help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagasawa, T.
Right arrow Articles by DeGroot, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagasawa, T.
Right arrow Articles by DeGroot, L. J.
Endocrinology Vol. 138, No. 3 1276-1281
Copyright © 1997 by The Endocrine Society

Articles

Thyroid Hormone Receptor ß1 Expression in Developing Mouse Limbs and Face1

Takeshi Nagasawa, Satoru Suzuki, Teiji Takeda and Leslie J. DeGroot

Thyroid Study Unit, Department of Medicine, The University of Chicago, Chicago, Illinois 60637

Address all correspondence and requests for reprints to: Leslie J. DeGroot, M.D., Thyroid Study Unit, Mail Code 3090, Department of Medicine, The University of Chicago, 5841 South Maryland Avenue, Chicago, Illinois 60637.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid hormone, acting through thyroid hormone receptors (TRs), plays an important role in amphibian metamorphosis and vertebrate development. To identify where and when TRß1 promoter is activated during fetal life, we carried out an in vivo functional study of a 1.3 kilobase (kb) TRß1 gene promoter using transgenic mice that express the ß-galactosidase gene under control of the TRß1 promoter. Transactivation of the gene was determined by blue staining of tissues after incubation with X-gal. High expression of transgene was detected in the limbs and face of the 12.5-day-old fetus (12.5F) and 14.5F, reminiscent of the changes occurring during amphibian metamorphosis, and this disappeared at 17.5F. The expression was confined to the tip of finger bones, between fingers in the limb buds, and was detected in the root of whisker follicles, nose, and around the eyes. Signal was detected in the oral cavity, nasal cavity, lung, and urogenital sinus of 14.5F, and disappeared at 17.5F. Signal was detected in the midbrain and auditory vesicles of 9.5F but was reduced between 12.5F and 17.5F, and there was no expression in the cerebral cortex layer of 0 days old neonates (P0). Expression was detected in the cortex after P5. There was signal in the cerebral cortex, cerebellum, kidney, and liver of adult mice. TRß1 messenger RNA was detected by RT-PCR in the developing limbs and face. Transgene expression in the interdigital tissues, which regress during development, suggests that TRß1 is expressed in mammals in areas undergoing apoptosis as well as in areas undergoing differentiation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONE is well known as a biological effector of amphibian metamorphosis and mammalian development (1). Hormone action is mediated through nuclear thyroid hormone receptors (TRs) (2). There are two isoforms of TRs, {alpha} and ß (3, 4), and each isoform has subtypes derived through alternative splicing or use of different promoters (5). The level of TRß messenger RNA (mRNA) rises in parallel with thyroid hormone secretion during amphibian metamorphosis, especially in the developing limbs and regressing tail, and drops after metamorphosis (6). The mRNA for retinoic acid receptor (RAR) that is associated with morphogenesis (7, 8) is present in the developing limbs of mice (9). RAR and TRs are known to interact functionally and to form heterodimers (10). Apoptosis occurs during limb morphogenesis, especially in the interdigital tissues of the mouse at embryonic day 13 and 14 (11). Apoptosis is involved not only in regression of the amphibian tail, but also in organogenesis (12) and in oncogenesis (13, 14).

TRß mRNA expression can be detected in cerebral ventricular epithelium and the external granular layer of the cortex at embryonic day 9 and increases dramatically in fetal brain and liver just before birth on embryonic days 19 through 21 in chickens (15, 16). TRß1 mRNA was detected in rat diencephalon and mesencephalon at embryonic day 12.5 (17), in rat auditory vesicles at embryonic day 12.5 (18), and in rat liver at embryonic day 14.5 (19). Total maximum binding capacity for T3 was measurable in the whole rat fetus on embryonic day 13 and in rat brain on embryonic day 14 (20), and increases 30- to 100-fold from fetal day 16 to postnatal day 20 in rat brain (21). TRß1 protein was detected in the brain and liver of fetal rats beginning on embryonic day 14 (22) and in rat liver on embryonic day 16 (23). T3 was barely measurable in human limbs at 6–8 weeks gestation (24). There are, however, no reports that show a relation between thyroid hormone function and the differentiation of mammalian limbs, or apoptosis in mammals.

Transgenic mice have been very useful for understanding expression of genes during fetal development, including role of the anti-Müllerian hormone (25), pituitary {alpha}-subunit promoter (26), and the estrogen receptor promoter (27). We carried out an in vivo functional study of the 1.3 kilobase (kb) TRß1 gene promoter (28) using transgenic mice, to identify when and where TRß1 gene promoter is activated during mammalian fetal life, including limb buds. We also confirmed TRß1 mRNA in the limbs and face by RT-PCR methodology.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Construction of thyroid hormone receptor ß1 promoter fused to ß-galactosidase and making transgenic mice
The fragment from -1325 to +44 of the TRß1 promoter gene, HindIII to SalI, was excised from 5UTBPGEM3Z1 (29), and a 3.5-kb BamHI to HindIII fragment was excised from pCH110 (Pharmacia Biotech, Uppsala, Sweden). These two fragments were subcloned into the Bluescript (Stratagene, La Jolla, CA). This subcloned plasmid was digested with BamHI. The fragment including -1325 to +44 of the TRß1 promoter gene fused to ß-galactosidase was purified for microinjection by the sucrose gradient method (30). The purified fragment was microinjected into zygotes as described previously with minor modification (26, 31).

Identification of transgenic mice
Genomic DNA prepared from tail biopsies was screened for the presence of the transgene by (32) using the DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT). A 24-bp sense oligo (5' GATCTCTATAATCTCGCGCAACCT 3') and a 24-bp antisense oligo (5' GGACGACGACAGTATCGGCCTCAG 3') were used to amplify a 522-bp fragment of the ß-galactosidase gene. The PCR reactions were carried out under standard conditions using 400 ng genomic DNA, 1 pmol/µl primers, 5 µl 10x PCR buffer (15 mM MgCl2, 100 mM Tris-HCl, pH 9.0, 500 mM KCl, 1% Triton X-100), 1 µl 10 mM dNTPs, and 0.5 µl Taq DNA polymerase (Promega, Madison, WI). Reactions proceeded for 30 cycles of denaturation at 94 C for 30 sec, annealing at 55 C for 1.5 min, extension at 72 C for 2 min, and final extension at 72 C for 10 min.

Determination of fetus age
Midday after detection of a vaginal plug was considered to represent a 0.5 day-old fetus (0.5F).

Fixation and X-gal staining of whole embryos and tissues
Whole 9.5F embryos were fixed for 30