfactant accumulation 48 and 72 h later) was used in studies in which fetal rats were injected in vivo with nanomolar concentrations of MIS (11). It is conceivable, therefore, that a single MIS dose may be sufficient to produce the effects measured, rather than daily dosing of MIS or continued anatomical proximity of testis and lung. If an initial paracrine MIS exposure is sufficient to cause a delay in branching morphogenesis, then further high dose exposure later in gestation might be unnecessary. We previously reported that recombinant MIS in concentrations of 45450 pM incubated with gestation day 17.5 fetal rat lung cultures delayed accumulation of the major glycerophospholipid of pulmonary surfactant (10). Inhibition of branching by higher dose MIS (early in gestation, when testis and lung are anatomically close) combined with data showing impaired surfactant accumulation later in gestation by lower dose MIS support the hypothesis that MIS contributes to the male disadvantage in respiratory distress syndrome, in that higher dose paracrine MIS exposure is conceivable when testis and lung are proximate and lower dose MIS exposure is ongoing at concentrations approaching 1 nM in embryonic human male serum from week 7 throughout gestation.
MIS induces changes characteristic of programmed cell death in the Müllerian duct (3, 5), and here we demonstrate by in situ end-labeling methodology that apoptosis is, as expected, activated there. In addition, to correlate with the findings of diminished branching morphogenesis and differentiation (10, 11), we now report that apoptosis is induced to a considerable degree in embryonic lungs incubated with MIS. Similarly, another TGFß family member, bone morphogenetic protein-4, when targeted to and overexpressed in lung, produces abnormal morphogenesis, including grossly small lungs, delayed cytodifferentiation, and proliferation of mesenchymal cells with an increase in cell death (31). Apoptosis or programmed cell death is an evolutionarily conserved process that directs embryonic development and regulates cell numbers. Whether MIS-induced apoptosis in lung and its effects on branching morphogenesis are functionally linked is unknown. Extrinsic signals known to activate the cell death program include bone morphogenetic protein signaling (32), cell damage caused by viral infection and ionizing radiation, expression of oncogenes, removal of growth factors (4), and, as presented here, MIS exposure.
The presence of the MIS RII in fetal rat lung is consistent with a role in the measured inhibitory effect(s) of the MIS ligand and suggests that those effects are mediated in part by this receptor. The rat MIS RII is a serine/threonine kinase receptor with a single transmembrane domain belonging to the TGFß type II receptor family (13, 14). By analogy to the mechanism of action of the TGFß receptors (33), it was expected that the MIS RII would reside in the plasma membrane of MIS-responsive fetal lung cells to bind ligand, next forming a complex with type I receptors and so initiating a signaling cascade (34). We previously reported confocal imaging evidence of specific cell surface binding and uptake of an MIS-fluorescent antibody sandwich in explanted fetal rat lungs (12). Recent Northern analyses of human fetal lung mRNA hybridized with a riboprobe from human MIS RII cDNA (35) confirm the expression of this receptor in human fetal lung tissue (Catlin, E. A., unpublished) and further support the possible relevance of these findings to the neonatal male disadvantage in the respiratory distress syndrome. Definitive proof, however, that a functional ligand-receptor unit exists, as implied in the adsorptive endocytosis results seen on confocal imaging (12), given the presence of MIS RII in fetal lung combined with high local concentrations as well as circulating MIS ligand in fetal males, awaits further studies.
A second speculation is that MIS-mediated inhibition of branching morphogenesis involves EGF, which produces a dose-dependent stimulation of fetal lung branching in vitro (26). We have previously reported that MIS inhibits EGF receptor phosphorylation in fetal rat lung (36). Also, Warburton and colleagues showed that a specific EGF receptor kinase antagonist (tyrphostin) causes concentration-dependent inhibition of branching (26); thus, MIS and EGF may function as antagonists during the secondary embryonic induction of lung branching. In addition, male fetal rabbit lung explants have been reported to be resistant to EGF-mediated surfactant stimulation during a window of time, suggesting the presence of a male-specific endogenous inhibitor (37).
It is conceivable that the MIS ligand might bind to other TGFß family receptors, activating downstream pathways and resulting in branching inhibition. TGFß1 has recently been shown to inhibit branching morphogenesis and n-myc expression in fetal lung in a dose-dependent manner (25), and the TGFß type II receptor is expressed as early as gestation day 16 in fetal rat lung (38). Arguing against this proposed mechanism is the evidence that radiolabeled MIS does not bind to TGFß type II receptor-transfected COS cells (14, 15), and signaling for TGFß family members requires the kinase domains of both type I and type II receptors (33); thus, the presence of the MIS type II receptor would be expected to be required for signaling. However, the exact mechanisms and conditions of receptor cross-talk are unknown and certainly could involve cell specificity or be regulated by pairing of ligand-specific type II receptors with different type I receptors (39).
The cumulative findings described here, including detection of the MIS RII in fetal rat lung, suggest that paracrine MIS, secreted from the embryonic testis to the neighboring lung rudiment, or circulating serum MIS binds to developing lung via its receptor, initiating a signal transduction cascade that results in inhibition of airway branching and perhaps cytodifferentiation. This process in the lung coincides with the developmental event of MIS-initiated programmed cell death in the male Müllerian duct. Growth and/or differentiation arrest has been observed in MIS-treated A431 cells (40), a human cell line that binds MIS (17). The downstream events elicited by MIS binding are largely unknown, but we do know that MIS decreases EGF receptor autophosphorylation in A431 membranes (41), that EGF receptor phosphorylation in fetal rat lung membranes is similarly inhibited (36), and that apoptosis is activated by MIS in lung as well as in the Müllerian duct. It is tempting to speculate that paracrine as well as endocrine MIS may play a role in the delicate balance of stimulatory and inhibitory factors that influence the developing lung, and that MIS under certain circumstances, such as premature birth of the fetus, could contribute to impaired male lung development and the male disadvantage, as commonly observed, in the neonatal respiratory distress syndrome.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received August 16, 1996.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Q.-a. Yuan, H. H. Simmons, M. K. Robinson, M. Russeva, W. A. Marasco, and G. P. Adams Development of engineered antibodies specific for the Mullerian inhibiting substance type II receptor: a promising candidate for targeted therapy of ovarian cancer. Mol. Cancer Ther., August 1, 2006; 5(8): 2096 - 2105. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhan, A. Fujino, D. T. MacLaughlin, T. F. Manganaro, P. P. Szotek, N. A. Arango, J. Teixeira, and P. K. Donahoe Mullerian inhibiting substance regulates its receptor/SMAD signaling and causes mesenchymal transition of the coelomic epithelial cells early in Mullerian duct regression Development, June 15, 2006; 133(12): 2359 - 2369. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Salva, M. P. Hardy, X.-f. Wu, C. M. Sottas, D. T. MacLaughlin, P. K. Donahoe, and M. M. Lee Mullerian-Inhibiting Substance Inhibits Rat Leydig Cell Regeneration after Ethylene Dimethanesulphonate Ablation Biol Reprod, March 1, 2004; 70(3): 600 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Segev, Y. Hoshiya, M. Hoshiya, T. T. Tran, J. L. Carey, A. E. Stephen, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran Mullerian-inhibiting substance regulates NF-kappa B signaling in the prostate in vitro and in vivo PNAS, January 1, 2002; (2002) 221599298. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Teixeira, S. Maheswaran, and P. K. Donahoe Mullerian Inhibiting Substance: An Instructive Developmental Hormone with Diagnostic and Possible Therapeutic Applications Endocr. Rev., October 1, 2001; 22(5): 657 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Clarke, Y. Hoshiya, S. E. Yi, X. Liu, K. M. Lyons, and P. K. Donahoe Mullerian Inhibiting Substance Signaling Uses a Bone Morphogenetic Protein (BMP)-Like Pathway Mediated by ALK2 and Induces Smad6 Expression Mol. Endocrinol., June 1, 2001; 15(6): 946 - 959. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. McGee, R. Smith, N. Spears, M. W. Nachtigal, H. Ingraham, and A. J.W. Hsueh Mullerian Inhibitory Substance Induces Growth of Rat Preantral Ovarian Follicles Biol Reprod, January 1, 2001; 64(1): 293 - 298. [Abstract] [Full Text] |
||||
![]() |
S Allard, P Adin, L Gouedard, N di Clemente, N Josso, M. Orgebin-Crist, J. Picard, and F Xavier Molecular mechanisms of hormone-mediated Mullerian duct regression: involvement of beta-catenin Development, January 8, 2000; 127(15): 3349 - 3360. [Abstract] [PDF] |
||||
![]() |
J. A. Visser, A. McLuskey, M. Verhoef-Post, P. Kramer, J. A. Grootegoed, and A. P. N. Themmen Effect of Prenatal Exposure to Diethylstilbestrol on Mullerian Duct Development in Fetal Male Mice Endocrinology, October 1, 1998; 139(10): 4244 - 4251. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Segev, T. U. Ha, T. T. Tran, M. Kenneally, P. Harkin, M. Jung, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran Mullerian Inhibiting Substance Inhibits Breast Cancer Cell Growth through an NFkappa B-mediated Pathway J. Biol. Chem., September 8, 2000; 275(37): 28371 - 28379. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. U. Ha, D. L. Segev, D. Barbie, P. T. Masiakos, T. T. Tran, D. Dombkowski, M. Glander, T. R. Clarke, H. K. Lorenzo, P. K. Donahoe, et al. Mullerian Inhibiting Substance Inhibits Ovarian Cell Growth through an Rb-independent Mechanism J. Biol. Chem., November 17, 2000; 275(47): 37101 - 37109. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Segev, Y. Hoshiya, M. Hoshiya, T. T. Tran, J. L. Carey, A. E. Stephen, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran Mullerian-inhibiting substance regulates NF-kappa B signaling in the prostate in vitro and in vivo PNAS, January 8, 2002; 99(1): 239 - 244. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |