help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pilon, N.
Right arrow Articles by Silversides, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pilon, N.
Right arrow Articles by Silversides, D. W.
Endocrinology Vol. 138, No. 3 1085-1091
Copyright © 1997 by The Endocrine Society


Articles

Porcine and Bovine Steroidogenic Acute Regulatory Protein (StAR) Gene Expression during Gestation1

Nicolas Pilon, Isabelle Daneau, Chantal Brisson, Jean-François Ethier, Jacques G. Lussier and David W. Silversides

Centre de Recherche en Reproduction Animale, Department of Veterinary Biomedicine, Faculty of Veterinary Medicine, University of Montreal, St. Hyacinthe, Quebec, Canada J2S 7C6

Address all correspondence and requests for reprints to: Dr. David W. Silversides, Centre de Recherche en Reproduction Animale, Faculty of Veterinary Medicine, University of Montreal, St. Hyacinthe, Quebec, Canada J2S 7C6. E-mail: silverdw{at}ere.umontreal.ca


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have generated complete complementary DNA (cDNA) sequences for the porcine steroidogenic acute regulatory protein (StAR) gene, using a combination of genomic PCR amplification and reverse transcription-PCR amplification of pig ovarian cDNA. Porcine StAR cDNA consists of 855 bp and shares 90.2%, 87.3%, 84.3%, and 83.9% homologies with bovine, human, mouse, and rat StAR cDNA at the nucleotide level, and 89.1%, 88.8%, 86.7%, and 86.3% homologies with bovine, human, mouse, and rat StAR protein at the deduced amino acid level. Northern analysis of porcine StAR showed that it is expressed in adult and fetal steroidogenic tissues, including adult testes and ovaries and adult adrenal glands as well as steroidogenic tissues of pregnancy, including developing fetal testes, corpus luteum, and pregnancy, but not the fetal ovary. Major hybridizing bands of 1.8 and 1.1 kilobases were demonstrated. In contrast to human StAR, porcine StAR was not expressed in adult or fetal kidneys. Expression of porcine StAR by the pig placenta is in contrast to human StAR, which is not expressed by the human placenta. Northern analysis of bovine cotyledons using a homologous probe for bovine StAR showed that StAR is also expressed by the placenta in the bovine animal. With respect to placental expression of StAR, variations may exist among mammalian species.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
STEROIDOGENESIS during mammalian pregnancy is characterized by pregnancy-specific steroidogenic tissues and pregnancy-specific functions. The corpus luteum (CL) and placenta are transient steroidogenic tissues involved in the maintenance of pregnancy, whereas the gonads of the male fetus elaborate steroids that are important for sex differentiation. The relative importance of the CL and placenta for the maintenance of pregnancy shows considerable variation among mammalian species. In the pig, removal of the CL at any time throughout gestation will cause abortion, whereas removal of the human CL after the first trimester or the bovine CL in later pregnancy is compatible with continued gestation (1, 2). Alternatively, placental production of progesterone in humans appears essential for the maintenance of pregnancy, whereas in other species, such as the rabbit, this is not the case (1). The mechanisms that control steroidogenesis in the placenta are not as well studied as those of the CL and may well be different (1).

Steroids required for male sex differentiation are produced by the fetal testes shortly after sex determination, which in the mouse occurs between embryonic day 10.5 (e10.5) and e12 and in the pig occurs between e21 and e26 (3, 4). In the male fetus, the developing Leydig cells produce and secrete testosterone, which is required for the retention and growth of the Wolffian duct, the anlagen of the male internal reproductive tract, as well as for the growth of external male structures. In the female, the lack of testosterone results in regression of the Wolffian duct. Partial or complete deprivation of testosterone to the male fetus during gestation, whether via surgical (5), pharmaceutical (6), or genetic (7, 8) means, will result in developmental anomalies in secondary male sex structures, which in extreme cases can produce genetic males displaying female secondary sex characteristics.

The molecular biology of steroid hormone synthesis is now relatively well characterized (9, 10, 11). The rate-limiting enzymatic step in gonadal and adrenal steroidogenesis is the conversion of cholesterol to pregnenolone by the cytochrome P450 enzyme complex for cholesterol side-chain cleavage (P450SCC), which is situated on the inner side of the mitochondrial membrane. The acutely regulated step in steroidogenesis in these organs, however, is the delivery of cholesterol from cellular stores across the mitochondrial membrane for presentation to the P450SCC enzymatic complex. Extensive studies of several steroidogenic cell systems have identified a number of protein molecules potentially implicated in the acute regulation of steroidogenesis (for review, see Ref.12). In particular, a class of 30-kDa proteins, localized to mitochondria, is induced by trophic hormone stimulation and has been implicated in the transport of cholesterol across the mitochondrial membrane. These proteins have been described in rat and mouse Leydig cell lines (13, 14), rat adrenal cortex and CL primary cell cultures, and bovine adrenal and granulosa cell cultures (15). Because of their acute hormone responsiveness and their ability to stimulate steroid production in the absence of hormone stimulation, these proteins have been named steroidogenic acute regulatory proteins (StAR) (12, 14). The mouse Leydig tumor cell line MA10 proved useful for the purification and microsequencing of peptides derived from these proteins; this information, in turn, allowed the design of degenerate nucleotide primers and the PCR amplification of partial complementary DNA (cDNA) sequences for the mouse StAR gene (14). These sequences were used to screen a phage mouse Leydig tumor cell cDNA library, and full-length StAR cDNA sequences were derived (14). Mouse StAR genomic organization was described (16), human cDNA and genomic sequences were generated (17, 18), and partial ovine cDNA sequences were reported (19). Independently, human StAR cDNA was cloned as an orphan sequence identified via chimeric association with human p220 translation initiation factor (20), and bovine StAR cDNA was cloned as an orphan sequence identified via differential cDNA expression studies of CL cells taken from early and late in the bovine estrous cycle (21). More recently, the rat StAR cDNA has been reported (22).

Recently, we proposed the pig as a useful model for studying mammalian sex determination and differentiation at the molecular level (4). To examine the expression of StAR gene for both fetal sex differentiation and maternal maintenance of pregnancy in the pig, we have cloned StAR cDNA sequences from this species. In a parallel study, bovine StAR cDNA sequences were cloned, and the expression of bovine StAR was studied in fetal and adult tissues from this species.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genomic cloning porcine StAR
Genomic sequences of the porcine StAR gene were initially derived via PCR cloning to provide coding sequences for subsequent cDNA cloning. Heterologous sense (pStAR.A: 5'-TGGTICCAGATGTGGGCAAGGTGTT, where I is inosine) and antisense (pStAR.1: 5'-AGTTTIGTCTTIGAGGGACTTCCAGCCA, where I is inosine) primers were designed based on mouse and human sequences to amplify a genomic fragment spanning from exon 3 to exon 5. PCR cycling was performed on 0.5 µg male genomic pig DNA using Taq DNA polymerase (Amplitaq, Perkin-Elmer/Cetus, Norwalk, CA). Thermal cycling included 40 cycles of 45-sec denaturation at 95 C, 45 sec of annealing at 66 C, and 2-min elongation at 72 C. Products of the amplification were size-separated on a 1% agarose gel, and a fragment of 1.2 kilobases (kb) was identified for further characterization, excised from the gel, purified, and cloned into the PCRII vector (Clontech, Palo Alto, CA). Sequencing via the dideoxy method (T7Sequencing Kit, Pharmacia Biotech, Uppsala, Sweden) confirmed that this clone, named pStAR.A1(genomic), represented porcine StAR genomic sequences.

Rapid amplification of 3'-cDNA ends (3'RACE) cloning porcine StAR
To identify a useful source of RNA for subsequent 3'RACE and 5'RACE cloning of porcine StAR cDNA sequences, the cDNA fragment represented by primers pStAR.A and pStAR.1 was amplified and cloned via reverse transcription-PCR from pig ovarian polyadenylated [poly(A)+] RNA to give clone pStAR.A1(cDNA). Based on coding sequences of the porcine StAR gene derived from preliminary genomic and cDNA cloning, homologous sense and antisense primers were designed for cDNA cloning via 3'RACE and 5'RACE PCR methods. Ovarian total RNA was recovered via the acid phenol method (23). Poly(A)+ RNA was derived using magnetic bead technology (Magnetobeads, Dynal Corp., Great Neck, NY), as previously described (24). To generate the 3'-end of porcine StAR cDNA, 2 µg poly(A)+ RNA were reverse transcribed using a poly(deoxythymidine) adapter-primer, AD/T7T17 (5'-GGATCCAAGCTTGAATTCTAATACGACTCACTATAGGGTTT-TTTTTTTTTTTTTT), and reverse transcriptase enzyme according to the supplier’s instructions (Superscript RT, Life Technologies, Grand Island, NY). Of the 30-µl total volume of first strand synthesis reaction, 2 µl were used in a primary PCR reaction of 40 cycles using specific sense primer 3'A (5'-GACCAGCCCATGGAGAGGCTT) and nonspecific primer AD/BHE (5'-GGATCCAAGCTTGAATTCTAATACG) and the following cycling conditions: 45-sec denaturation at 95 C, 45-sec annealing at 64 C, and 2-min elongation at 72 C. One microliter of this first PCR was used to seed a nested PCR involving specific sense primer 3'B (5'-AGCGCATGGAGGCCATGGGC) and nonspecific primer AD/ET7 (5'-GAATTCTAATACGACTCACTATAGGG), with the same cycling conditions as mentioned. An amplified band of 800 bp was identified on a 1% agarose gel, cloned into PCRII vector (Invitrogen), and upon preliminary sequencing was shown to represent the 3'-end of porcine StAR gene. Complete sequencing of this clone, named pStAR.3'RACE AD/ET7.3'B, was performed in house via the dideoxy method and via commercially available automated sequencing methods (Regional DNA Synthesis Laboratory, University of Calgary, Calgary, Canada).

5'RACE cDNA cloning porcine StAR
To derive 5' cDNA sequences for porcine StAR gene, a RACE 5' method was used as previously described (25) with minor modifications. Briefly, 2 µg porcine ovarian poly(A)+ RNA were reverse transcribed using the heterologous StAR antisense primer 1. The RNA was then hydrolyzed via incubation with 0.4 N NaOH for 30 min at 65 C, and first stranded cDNA was recovered and purified via centrifugal filtration (Microcon-100 microconcentrator, Amicon, Lexington, MA). The cDNA was then precipitated via incubation with 2 vol ethanol, 0.2 M sodium acetate, and 15 µg glycogen at -20 C for 1 h. Single stranded DNA ligation was performed between the first strand cDNA and a primer designed for this purpose (ANCH.PRIM: 5'-GCAGGATCCTGAAGCTTGAATTC, with the 5'-end phosphorylated and the 3'-end modified with an amino group). The ligation reaction was performed in a volume of 10 µl at room temperature for 24 h in a hexamine chloride buffer (25) using T4 RNA ligase (New England Biolabs, Beverley, CA). A first PCR reaction was performed using a specific antisense primer 5'1 (5'-GCGCTCCACAAGCTCTTCATAA) and the nonspecific primer ANCH.SEQ (5'-GAATTCAAGCTTCAGGATCCTGC) with 40 cycles of 45-sec denaturation at 95 C, 45 sec of annealing at 66 C, and 2 min of elongation at 72 C. A second, nested PCR reaction was then performed using the specific antisense primer 5'2 (5'-TGGTCCACCACCACCTCCAGC) and the primer ANCH.SEQ, seeded with 1 µl of the first PCR reaction. Amplification reactions were size-fractionated on a 1% agarose gel, and a band of about 700 bp was identified, gel purified, and cloned into PCRII vector. Sequencing confirmed that this clone, identified as pStAR.5'RACE ANCH.SEQ.5'2, represented 5'-cDNA sequences for the porcine StAR gene.

Open reading frame (ORF) StAR porcine cDNA
To provide complete coding sequences of porcine StAR for subsequent Northern expression analysis, primers were designed to PCR amplify the ORF (sense primer Exp A: 5'-GGATCCATGCTCCTAGCGACGTTTAAGCTGT, where GGATCC is an exogenous BamHI site; antisense primer Exp1: 5'-AAGCTTAGCTTTAACACCTGGCTTCCAGAG, where AAGCTT is an exogenous HindIII site). Ovarian poly(A)+ RNA was reverse transcribed as described above for the 3' RACE methods, and a PCR amplification was performed using standard methods. The resulting band was cloned into PCRII vector to give pStAR.EXP.A1.

Northern analysis porcine StAR and P-450 SCC
To study the developmental expression of porcine StAR gene during gonadal sex differentiation, fetal ovaries and testes were dissected from fetuses taken from pregnant sows at a local abattoir. Gestational length was estimated by measuring the embryonic crown-rump length (26). At the same time, samples of placenta, adult ovaries, and fetal kidneys as well as adolescent and adult testes were taken. Total RNA was extracted via the acid-phenol method or, for the adrenal glands and adult tissues, via pelleting over a cesium chloride gradient (27). RNA (10 µg total/tissue type) was size-fractionated on a 1% formaldehyde-1% agarose gel and transferred via capillarity to a nylon membrane (Hybond-N, Amersham Corp., Arlington Heights, IL). To estimate the relative RNA loading per well, the membrane was stained with methylene blue via standard methods (28), and the gel image was digitized (Foto/Eclipse, Fotodyne). A radioactive double stranded probe was generated using porcine pStAR.EXP.A1 clone. In addition, 518 bp of cDNA sequences for the porcine P-450 side-chain cleavage (P-450SCC) gene were generated via reverse transcription-PCR amplification of porcine ovarian RNA. Primers were designed based on published sequences (29) to give 518 bp of cDNA sequences including the steroid binding sequence (sense: pSCC.A, 5'-CAATGTTACCGAGATGCT; antisense: pSCC.1, 5'-CTGGAGTGGATCCTGATTG). Membranes were hybridized overnight with radioactive probes for porcine StAR or porcine P-450SCC generated via the random priming method (Quick Prime, Pharmacia) using [{alpha}-32P]CTP (DuPont, Wilmington, DE). Membranes were then washed at high stringency and exposed to photographic film (BioMax, Eastman Kodak, Rochester, NY) at -70 C overnight and for 6–24 h (see figure legends).

cDNA cloning bovine StAR
To test the clonal representation of a bovine CL cDNA library (30) made in Lambda Zap Express (Stratagene) as well as to derive bovine StAR sequences for physiological studies in this species, 500,000 plaque-forming units were hybridized with a probe (A1) derived from porcine partial cDNA StAR sequences. After the initial screening, approximately 50 plaques hybridized strongly; 12 of these were purified via replating at serial dilutions and rehybridized. Two clones were selected for in vivo excision of the insert containing pBK plasmid, and upon restriction analysis revealed an insert of approximately 2.5 kb. Sequencing and comparisons with previously published sequences (21) confirmed that these clones, labeled pBK.bStAR(cDNA), represented bovine StAR cDNA sequences.

Northern analysis bovine StAR
Representative bovine tissues were analyzed for StAR gene expression using the homologous bovine probe derived via phage cloning. Total RNA was generated via the acid-phenol method or via cesium chloride gradient pelleting (27), and 10 µg/tissue were loaded per lane for Northern analysis. The following tissues were analyzed: adult epididymus, adult testicles, testicles from a 7-month-old fetus, ovaries from a 5-month-old fetus, superovulated adult follicles, CL, adult oviducts, uterus, cotyledons (placenta), and adrenal gland. A radioactive probe was generated with the 2.5-kb pBK.bStAR(cDNA) sequence using the random priming method (Quick Prime, Pharmacia) and [{alpha}-32P]deoxy-CTP (DuPont). Size-fractionated bands were transferred via capillarity to nylon membrane and hybridized overnight to the bovine StAR probe. The hybridized blot was exposed to photographic film (BioMax, Kodak) for 1 week at -70 C with an intensifying screen.

Nucleotide and amino acid comparisons
Comparisons of nucleotide and deduced amino acid sequences were performed via a Lipman and Person type olgarithm (31) using MacDNASIS software (Hitachi, Hialeah, FL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nucleic acid and deduced amino acid sequences for porcine StAR cDNA are shown in Fig. 1Go. Porcine StAR cDNA shows an ORF of 855 bp representing a transcribed protein of 285 amino acids, a 5'-untranslated region of 122 bp, and a 3'-untranslated region of 234 bp, to give a total size of 1211 bp. Percent homologies of porcine StAR cDNA at the nucleotide and deduced amino acid levels (in parentheses) with StAR cDNA from other species are as follows: bovine, 90.2% (89.1%); human, 87.3% (88.8%); mouse, 84.3% (86.7%); and rat, 83.9% (86.3%).



View larger version (86K):
[in this window]
[in a new window]
 
Figure 1. cDNA sequence, deduced amino acid sequence for porcine StAR. The deduced amino acid sequence appears below the nucleic acid sequence. The first A of the ATG start codon represents nucleotide 1, whereas the corresponding Met represents amino acid 1. The stop codon at nucleotide 856 is indicated by asterisks, and the 3'-polyadenylated sequence is italicized.

 
Expression of porcine StAR cDNA in CL, placenta, and fetal gonads during pregnancy was determined by Northern analysis and consistently revealed a major hybridizing band with a calculated size of about 1.8 kb and a fainter band of about 1.1 kb (Figs. 2Go and 3Go). Our cloned porcine StAR cDNA sequence, at 1211 bp, suggests that the lower band may, in fact, be slightly larger than the Northern estimates.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 2. Porcine StAR and P450SCC gene expression in the developing gonads during sex differentiation and in adult tissues via Northern blot analysis. Loading of RNA is as follows: testes (nb), 7-day-old pig testicles; testes (adult); ovaries (adult); adrenal glands (adult); ovaries (e12w), embryonic ovaries at 12 weeks gestation; testes (e12w), embryonic testes at 12 weeks gestation; ovaries (e13w), fetal ovaries at 13 weeks gestation; and testes (e13w), fetal testes at 13 weeks gestation; kidney (fetal). A, The probe is porcine StAR cDNA; hybridizing bands at 1.8 and 1.1 kb are marked. Sample loading is indicated by the 18S RNA band. Membrane was exposed to film for 6 h. B, The probe is porcine P450SCC; the hybridizing band at 1.9 kb is marked. Sample loading is indicated by the 18S RNA band. Membrane was exposed to film for 6 h.

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. Porcine StAR and P540SCC gene expression in CL and placenta. Loading of RNA is as follows: placenta (7w), placenta from 7 weeks gestation; placenta (13w), placenta from 13 weeks gestation; CL (7w), CL from 7 weeks gestation; CL (13w), CL from 13 weeks gestation; ovary (adult); and kidney (adult). A, The probe is porcine StAR cDNA; hybridizing bands at 1.8 and 1.1 kb are marked. Sample loading is indicated by the 18S RNA band. Membrane was exposed to film for 24 h. B, The probe is porcine P450SCC; the hybridizing band at 1.9 kb is marked. Sample loading is indicated by the 18S RNA band. Membrane was exposed to film for 18 h.

 
A developmental profile of porcine StAR expression in gonadal tissue via Northern analysis is presented in Fig. 2Go. Porcine StAR expression was detected in all testicular tissue tested, including fetal testes (weeks 12 and 13 of gestation), perinatal testes, and adult testes. In contrast, StAR expression was not detected in fetal ovaries, consistent with an absence of steroidogenesis in the fetal ovary, but was very weakly present in adult ovaries (taken from slaughterhouse material, age and stage of cycle unknown; compare these results with ovary in Fig. 3Go). Porcine StAR expression was also seen in the adult adrenal gland.

To further our understanding of the steroidogenic relationship between the pig placenta and CL during gestation, we compared the expression of the porcine StAR and P450SCC genes within these tissues. Porcine StAR expression was relatively weak, but was readily detected, in the placenta at 7 and 13 weeks gestation, while StAR was strongly expressed in the CL at these times. A porcine ovary (different sample from Fig. 3Go, again stage of cycle undetermined) displays relatively strong StAR expression, whereas adult kidney does not show StAR expression.

We have also cloned and sequenced bovine StAR cDNA and find our sequences in agreement with previously reported sequences (21), with the following changes at the deduced amino acid level: 75H=Y, 102Q=H, 103A=P, 273K=N, and 274R=G. In our Northern studies of bovine StAR expression, we found hybridizing bands of about 1.4 and 2.4 kb (Fig. 4Go). We demonstrate positive hybridization of a bovine StAR cDNA probe to bovine fetal and adult testes, superovulated ovary, CL, placentomes, and adrenal gland. Very faint hybridization was seen in the fetal bovine ovary at 5 months gestation; the significance of this is not known.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 4. Bovine StAR gene expression in fetal and adult tissues. Loading of RNA is as follows: epididymus (adult), testes (adult), fetal testes (7 months gestation), fetal ovaries (5 months gestation), follicular cells (superovulated), CL, oviduct (adult), uterus (adult nongravid), and placentome; adrenals (adult). The probe is bovine StAR cDNA; hybridizing bands at 2.4 and 1.4 kb are marked. The radiograph was overexposed for follicle and CL lanes (1-week exposure time) to demonstrate hybridization in the fetal placentome lane. Sample loading is indicated by the 18S RNA band.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have cloned porcine StAR cDNA sequences and initiated studies to look at the expression of this gene in pregnancy-specific steroidogenic tissues, including fetal gonads, CL, and placenta. We show that porcine StAR cDNA shows general homology to previously described mouse, human, bovine, and rat sequences (14, 17, 21, 22), and that there are no areas of notably reduced homologies. From this we can conclude that the StAR gene is not undergoing the rapid evolutionary changes seen in some of the genes implicated in sex determination, such as SRY and possibly DAX-1 (32, 33).

The transcript sizes seen on our Northern analysis of porcine StAR expression include a major band at 1.8 kb and a minor band at 1.1 kb. We have most likely cloned the lower band, which, via sequencing, is 1.2 kb. These findings are in general agreement with transcript sizes seen for StAR in other species: in the mouse, two major bands are seen at 3.4 and 1.6 kb (with a minor and inconsistent band at 2.7 kb) (16); in humans, a major transcript of 1.6 kb and minor transcripts of 4.4 and 7.5 kb are described (17, 20). In the cow, two transcript sizes are reported at 1.8 and 3.0 kb (21); our cloned bovine sequences at 2.7 kb correspond to the higher mol wt transcript. To date, no differential splicing has been described for the StAR gene, so it is probable that different transcript sizes represent differential use of polyadenylation signals. Expression of porcine P450SCC mirrored StAR expression, suggesting that porcine StAR expression is involved in steroidogenesis in these tissues.

During pregnancy, the relative contribution and importance of the CL and placenta for steroidogenesis and the maintenance of pregnancy varies between species (1). Also, major qualitative and quantitative differences exist in the steroidogenic capacity of placentas between species and even within species at different stages throughout pregnancy (1, 2, 34). For example, in humans, sheep, and horses, after a certain point in gestation the placenta can maintain pregnancy in the absence of the CL. In contrast in the pig the CL is required for the duration of pregnancy, and removal of the CL at any time throughout gestation will result in termination of the pregnancy.

Most interestingly, an absence of StAR transcription has been reported in the human placenta (17, 20); also, StAR protein was not seen in the mouse placenta (16). These observations support the hypothesis that within a mammalian species, mechanisms for steroidogenesis in the placenta need not be the same as those found in the gonads (1, 2). This may not be conceptually unreasonable, as the placenta is a composite fetal/maternal tissue, which is anatomically and developmentally distinct from the gonadal/adrenal tissues; as such, the placenta would not be subject to the same evolutionary pressures as other steroidogenic tissues. Indeed, the placenta contains some of the fastest evolving protein hormones described (35) and varies considerably in structure (36) as well as function (37) between mammalian species. In terms of placental function, care must be exercised not to extrapolate the findings in one mammalian species to others. In contrast to the lack of placental expression StAR seen in humans (order Primates) (17, 20), our data confirm that StAR is expressed by the placenta of at least two members of the order Artiodactyla, the pig and the cow.

Testosterone synthesis by the fetal testes is required for male sex differentiation, whereas fetal ovaries are not steroidogenically active. Consistent with this view, we detected strong expression of the porcine StAR gene in the developing testes during the time of sex differentiation, with an absence of StAR expression in the developing ovaries. StAR gene activity has also been reported in the human fetal kidney (20), although StAR protein has not been demonstrated. Neither StAR message nor protein was detected in mouse or rat kidney (16, 22). We looked for StAR gene expression in fetal and adult porcine kidneys and failed to detect any.

In the course of cloning porcine StAR cDNA sequences, we have also cloned bovine StAR cDNA sequences from a {lambda} library of bovine CL cDNA (30). Sequences for bovine StAR cDNA have been described previously (21), and preliminary expression studies have been presented. In contrast to these studies, which did not show StAR expression in the endometrium of pregnancy, we detected bovine StAR expression in placentomes (combined cotyledons and caruncle tissue), indicating that StAR may have a role in placental steroidogenesis in the bovine species (as discussed above). Our findings of StAR expression in the cow placenta via use of a homologous bovine probe confirm recent reports of bovine StAR expression in the cotyledons and caruncles of the cow placenta derived using a heterologous mouse probe (38). We observed strong expression of bovine StAR in follicular cells taken from superovulated ovaries and also expression in fetal and adult bovine testes, tissues that where negative for expression in original reports (21).

Analysis of the promoter region of the mouse StAR gene has revealed a recognition sequence for steroidogenic factor-1 (SF-1), an orphan nuclear receptor belonging to the steroid hormone receptor family (16). SF-1 was first described as a trans-acting factor for steroidogenesis in the gonads and adrenal gland, and SF-1 binding sites are found in promoter regions of steroidogenic enzyme genes, including P450SCC, P450c17, 3ßHSD (type II), and CYP19 (for cytochrome P450 aromatase) (39, 40, 41). More recently, SF-1 binding sites were described in the promoters of Dax-1, a dosage-sensitive gene believed to be involved in sex determination (42, 43); Mullerian inhibitory hormone (MIH), a protein hormone of the transforming growth factor-ß family involved in sex differentiation (44); as well as mouse and human StAR genes (16, 18). It is now apparent that SF-1 is implicated in the control of reproductive functions at numerous levels (45), including sex determination and differentiation as well as steroidogenesis. Expression of SF-1 precedes StAR and P450SCC gene expression in the developing mouse gonads, suggesting that SF-1 protein may be involved in the control of StAR expression (16, 43); recent functional studies in human tissue culture support this relationship (46). However, this relationship may be species and tissue dependent; in the rabbit CL, StAR protein levels have been shown to be responsive to estradiol (47), indicating that further comparative studies are warranted. Expression of SF-1, StAR, and P450SCC genes in the developing pig gonads, CL, and placenta as well as analysis of the promoter region of the porcine StAR gene await additional studies.


    Acknowledgments
 
The authors express thanks for the most useful contributions of Daniel Veilleux, André Hébert, Diane Hébert, Norman Hébert, Claude Archambault, Alain Gelinas, Alain Deveault, and Éric Grenier. Micheline Sicotte and Hélène Boucher-Rhéaume are thanked for their help in the preparation of the manuscript.


    Footnotes
 
1 This work was supported by CORPAQ (Quebec) and NSERC Canada. The porcine StAR gene sequence reported herein has been assigned GenBank accession number U53020. Back

Received October 8, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Strauss III JF, Martinez F, Kiriakidou M 1996 Placental steroid hormone synthesis: unique features and unanswered questions. Biol Reprod 54:303–311[Abstract]
  2. Shemesh M, Izhar M, Pasmanik M, Shore LS 1992 Regulation of steroidogenesis in the bovine placenta. J Physiol Pharmacol 43:153–163
  3. Hacker A, Capel B, Goodfellow P, Lovell-Badge R 1995 Expression of SRY, the mouse sex determining gene. Development 121:1603–1614[Abstract]
  4. Daneau I, Ethier J-F, Lussier JG, Silversides DW 1996 Porcine SRY gene locus and genital ridge expression. Biol Reprod 55:47–53[Abstract]
  5. Jost A 1947 Recherches sur la différentiation sexuelle de l’embryon du lapin. Arch Anat Microsc Morphol Exp 36:271–315
  6. Silversides DW, Price CA, Cooke GM 1995 Effects of short-term exposure to hydroxyflutamide in utero on the development of the reproductive tract in male mice. Can J Physiol Phamacol 73:1582–1588[Medline]
  7. Griffin JE 1992 Androgen resistance–the clinical and molecular spectrum. N Engl J Med 326:611–618[Medline]
  8. Lin D, Sugawara T, Strauss III JF, Clark BJ, Stocco DM, Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:1828–1831[Abstract/Free Full Text]
  9. Miller WL 1988 Molecular biology of steroid hormone biosynthesis. Endocr Rev 9:295–318[CrossRef][Medline]
  10. Miller WL 1995 Mitochondrial specificity of the early steps in steroidogenesis. J Steroid Biochem Mol Biol 55:607–616[CrossRef][Medline]
  11. Omura T, Morohashi K-I 1995 Gene regulation of steroidogenesis. J Steroid Biochem Mol Biol 53:19–25[CrossRef][Medline]
  12. Stocco DM, Clark BJ 1996 Regulation of the acute production of steriods in steroidogenic cells. Endocr Rev 17:221–244[CrossRef][Medline]
  13. Epstein LF, Orme-Johnson NR 1991 Regulation of steroid hormone biosynthesis: identification of precursors of a phosphoprotein targeted to the mitochondrion in stimulated rat adrenal cortex cells. J Biol Chem 266:19739–19745[Abstract/Free Full Text]
  14. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. J Biol Chem 269:28314–28322[Abstract/Free Full Text]
  15. Elliot ME, Goodfriend TL, Jefcoate CR 1993 Bovine adrenal glomerulosa and fasiculata cells exhibit 28.5-kilodalton proteins sensitive to angiotensin, other agonists, and atrial natriuretic peptide. Endocrinology 133:1669–1677[Abstract]
  16. Clark BJ, Soo S-C, Caron KM, Ikeda Y, Parker DM 1995 Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 9:1346–1355[Abstract]
  17. Sugawara T, Holt JA, Driscoll D, Strauss III JF, Lin D, Miller WL, Patterson D, Clancy KP, Hart IM, Clark BJ, Stocco DM 1995 Human steroidogenic acute regulatory protein: functional activity in COS-1 cells, tissue-specific expression, and mapping of the structural gene to 8p11.2 and a pseudogene to chromosome 13. Proc Natl Acad Sci USA 92:4778–4782[Abstract/Free Full Text]
  18. Sugawara T, Lin D, Holt JA, Martin KO, Javitt NB, Miller WL, Strauss III JF 1995 Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 34:12506–12512[CrossRef][Medline]
  19. Juengel JL, Meberg BM, Turzillo AM, Nett TM, Niswender GD 1995 Hormonal regulation of messenger ribonucleic acid encoding steroidogenic acute regulatory protein in ovine corpora lutea. Endocrinology 136:5423–5429[Abstract]
  20. Gradi A, Tang-Wai R, McBride H, Chu LL, Shore GC, Pelletier J 1995 The human steroidogenic acute regulatory (StAR) gene is expressed in the urogenital system and encodes a mitochondrial polypeptide. Biochim Biophys Acta 1258:228–233[Medline]
  21. Hartung S, Rust W, Balvers M, Ivell R 1995 Molecular cloning and in vivo expression of the bovine steroidogenic acute regulatory protein. Biochem Biophys Res Commun 215:646–653[CrossRef][Medline]
  22. Sandhoff TW, McLean MP 1996 Hormoneal regulation of steroidogenic acute regulatory protein messenger ribonucleic acid expression in the rat ovary. Endocrine 4:259–267
  23. Chomczynski P, Sacchi N 1987 A single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:153–159
  24. Daneau I, Houde A, Ethier J-F, Lussier JG, Silversides DW 1995 Bovine SRY gene locus: cloning and testicular expression. Biol Reprod 52:591–599[Abstract]
  25. Edwards JBDM, Delort J, Mallet J 1991 Oligodeoxyribonucleotide ligation to single-stranded cDNAs: a new tool for cloning 5' ends of mRNAs and for constructing dDNA libraries by in vitro amplification. Nucleic Acids Res 19:5227–5232[Abstract/Free Full Text]
  26. Noden DM, DeLahunta A 1985 The Embryology of Domestic Animals. Developmental Mechanisms and Malformations. Williams and Wilkins, Baltimore
  27. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning–A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor
  28. Herrin DL, Schmidt GW 1988 Rapid, reversible staining of Northern blots prior to hybridization. Biotechniques 6:196–200[Medline]
  29. Mulheron GW, Stone RT, Miller WL, Wise T 1989 Nucleotide sequence of cytochrome P-450 cholesterol side-chain cleavage cDNA isolated from porcine testis. Nucleic Acids Res 17:1773[Free Full Text]
  30. Brûlé S, Rabahi F, Beckers J-F, Monniaux D, Silversides DW, Lussier JG 1996 Isolation of a cDNA encoding a substrate for protein kinase C in bovine luteal cells: nucleotide sequence and tissue expression. 29th Annual Meeting of the Society for the Study of Reproduction, London, Canada. Biol Reprod [Suppl 1] 54:160 (Abstract)
  31. Lipman DJ, Pearson WR 1985 Rapid and sensitive protein similarity searches. Science 227:1435–1441[Abstract/Free Full Text]
  32. Whitfield LS, Lovell-Badge R, Goodfellow PN 1993 Rapid sequence evolution of the mammalian sex-determining gene SRY. Nature 364:713–715[CrossRef][Medline]
  33. Swain A, Zanaria E, Hacker A, Lovell-Badge R, Camerino G 1996 Mouse Dax1 expression is consistent with a role in sex determination as well as in adrenal and hypothalamus function. Nat Genet 12:404–409[CrossRef][Medline]
  34. Conley AJH, Head JR, Stirling DT, Mason JI 1992 Expression of steroidogenic enzymes in the bovine placenta and fetal adrenal glands through gestation. Endocrinology 130:2641–2650[Abstract]
  35. Wallis M 1993 Remarkably high rate of molecular evolution of ruminant placental lactogens. J Mol Evol 37:86–88[Medline]
  36. Leiser R, Kaufman P 1994 Placental structure: in a comparative aspect. Exp Clin Endocrinol 102:122–134[Medline]
  37. Cross JC, Werb Z, Fisher SJ 1994 Implantation and the placenta: key pieces of the development puzzle. Science 266:1508–1518[Abstract/Free Full Text]
  38. Pescador N, Soumano K, Stocco DM, Price CA, Murphy BD 1996 Steroidogenic acute regulatory protein in bovine corpora lutea. Biol Reprod 55:485–491[Abstract]
  39. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor 1. Mol Endocrinol 6:1249–1258[Abstract]
  40. Morohashi K, Honda S, Inomata Y, Handa H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 267:17913–17919[Abstract/Free Full Text]
  41. Zhang P, Mellon SH 1996 The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3',5'-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17{alpha}-hydroxylase/c17–20 lyase). Mol Endocrinol 10:147–158[Abstract]
  42. Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, Lalli E, Moser C, Walker AP, McCabe ERB, Meitinger T, Monaco AP, Sassone-Corsi P, Camerino G 1994 An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 372:635–641[CrossRef][Medline]
  43. Burris TP, Guo W, Le T, McCabe ERB 1995 Identification of a putative steroidogenic factor-1 response element on the DAX-1 promoter. Biochem Biophys Res Commun 214:576–581[CrossRef][Medline]
  44. Shen W-H, Moore CCD, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Mullerian inhibiting substance gene: a link to the sex determination cascade. Cell 77:651–661[CrossRef][Medline]
  45. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W-H, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312[Abstract/Free Full Text]
  46. Sugawara T, Holt JA, Kiriakidou M, Straus III JF 1996 Steroidogenic Factor 1-dependent promoter activity of the human steroidogenic acute regulatory protein (StAR) gene. Biochemistry 35:9052–9059[CrossRef][Medline]
  47. Townsen DH, Wang XJ, Keyes PL, Kostyo JL, Stocco DM 1996 Expression of the steroidogenic acute regulatory protein in the corpus luteum of the rabbit: dependence upon the luteotropic hormone, estradiol-17ß. Biol Reprod 55:868–874[Abstract]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
L. A. Blomberg, E. L. Long, T. S. Sonstegard, C. P. Van Tassell, J. R. Dobrinsky, and K. A. Zuelke
Serial analysis of gene expression during elongation of the peri-implantation porcine trophectoderm (conceptus)
Physiol Genomics, January 20, 2005; 20(2): 188 - 194.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. L. Coulter, I. C. McMillen, I. M. Bird, and M. D. Salkeld
Steroidogenic Acute Regulatory Protein Expression Is Decreased in the Adrenal Gland of the Growth-Restricted Sheep Fetus During Late Gestation
Biol Reprod, August 1, 2002; 67(2): 584 - 590.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Kusakabe, T. Todo, H. J. McQuillan, F. W. Goetz, and G. Young
Characterization and Expression of Steroidogenic Acute Regulatory Protein and MLN64 cDNAs in Trout
Endocrinology, June 1, 2002; 143(6): 2062 - 2070.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. Liu, M. Antaya, A. K. Goff, D. Boerboom, D. W. Silversides, J. G. Lussier, and J. Sirois
Molecular Characterization of Bovine Prostaglandin G/H Synthase-2 and Regulation in Uterine Stromal Cells
Biol Reprod, March 1, 2001; 64(3): 983 - 991.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
A. Kerban, D. Boerboom, and J. Sirois
Human Chorionic Gonadotropin Induces an Inverse Regulation of Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid in Theca Interna and Granulosa Cells of Equine Preovulatory Follicles
Endocrinology, February 1, 1999; 140(2): 667 - 674.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
Y.-J. Chen, Q. Feng, and Y.-X. Liu
Expression of the Steroidogenic Acute Regulatory Protein and Luteinizing Hormone Receptor and Their Regulation by Tumor Necrosis Factor {alpha} in Rat Corpora Lutea
Biol Reprod, February 1, 1999; 60(2): 419 - 427.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Pilon, R. Behdjani, I. Daneau, J. G. Lussier, and D. W. Silversides
Porcine Steroidogenic Factor-1 Gene (pSF-1) Expression and Analysis of Embryonic Pig Gonads during Sexual Differentiation
Endocrinology, September 1, 1998; 139(9): 3803 - 3812.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Cherradi, Y. Brandenburger, M. F. Rossier, M. B. Vallotton, D. M. Stocco, and A. M. Capponi
Atrial Natriuretic Peptide Inhibits Calcium-Induced Steroidogenic Acute Regulatory Protein Gene Transcription in Adrenal Glomerulosa Cells
Mol. Endocrinol., July 1, 1998; 12(7): 962 - 972.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. Brand, N. Cherradi, G. Defaye, A. Chinn, E. M. Chambaz, J.-J. Feige, and S. Bailly
Transforming Growth Factor beta 1 Decreases Cholesterol Supply to Mitochondria via Repression of Steroidogenic Acute Regulatory Protein Expression
J. Biol. Chem., March 13, 1998; 273(11): 6410 - 6416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Arakane, S. R. King, Y. Du, C. B. Kallen, L. P. Walsh, H. Watari, D. M. Stocco, and J. F. Strauss III
Phosphorylation of Steroidogenic Acute Regulatory Protein (StAR) Modulates Its Steroidogenic Activity
J. Biol. Chem., December 19, 1997; 272(51): 32656 - 32662.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pilon, N.
Right arrow Articles by Silversides, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pilon, N.
Right arrow Articles by Silversides, D. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals