help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Torrance, C. J.
Right arrow Articles by Dohm, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torrance, C. J.
Right arrow Articles by Dohm, G. L.
Endocrinology Vol. 138, No. 3 1215-1223
Copyright © 1997 by The Endocrine Society


Articles

Characterization of a Low Affinity Thyroid Hormone Receptor Binding Site within the Rat GLUT4 Gene Promoter

Christopher J. Torrance, Stephen J. Usala, Jeffrey E. Pessin and G. Lynis Dohm

Departments of Biochemistry (C.J.T., G.L.D.) and Medicine (S.J.U.), East Carolina University School of Medicine, Greenville, North Carolina 27858; and the Department of Physiology and Biophysics, University of Iowa (J.E.P.), Iowa City, Iowa 52242

Address all correspondence and requests for reprints to: Christopher J. Torrance, Ph.D., Department of Oncology, Johns Hopkins University, Baltimore, Maryland 21231.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies have demonstrated that thyroid hormone (T3) stimulates insulin-responsive glucose transporter (GLUT4) transcription and protein expression in rat skeletal muscle. The aim of the present study was to define a putative thyroid hormone response element (TRE) within the rat GLUT4 promoter and thus perhaps determine whether T3 acts directly to augment skeletal muscle GLUT4 transcription. To this end, electrophoretic mobility shift analyses were performed to analyze thyroid hormone receptor (TR) binding to a previously characterized 281-bp T3-responsive region of the rat GLUT4 promoter. Indeed, within this region, a TR-binding site of the standard DR+4 TRE variety was located between bases -457/-426 and was shown to posses a specific affinity for in vitro translated TRs. Interestingly, however, the GLUT4 TR-binding site demonstrated a significantly lower affinity compared to a consensus DR+4 TRE, and only bound TRs appreciatively in the form of high affinity heterodimers, in this case with the cis-retinoic acid receptor.

In conclusion, these data demonstrated the presence of a specific TR-binding site within a T3-responsive region of the rat GLUT4 promoter and thus support the supposition that thyroid hormone acts directly to stimulate GLUT4 transcription in rat skeletal muscle. Moreover, characterization of a novel TR-binding site with low affinity suggests an additional mechanism by which the intrinsic activity and responsiveness of thyroid hormone regulated genes may be modulated.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE ENTRY of glucose into mammalian cells is mediated by a family of tissue-specific plasma membrane transport proteins (GLUT1 through 4), the process of which represents the rate-limiting step in glucose metabolism (1, 2). In tissues that express the insulin-responsive glucose transporter isoform (GLUT4), i.e. skeletal muscle, adipose, and heart, the uptake of glucose is also largely dependent upon insulin (3). In normal individuals, insulin-mediated glucose disposal functions largely to normalize circulating plasma glucose levels after a meal, approximately 85% of which occurs within skeletal muscle (4). However, defects in this process result in persistent hyperglycemia and hyperinsulinemia, and represent the ultimate cause of insulin resistance in noninsulin-dependent diabetes mellitus (NIDDM) (3).

The molecular defect in glucose disposal leading to NIDDM has been suggested to reside within the insulin signaling pathway (5, 6, 7), although cause and effect have not been established in this disease. Nevertheless, elucidating positive regulators of GLUT4 as well as their mechanism(s) of action are of considerable interest as a possible treatment in NIDDM. Overexpression of GLUT4 in transgenic diabetic mice has been shown to be highly effective in ameliorating postprandial hyperglycemia, primarily by stimulating basal (noninsulin-mediated) glucose disposal (8). Previous studies from our laboratory (9) and that of Weinstein et al. (10) have demonstrated that thyroid hormone (T3) stimulates basal and, to some extent, insulin-mediated glucose uptake in rat skeletal muscle. The mechanism for this stimulatory effect of T3 was determined to be due predominantly to an induction of GLUT4 protein expression (9, 10). In the preceding manuscript, GLUT4 induction by T3 was further defined to be primarily via transcriptional induction in red muscle, and a separate translational and/or posttranslational mechanism in white muscle fiber types (11). Moreover, in a previous study, constructs containing various regions of the GLUT4 upstream of a reporter gene, when transfected into C2C12 myotubes and treated with T3, isolated a 281-bp region responsive to thyroid hormone (12). However, further experiments are required to determine whether T3 acts directly on GLUT4 transcription and whether transcriptional induction of skeletal muscle GLUT4 by T3 or a previously suggested (11) muscle-selective T3-receptor agonist represents a viable therapeutic strategy in NIDDM.

The effects of T3 on gene transcription are mediated directly via a family of nuclear receptor/transcription factors: c-erbA{alpha}1, -ß1, and -ß2 (13, 14, 15, 16, 17, 18, 19). These thyroid hormone receptors (TRs) bind to specific thyroid hormone response elements (TREs) consisting of hexameric half-sites [consensus: AGGT(C/A)A], orientated in singlet or multiplex configurations within the promoter regions of target genes. A limited number of TREs have been elucidated; many consist of directly repeated half-sites separated by 4 bp (DR+4) (13), whereas, an everted half-site TRE separated by 6 bp (F2) has been reported to function as a silencer in the chick lysozyme promoter (20, 21). TRs bind with high affinity to their cognate DNA elements in both the presence and absence of T3; however, TRs only function to stimulate (on positive TREs) or repress (on negative TREs) gene transcription in response to binding thyroid hormone (13, 14, 15, 17, 18, 19). In contrast, unoccupied TRs on positive TREs (e.g. DR+4 elements) actively repress basal transcription (22, 23, 24, 25, 26, 27).

TRs bind to composite TREs as monomers; however, cooperative interactions favor the formation of homodimers. Moreover, TRs interact with coregulatory proteins or thyroid hormone auxiliary proteins in vivo, some of which have been characterized [e.g. the cis-retinoic acid receptors (RXRs)] (28, 29, 30, 31, 32, 33, 34). TR/RXR heterodimers demonstrate higher binding affinities than TR homodimers, are favored in the presence of T3, and produce larger increases in T3-induced gene expression (13, 14, 32, 33). Indeed, heterodimers are considered to be the primary complexes mediating T3-regulated gene expression in vivo.

The aim of the present study was to determine and characterize a putative TRE within the rat GLUT4 promoter and thus perhaps establish whether T3 acts directly to stimulate GLUT4 transcription. Sequential electrophoretic mobility shift assay (EMSA) analyses using a previously described 281-bp T3-responsive region of the GLUT4 promoter (12) identified a TR-binding site, orientated in the classical DR+4 motif, between bases -450 and -434. However, in contrast to other established TREs, the GLUT4 TR-binding element demonstrated a significantly lower affinity, and as a likely consequence only bound TRs appreciatively in the presence of RXR. Therefore, these data are also suggestive of an additional level of complexity that may govern the inducibility and responsiveness of T3-regulated genes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids and reticulocyte lysate-synthesized receptors
The previously described human complementary DNA clones for c-erbAß1 and c-erbA{alpha}1 in pCMV (35) and for RXR{alpha} and retinoic acid receptor {alpha} (RAR{alpha}) complementary DNAs in pSKXR3–1 (36) were used to program TNT T7-coupled reticulocyte lysates (Promega, Madison, WI). Unlabeled and [35S]methionine-labeled receptors were synthesized in parallel using in vitro translation reactions, and the protein concentrations were determined from trichloroacetic acid-precipitable counts according to the manufacturer’s instructions. The synthesis of the human {alpha}1 (h{alpha}1) TR, however, is not as efficient as those for ß1 and RXR{alpha} and thus could not be used in sufficient amounts to give optimal results in EMSAs. In some experiments purified chick {alpha}1 TR was used to visualize {alpha}1 complexes more readily. This receptor was the gift of Dr. H. Samuels (New York University Medical Center, New York, NY). The isolation procedure for chick {alpha}1 has been described previously (37) and was used here in approximately equimolar ratios with hRXR{alpha}.

A plasmid containing a 281-bp EcoNI-BstXI fragment of the GLUT4 promoter (bases -517 to -238), which accounts for full thyroid hormone responsiveness of 2212 bp from the transcriptional start site of GLUT4, was obtained from Dr. J. Pessin (University of Iowa, Iowa City, IA). Various double stranded DNA oligomers spanning this region were also designed to further localize the putative GLUT4 TRE. These were synthesized at the East Carolina University School of Medicine DNA-Core Facility.

Antibodies
The N-terminal polyclonal antibody specific for rat ß1 (rß1PAb, amino acids 62–92 in rat ß1) and the C-terminal {alpha}1/ß cross-specific polyclonal antibody (r{alpha}1/ßPAb, amino acids 447–461 and 393–407 in rat ß1 and {alpha}1, respectively) were provided by Drs. J. Oppenheimer and H. Schwartz (University of Minnesota, Minneapolis, MN). The hRXR{alpha} polyclonal antibody (RXR{alpha}PAb) was the generous gift of Dr. R. Evans (The Salk Institute, San Diego, CA).

Isolation and extraction of nuclei from rat skeletal muscle
Nuclei were isolated from rat skeletal muscle in the presence of protease inhibitors (0.5 mM phenylmethylsulfonylfluoride, 10 µg/ml leupeptin, 1 µg/ml aprotinin, and 10 mM EDTA) by the previously described method of Neufer et al. (38). Approximately 500 µg purified rat muscle nuclei were extracted using 100 µl cold (4 C) M4 extraction buffer [20 mM HEPES (pH 7.8), 0.4 M KCl, 2 mM dithiothreitol, and 20% glycerol] for 30 min (plus protease inhibitors), and the nuclear debris and DNA were pelleted at 12,000 rpm in a microfuge for 15 min. Nuclear extracts were assayed for protein concentration by the method of Bradford (39) and were used either immediately for analysis or stored at -80 C until required.

EMSAs
EMSAs were performed as previously described (40). Briefly, approximately 100 ng (60,000 cpm) of a 32P-labeled double stranded DNA oligomer were incubated with either 1 µl (10 fmol) reticulocyte lysate synthesized receptor (1 µl hß1 and/or hRXR{alpha}) or 5 µg nuclear extract for 30 min at room temperature in a total volume of 20 µl reaction buffer [25 mM Tris (pH 7.8), 0.5 mM EDTA, 88 mM KCl, 1 mM dithiothreitol, 150 µg/ml poly(dI·dC)-poly(dI·dC), 0.05% Triton X-100, and 12.5 µg/ml sonicated salmon sperm DNA]. For supershift experiments, 1 µl polyclonal antisera was incubated with in vitro translated receptors for 30 min at room temperature before addition of the DNA oligomer. Reaction mixtures were subjected to electrophoresis on a 5% nondenaturing polyacrylamide gel at 4 C and 40 mA (200 V) for approximately 2.5 h, and the dried gels were exposed with intensifying screens to x-ray film for 16–48 h at -80 C.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of TR-binding site within a T3-responsive region of the GLUT4 promoter
To identify a putative TRE within the rat GLUT4 promoter, a series of electrophoretic mobility shift analyses were performed using a 281-bp fragment of the rat GLUT4 promoter (Fig. 1Go), previously delineated in transient transfection studies to be T3 responsive (12). EMSA using this fragment was sufficient to first establish the presence of a TR-binding site within the GLUT4 promoter. The binding of reticulocyte lysate-synthesized {alpha}1 and ß1 TR/RXR{alpha} heterodimers to this 281-bp fragment is shown in the four left lanes of Fig. 2Go (complex composition confirmed in Fig. 6Go). In addition, complexes were formed using rat skeletal muscle nuclear extracts, in particular one that migrates closely with the human in vitro translated {alpha}1/RXR{alpha} heterodimer (Fig. 2Go, left lanes 4 and 2, respectively) and one highly abundant species with very low mobility. The lesser degree of h{alpha}1 TR binding to the GLUT4 sequence as well as other TREs used throughout this report is due to the lower efficiency of the in vitro translation reaction for h{alpha}1, such that equimolar ratios with hß1 and RXR{alpha} could not be used in this assay.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Sequence of the previously described 281-bp thyroid hormone-responsive region of the GLUT4 promoter. Arrows show the putative TRE half-sites (consensus AGGT(C/A)A). MyoD, Consensus sequence for myogenic differentiation factor (MyoD); MEF-2, consensus sequence for MEF-2; AlwN1, cleavage site for restriction enzyme AlwN1. Dotted lines indicate the sequences included in double stranded DNA oligomers synthesized to determine the position of a putative GLUT4 TRE.

 


View larger version (74K):
[in this window]
[in a new window]
 
Figure 2. EMSA using in vitro translated TR and skeletal muscle nuclear extracts with the full-length (-517/-237) and AlwN1 restriction fragments (-517/-363 and -363/-237) of the thyroid hormone-responsive GLUT4 promoter region. Lane 1, Reticulocyte lysate control; lane 2, h{alpha}1 TR and RXR{alpha}; lane 3, hß1TR and RXR{alpha}; lane 4, 15 µg skeletal muscle nuclear extract.

 


View larger version (55K):
[in this window]
[in a new window]
 
Figure 6. EMSA to determine the identity and binding specificity of TR complexes formed on the GLUT4 TRE. Lanes 1–6, EMSA supershift experiment using TR isoform-specific antibodies to determine the composition of TR/GLUT4 TRE complexes. Lane 1, Purified chick {alpha}1 and hRXR{alpha}; lane 2, purified chick {alpha}1, hRXR{alpha}, and {alpha}1 polyclonal antibody; purified chick {alpha}1, hRXR{alpha}, and RXR{alpha} polyclonal antibody; lane 4, hß1, hRXR{alpha}, and ß1 polyclonal antibody; hß1, hRXR{alpha}, and RXR{alpha} polyclonal antibody. Lanes 7–12, EMSA with competing DNA to determine the binding specificity of the GLUT4 TRE for TRs: lane 7, purified chick {alpha}1 and hRXR{alpha}; lane 8, purified chick {alpha}1, hRXR{alpha}, and a 200-fold excess of cold F2 TRE; lane 9, purified chick {alpha}1, hRXR{alpha}, and a 200-fold excess of a cold mutant (non-TR binding) TRE (M2); lanes 10–12, same as for lanes 7–9, except using in vitro translated ß1 TR and RXR{alpha}.

 
Using two AlwN1 restriction fragments of the 281-bp promoter sequence, the GLUT4 TR-binding element was further localized to the 5'-fragment (Fig. 2Go). In addition, consistent with the presence of a MyoD and/or myocyte enhancer factor-2 (MEF-2) consensus binding site within the 5'-restriction fragment (Fig. 1Go), both the full-length and 5'-AlwNI sequences bound low mobility complex produced with muscle nuclear extracts (left and right four lanes of Fig. 2Go, respectively). Based on these data, three oligomers were synthesized to span the 5'-AlwN1 restriction fragment: oligo 1 (bases -526/-485), oligo 2 (bases -491/-452), and oligo 3 (bases -460/-418) (Fig. 1Go), to further define the position of the GLUT4 TRE as well as establish the putative binding of MyoD and/or MEF activities within this thyroid hormone-responsive region of the GLUT4 promoter. Specifically, oligo 1 encompassed the three upstream putative TRE sequences, oligo 2 covered the MyoD and MEF consensus binding sites, and oligo 3 spanned the remaining near-consensus TRE sequence within this AlwN1 restriction fragment (Fig. 1Go). Oligo 3 was not synthesized to cover the residual downstream sequences in the 5'-AlwN1 fragment, because this region is simply composed of a stretch of AC microsatellite dinucleotide repeats and thus is highly unlikely to contain a specific TR-binding element.

The bindings of in vitro translated TRs and skeletal muscle nuclear extracts to oligo 1 and a previously characterized TRE (the chicken lysozyme F2 TRE) (20, 21) were compared in Fig. 3Go. These data clearly demonstrated that bases -526/-485 of the GLUT4 promoter do not contain a TR-binding element, although the putative TRE half-sites within this region (highlighted in Fig. 1Go) are close to the consensus AGGT(C/A)A. The experiment shown in Fig. 4Go, left panel, directly compared the binding of TRs and skeletal muscle nuclear extracts to oligos 2 and 3. Consistent with the respective putative consensus elements within these oligos (Fig. 1Go), binding of in vitro translated TRs was localized to oligo 3 (bases -460/-418), whereas the postulated MEF-2 and/or MyoD binding complex was defined within oligo 2. Moreover, competition of the oligo 2 binding species with a large excess of an unlabeled MEF-2, but not a MyoD consensus binding site, confirmed this DNA-binding species to be composed solely of MEF-2 (Fig. 4Go, right panel).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 3. EMSA using in vitro translated TRs and skeletal muscle nuclear extracts with the chicken lysozyme F2 TRE and sequences -526/-485 (oligo 1) of the thyroid hormone-responsive GLUT4 promoter region. Lane 1, h{alpha}1; lane 2, h{alpha}1 TR and RXR{alpha}; lane 3, hß1; lane 4, hß1TR and RXR{alpha}; lane 5, 5 µg skeletal muscle nuclear extract; lane 6, 10 µg skeletal muscle nuclear extract. M, Monomer; HD, homodimer or heterodimer.

 


View larger version (64K):
[in this window]
[in a new window]
 
Figure 4. EMSA using TRs, MEF-2A, and skeletal muscle nuclear extracts with oligomers spanning sequences -491/-452 (oligo 2) and -460/-418 (oligo 3) of the thyroid hormone-responsive GLUT4 promoter region. Lanes 1 and 5, Reticulocyte lysate control; lanes 2 and 6, purified chick {alpha}1 TR and RXR{alpha}; lanes 3 and 7, hß1TR and RXR{alpha}; lanes 4 and 8, 15 µg skeletal muscle nuclear extract; lane 9, 0.1 µg nuclear extract (NE); lane 10, 0.1 µg NE and a 200-fold excess of a MEF-2 consensus DNA-binding element; lane 11, 0.1 µg NE and a 1000-fold excess of MEF-2 DNA; lane 12, 0.1 µg NE and a 200-fold excess of a MyoD consensus DNA-binding element; lane 13, 0.1 µg NE and a 1000-fold excess of MyoD DNA.

 
In summary, these data clearly demonstrated the presence of a TR-binding site within the GLUT4 promoter, the position of which was determined to be within bases -460/-418. However, two overlapping near-consensus DR+4 TRE sequences could equally be envisaged to be present within this region (Fig. 1Go, solid and dashed arrows, and Fig. 5Go, top panel). Therefore, to further define the boundaries and orientation of the GLUT4 TRE, two additional oligomers were synthesized with mutations designed to abrogate TR binding dependent upon which sequence represented the true TR-binding site (Fig. 5Go). Mutations within the 5'- to 3'-orientated putative TRE were shown to abolish TR binding, whereas mutations within the oppositely orientated sequence did not (Fig. 5Go). Therefore, these data unambiguously established the location of the GLUT4 TR-binding site between bases -457/-426, composed in a classical DR+4 arrangement orientated in the 5' to 3' direction.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. EMSA using two mutated oligomers spanning the sequence -457/-426 determined the orientation of the GLUT4 TRE. Sequence and EMSA of oligos DR+4 and DR-4. lanes 1 and 4, Reticulocyte lysate control; lanes 2 and 5, purified chick {alpha}1 TR and RXR{alpha}; lanes 3 and 6, hß1 TR and RXR{alpha}. *, Mutation sites [all replaced with an adenine (A), except the one original A, which was replaced with a thymine].

 
Characterization of the GLUT4 TR-binding site
A series of experiments was performed to characterize in detail the specificity, affinity, and identity of TR complexes able to form on this newly distinguished TR-binding site. Supershift experiments (Fig. 6Go, lanes 1–6) first demonstrated that the TR complexes formed using in vitro translated TRs and hRXR{alpha} on the GLUT4 TRE were composed of TR/RXR{alpha} heterodimers. Moreover, the successful competition of these species with a large excess of an unlabeled oligo containing the F2 TRE, but not with a mutated (non-TR-binding) version of this element (M2; Fig. 6Go, lanes 7–12), demonstrated the specificity of the GLUT 4 sequence for TRs.

All EMSA experiments described thus far were performed for the most part by coincubating in vitro translated TRs with hRXR{alpha}, principally with the intent of visualizing the maximum possible number of TR/TRE interactions. However, only a single species has consistently been observed in these assays, i.e. DNA binding was unable to be demonstrated by TRs in the absence of hRXR. These data, therefore, suggest that binding of TRs to the GLUT4 TRE may be dependent upon heterodimerization. Hence, the GLUT4 TRE was next compared to a canonical DR+4 TRE sequence composed of perfect consensus half-sites to determine the relative ability of these sequences to bind TRs (Fig. 7Go; both elements labeled to identical specific activities). Complexes on both elements demonstrated the characteristic downshift of heterodimeric TR/TRE complexes and dissociation of TR homodimers in the presence of T3 (Fig. 7Go). However, TR binding to the GLUT4 TRE was overall considerably lower, and as a likely consequence, homodimer and even monomeric binding evident for ß1 TRs on the canonical DR+4 element, was not detectable on the GLUT4 TR-binding site.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 7. EMSA comparing the relative affinity and TR complexes formed on the GLUT4 TRE with a canonical DR+4 TRE sequence. GLUT4 and DR+4 TREs were labeled to an identical specific activity, and equal counts were used for EMSA analysis. Lane 1 and 9, Purified {alpha}1 TR; lanes 2 and 10, purified {alpha}1 TR and T3 (1 x 10-7 M); lanes 3 and 11, hß1; lanes 4 and 12, hß1 and T3; lanes 5 and 13, purified {alpha}1 and RXR{alpha}; lanes 6 and 14, purified {alpha}1, RXR{alpha}, and T3; lanes 7 and 15, hß1 and RXR{alpha}; lanes 8 and 17, hß1, RXR{alpha}, and T3.

 
This phenomenon was next studied in more detail, initially by comparing a titration curve for the binding of increasing amounts of in vitro translated ß1 TR with a constant concentration of RXR{alpha} to the GLUT4 and canonical DR+4 TR-binding sites. The results of this experiment (Fig. 8Go) demonstrated that unlike the canonical DR+4, only at the highest ß1TR concentration was TR homodimer marginally apparent on the GLUT4 TRE.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 8. EMSA titration curve to determine the specificity of the GLUT4 TRE (oligo sequence -452/-431; TCCGGGTTACTTCGGGGCATTG) for TR/RXR heterodimers compared to the canonical DR+4 TRE. Lanes 1 and 5, 2 µl RXR{alpha}; lanes 2 and 6, 2 µl RXR{alpha} and 1 µl ß1TR; lanes 3 and 7, 2 µl RXR{alpha} and 2 µl hß1; lanes 4 and 8, 2 µl RXR{alpha} and 4 µl hß1TR.

 
With regard to a potential mechanism for this observation, as the binding affinity/specificity of TRs is presumably determined by the DNA sequence of the binding site, a final experiment was performed using a series of oligos synthesized with single base substitutions to determine a crucial base or sequence dictating the lower affinity and perhaps putative heterodimer-selective binding of the GLUT4 TR-binding element (Fig. 9Go). Specifically, these mutations were designed to replace nonconsensus half-site bases with consensus nucleotides. In addition, various substitutions were introduced within the intervening and flanking regions of the GLUT 4 TR-binding element, e.g. mutant oligo 7 was synthesized, replacing all the intervening and flanking bases with those present in the canonical DR+4 TRE.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 9. EMSA using a series of GLUT4 TRE mutants to determine a putative base(s) imparting specificity for TR/RXR heterodimers. The sequences of GLUT4 TRE mutants (italic, mutated base) and EMSA using the GLUT4 TRE and GLUT4 TRE mutants 1–7 (lanes 1–8, respectively) are shown. Lane 9, Canonical DR+4 TRE.

 
The results of the binding of in vitro translated ß1 and ß1+RXR{alpha} receptors to these mutant GLUT4 TREs are shown in Fig. 9Go. Interestingly, bases within the intervening and/or flanking sequences were also shown to be crucial for TR binding; in particular intervening bases 2 and 3. In contrast, the mutations in oligo 5 and oligo 6 (which converts the first base of the 3'-TRE half-site to the consensus) apparently imparted an additional affinity to these sequences, the degree of which and perhaps complex formation on would seem to be comparable with those of the canonical DR+4 TRE. Therefore, in combination with the previous titration experiment, these data suggest that it is the overall lower affinity of the GLUT4 sequence that accounts for the visualization of only the more avid heterodimer in these experiments, i.e. a quantitative, rather than qualitative, phenomenon. This conclusion would also be supported by the reduced binding and formation of only heterodimer observed by mutant 7, wherein all the flanking and intervening bases were substituted with those from the canonical TR-binding element.

In conclusion, these data demonstrated that the newly identified GLUT4 TRE has a specific affinity for TRs. However, in contrast to other established TREs, GLUT4 TRE was shown to have a much lower affinity, and this property appears to be responsible for the observation that only high affinity TR/heterodimeric receptors bind appreciatively on this TRE. Moreover, combined with the results of a previous study that demonstrated this region of the GLUT4 promoter to confer thyroid hormone responsiveness in transfection studies (12), these data indicate that the effects of T3 on GLUT 4 transcription are likely to be mediated directly by this TR-binding element. However, formal proof of this hypothesis requires additional functional analyses using mutations within this TR-binding element.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The primary aim of this study was to analyze the binding of TRs and nuclear extracts to a previously identified thyroid hormone-responsive region of the GLUT4 promoter (12) and thus perhaps determine whether thyroid hormone acts directly to stimulate GLUT4 transcription in rat skeletal muscle (11). Indeed, consistent with this hypothesis, a series of EMSA analyses clearly demonstrated the presence of a specific DR+4 TR-binding site between bases -457/-426 of the GLUT4 promoter fragment. However, given the similar deviations from the consensus [AGGT(C/A)A] of this confirmed TR-binding site and the other three putative TRE half-sites located further upstream, it is not immediately clear why the latter sequences did not also display TR-binding activity. Conceivably, the second and third half-sites of the latter tandem sequence can be discounted due to their nonoptimal separation distance (3 bp). However, the first and second elements form an apparently viable DR+4 element. Nevertheless, this can probably be explained by the fact that neither of these half-sites contains a consensus thymine [AGGT(C/A)A] at the fourth position.

The exquisite specificity of base sequences directing protein-DNA interaction(s) was similarly demonstrated in the mutation experiment, which revealed that intervening and flanking sequences surrounding the GLUT4 half-sites were also crucial for mediating TR binding. Indeed, we may have been fortunate in that the mutations introduced within the intervening and flanking regions to discern the orientation of the GLUT4 TRE did not also abrogate TR binding. However, none of the mutations analyzed in Fig. 9Go directly altered the propensity of the GLUT4 TRE to bind heterodimers. Moreover, certain substitutions (in particular the conversion of the first base in the 3' half-site to the consensus adenine; mutant oligo 6) that enhanced the affinity of the GLUT4 TRE, resulted in binding properties similar to those of the canonical DR+4 TRE. Of note, increased binding to the mutation oligo 6 would be consistent with the fact that TRs in heterodimeric complexes are considered to bind this particular half-site. In contrast, mutant oligo 7, in which all bases other than those within the GLUT4 TRE half-sites were replaced with the corresponding sequences in the canonical DR+4, demonstrated properties comparable to those of the wild-type GLUT4 TRE. These data, therefore, suggest that the apparent heterodimer specificity observed for the GLUT4 TR-binding site is simply a function of the overall lower affinity of the half-sites within this element. Indeed, the titration experiment demonstrated the GLUT4 sequence to be equally deficient in binding both homodimers and heterodimers compared to a canonical DR+4 TR-binding element (estimated to be approximately 5-fold from densitometric scanning).

Finally, characterization of a low affinity TR-binding site has a number of implications for thyroid hormone-regulated genes, the first of which would presumably be the inducibility of responsive genes. Indeed, the degree of transcriptional induction observed for the GLUT4 gene (~2.5 under chronic hyperthyroid vs. hypothyroid conditions) (11) compared to genes containing high affinity TRE(s) (e.g. malic enzyme; transcription stimulated 3- to 4-fold in the liver of euthyroid rats) (43) is consistent with this hypothesis. Secondly, as 1) TRs bind DNA in the presence and absence of thyroid hormone, 2) unoccupied TRs actively repress basal transcription, and 3) heterodimers demonstrate higher affinities over homodimers and are favored in the presence of T3 (13), a low affinity TRE would have special relevance for thyroid hormone-regulated genes. For example, one can speculate that although a low affinity TRE would not illicit as large a T3 induction compared to a high affinity TRE, by the same token, in the absence of T3 a low affinity TRE would not be subjected to such a great degree of basal repression.

A previous study suggested a criterion by which different combinations of weak and strong artificial TRE half-sites modulate TR complex formation and T3 responsiveness of thyroid hormone-regulated genes (44). In this classification, the GLUT4 TRE presumably falls into the category of either a weak/weak (w/w) or, more likely from the high affinity imparted to the mutant 6, a strong/weak half-site composition. Interestingly, consistent with our observations, both of these previously described TREs were weakly T3 responsive (44). Moreover, distinct from all other TRE combinations, these elements were also dependent upon RXR to mediate T3 induction in transfection assays. Unfortunately, however, the basal repression properties of a w/w or strong/weak TRE were not investigated in this study (44).

Interestingly, both the half-site sequences, the immediately flanking bases, and three of the four intervening sequences of the GLUT4 TRE are absolutely conserved among humans, mice, and rats (Fig. 10Go). Their conservation would, therefore, further suggest the probable functionality of this low affinity TRE as well as the importance of sequences other than those within the TR half-sites for mediating TR binding. Indeed, one can envisage that during the evolution of genes, the properties of promoter regulatory elements, e.g. affinity, may be similarly selected so that they compliment the function of the particular gene product, i.e. for a TRE; a low affinity TRE(s) may predominate in genes that need to be constitutively expressed, but under certain conditions need to be up-regulated to some extent, e.g. GLUT4 (11). In contrast, a higher affinity TREs would be highly responsive to thyroid hormone, but would also be subjected to a greater degree of active repression by unoccupied heterodimers and/or homodimers. Such a TRE would, therefore, be highly sensitive to changes in T3 status/availability and may be advantageous for imparting high inducibility on, for instance, temporally expressed genes.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 10. Evolutionary conservation of the GLUT4 TRE. Comparison of the base sequences within the GLUT4 promoter region containing the GLUT4 TRE in mice, rats, and humans.

 
In conclusion, these studies demonstrated the presence of a specific TR-binding element within a region of the GLUT4 promoter previously found to impart T3 responsiveness (12). These data, therefore, corroborate the supposition that the effects of T3 on GLUT4 transcription are direct. However, formal demonstration of this hypothesis must await proof of nonfunctionality in transient transfection assays of mutants within the GLUT4 TR-binding site. Nevertheless, the GLUT4 TR-binding element was also shown to possess a significantly lower affinity than a conventional DR+4 TR-binding element and only bound TRs significantly in combination with RXR. These data, therefore, suggest another mechanism by which the intrinsic basal activity and T3 responsiveness of thyroid hormone-regulated genes may be modulated.


    Acknowledgments
 
We express our gratitude to Dr. James deVente for his extremely helpful comments during the preparation of this manuscript.

Received July 1, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fink RI, Wallace P, Brechtel G, Olefsky JM 1992 Evidence that glucose transport is rate limiting for in vivo glucose uptake. Metabolism 41:897–902[CrossRef][Medline]
  2. Ren JM, Marshall BA, Gulve EA, Gao J, Johnson DW, Holloszy JO, Mueckler M 1993 Evidence from transgenic mice that glucose transport is rate limiting for glycogen deposition and glycolysis in skeletal muscle. J Biol Chem 268:16113–16115[Abstract/Free Full Text]
  3. Mueckler M 1994 The molecular biology of glucose transport: relevance to insulin resistance and non-insulin dependent diabetes mellitus. J Diabetes Complications 7:130–141
  4. DeFronzo RA, Ferranninni E, Sato Y, Felig P, Wahren J 1981 Synergistic interaction between exercise and insulin on peripheral glucose uptake. J Clin Invest 68:1468–1474
  5. Azavedo Jr JL, Carey JO, Pories WJ, Morris PG, Dohm GL 1995 Hypoxia stimulates glucose transport in insulin-resistant human skeletal muscle. Diabetes 44:695–698[Abstract]
  6. Carey JO, Azevedo Jr JL, Morris PG, Pories WJ, Dohm GL 1995 Okadaic acid, vanadate, and phenylarsine oxide stimulate 2-deoxyglucose transport in insulin-resistant human skeletal muscle. Diabetes 44:682–688[Abstract]
  7. Goodyear LJ, Giorgino F, Sherman LA, Carey JO, Smith RJ, Dohm GL 1995 Insulin receptor phosphorylation, insulin receptor substrate-1 phosphorylation, and phosphoinositol 3-kinase are decreased in intact skeletal muscle strips from obese subjects. J Clin Invest 95:2195–2204
  8. Lui M, Gibbs EM, McCoid SC, Milici AJ, Stukenbrok HA, McPherson RK, Treadway JL, Pessin JE 1993 Transgenic mice expressing the human GLUT4/muscle-fat facilitative glucose transporter protein exhibit efficient glycemic control. Proc Natl Acad Sci USA 90:11346–11350[Abstract/Free Full Text]
  9. Casla A, Rovira A, Wells JA, Dohm GL 1990 Increased glucose transporter (GLUT4) protein expression in hyperthyroidism. Biochem Biophys Res Commun 171:182–188[CrossRef][Medline]
  10. Weinstein SP, O’Boyle E, Haber RS 1994 Thyroid hormone increases basal and insulin-stimulated glucose transport in skeletal muscle. Diabetes 43:1185–1189[Abstract]
  11. Torrance CJ, deVente JE, Jones JP, Dohm GL 1997 Effects of thyroid hormone on GLUT4 glucose transporter gene expression and NIDDM in rats. Endocrinology 138:1204–1214[Abstract/Free Full Text]
  12. Richardson JM, Pessin JE 1993 Identification of a skeletal muscle-specific regulatory domain in the rat GLUT4/muscle-fat gene. J Biol Chem 268:21021–21027[Abstract/Free Full Text]
  13. Glass CK 1994 Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15:391–407[Abstract/Free Full Text]
  14. Schwartz HL, Strait KA, Oppenheimer JH 1993 Molecular mechanisms of thyroid hormone action: a physiological perspective. Clin Lab Med 13:543–561[Medline]
  15. Shepard AR, Eberhardt NL 1993 Molecular mechanisms of thyroid hormone action. Clin Lab Med 13:531–541[Medline]
  16. Weinberger C, Thompson CC, Ong ES, Lebo R, Gruol DJ, Evans RM 1986 The c-erbA gene encodes a thyroid hormone receptor. Nature 324:641–646[CrossRef][Medline]
  17. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  18. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–188[Abstract/Free Full Text]
  19. Samuels HH, Forman BM, Horowitz ZD, Ye Z 1988 Regulation of gene expression by thyroid hormone. J Clin Invest 81:957–967
  20. Baniahmad A, Steiner C, Koehne AC, Renkawitz R 1990 Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61:505–514[CrossRef][Medline]
  21. Baniahmad A, Tsai SY, O’Malley BW, Tsai M J 1992 Kindred S thyroid hormone receptor is an active and constitutive silencer and repressor for thyroid hormone and retinoic acid responses. Proc Natl Acad Sci USA 89:10633–10637[Abstract/Free Full Text]
  22. Brent GA, Dunn MK, Harney JW, Gulick T, Larsen PR, Moore DD 1989 Thyroid hormone aporeceptor represses T3-inducible promoters and blocks activity of the retinoic acid receptor. New Biol 1:329–336[Medline]
  23. Graupner G, Wills KN, Tzukerman M, Zhang X-k, Pfahl M 1989 Dual regulatory role for thyroid hormone receptors allows control of retinoic acid receptor activity. Nature 340:653–656[CrossRef][Medline]
  24. Zhang XK, Wills KN, Graupner G, Tzukerman M, Hermann T, Pfahl M 1991 Ligand-binding domain of thyroid hormone receptors modulates DNA binding and determines bifunctional roles. New Biol 3:169–181[Medline]
  25. Yen PM, Wilcox EC, Hayashi Y, Refetoff S, Chin WW 1995 Studies on the repression of basal transcription (silencing) by artificial and natural human thyroid hormone receptor-ß mutants. Endocrinology 136:2845–2851[Abstract]
  26. Hollenberg AN, Monden T, Wondisford FE 1995 Ligand-independent and -dependent functions of thyroid hormone receptor isoforms depend upon their distinct amino termini. J Biol Chem 270:14274–14280[Abstract/Free Full Text]
  27. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamel Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor is mediated by a nuclear receptor co-repressor. Nature 377:397–403[CrossRef][Medline]
  28. Darling DS, Beebe JS, Burnside J, Winslow ER, Chin WW 1991 3,5,3'-triiodothyronine(T3) receptor-auxiliary protein (TRAP) binds DNA and forms heterodimers with the T3 receptor. Mol Endocrinol 5:73–84[Abstract/Free Full Text]
  29. Hsu JH, Zavacki AM, Harney JW, Brent GA 1995 Retinoid X receptor (RXR) differentially augments thyroid hormone response in cell lines as a function of the response element and endogenous RXR content. Endocrinology 136:421–430[Abstract]
  30. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM 1992 Retinoid X receptor interacts with nuclear receptors in retionic acid, thyroid hormone, and vitamin D signaling. Nature 355:446–449[CrossRef][Medline]
  31. Kurokawa R, Yu VC, Naar A, Kyakumoto S, Han Z, Silverman S, Rosenfeld MG, Glass CK 1993 Differential orientations of the DNA binding domain and carboxy-terminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7:1423–1435[Abstract/Free Full Text]
  32. Murray MB, Towle HC 1989 Identification of nuclear factors that enhance binding of the thyroid hormone receptor to a thyroid hormone response element. Mol Endocrinol 3:1432–1442
  33. Rosen ED, O’Donnell AL, Koenig RJ 1992 Ligand-dependent synergy of thyroid hormone and retinoid X receptors. J Biol Chem 267:22010–22013[Abstract/Free Full Text]
  34. Zhang SK, Hoffmann B, Tran BPV, Graupner G, Pfahl M 1992 Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature 355:441–445[CrossRef][Medline]
  35. Geffner ME, Su F, Ross NS, Hershman JM, Van Dop C, Menke J, Hao EH, Stanzak RK, Eaton T, Samuels HH, Usala SJ 1993 An arginine to histidine mutation in codon 311 of the c-erbAb gene results in a mutant receptor which does not mediate a dominant negative phenotype. J Clin Invest 91:538–546
  36. Manglesdorf DJ, Ong ES, Dyck JA, Evans RM 1990 A nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345:224–229[CrossRef][Medline]
  37. Au-Fliegner M, Helmer E, Casanova J, Raaka BM, Samuels HH 1993 The conserved ninth C-terminal heptad in thyroid hormone and retinoic acid receptors mediates diverse responses by affecting heterodimer but not homodimer formation. Mol Cell Biol 13:5725–5737[Abstract/Free Full Text]
  38. Neufer PD, Dohm GL 1993 Exercise induces a transient increase in transcription of the GLUT4 gene in skeletal muscle. Am J Physiol 265:C1597–C1603
  39. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  40. Hao E, Menke JB, Smith AM, Jones C, Geffner ME, Hershman JM, Wuerth JP, Samuels HH, Ways DK, Usala SJ 1994 Divergent dimerization properties of mutant ß1 thyroid hormone receptors are associated with different dominant negative activities. Mol Endocrinol 8:841–851[Abstract/Free Full Text]
  41. Deleted in proof
  42. Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E, DeGroot LJ 1992 Antipeptide polyclonal antibodies specifically recognize each human thyroid hormone receptor isoform. Endocrinology 131:2419–2429[Abstract/Free Full Text]
  43. Dozin B, Magnuson MA, Nikodem VM 1986 Thyroid hormone regulation of malic enzyme synthesis. J Biol Chem 261:10290–10292[Abstract/Free Full Text]
  44. Force WR, Tillman JB, Sprung CN, Spindler SR 1993 Homodimer and heterodimer DNA binding and transcriptional responsiveness to triiodothyronine (T3) and cis-retinoic acid are determined by the number and order of high affinity half-sites in a T3 response element. J Biol Chem 269:8863–8870[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G. A. Lima, G. F. Anhe, G. Giannocco, M. T. Nunes, M. L. Correa-Giannella, and U. F. Machado
Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR{alpha} transcriptional factors
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E132 - E138.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. de Lange, R. Senese, F. Cioffi, M. Moreno, A. Lombardi, E. Silvestri, F. Goglia, and A. Lanni
Rapid Activation by 3,5,3'-L-Triiodothyronine of Adenosine 5'-Monophosphate-Activated Protein Kinase/Acetyl-Coenzyme A Carboxylase and Akt/Protein Kinase B Signaling Pathways: Relation to Changes in Fuel Metabolism and Myosin Heavy-Chain Protein Content in Rat Gastrocnemius Muscle in Vivo
Endocrinology, December 1, 2008; 149(12): 6462 - 6470.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Karnieli and M. Armoni
Transcriptional regulation of the insulin-responsive glucose transporter GLUT4 gene: from physiology to pathology
Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E38 - E45.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. S. Malo, W. Zhang, F. Alkhoury, P. Pushpakaran, M. A. Abedrapo, M. Mozumder, E. Fleming, A. Siddique, J. W. Henderson, and R. A. Hodin
Thyroid Hormone Positively Regulates the Enterocyte Differentiation Marker Intestinal Alkaline Phosphatase Gene via an Atypical Response Element
Mol. Endocrinol., August 1, 2004; 18(8): 1941 - 1962.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Moreno, A. L. Serrano, T. Santalucia, A. Guma, C. Canto, N. J. Brand, M. Palacin, S. Schiaffino, and A. Zorzano
Differential Regulation of the Muscle-specific GLUT4 Enhancer in Regenerating and Adult Skeletal Muscle
J. Biol. Chem., October 17, 2003; 278(42): 40557 - 40564.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. P. Schroder-van der Elst, D. van der Heide, J. Kastelijn, B. Rousset, and M. Jesus Obregon
The Expression of the Sodium/Iodide Symporter Is Up-Regulated in the Thyroid of Fetuses of Iodine-Deficient Rats
Endocrinology, September 1, 2001; 142(9): 3736 - 3741.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Santalucia, K. R. Boheler, N. J. Brand, U. Sahye, C. Fandos, F. Vinals, J. Ferre, X. Testar, M. Palacin, and A. Zorzano
Factors Involved in GLUT-1 Glucose Transporter Gene Transcription in Cardiac Muscle
J. Biol. Chem., June 18, 1999; 274(25): 17626 - 17634.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Torrance, C. J.
Right arrow Articles by Dohm, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torrance, C. J.
Right arrow Articles by Dohm, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals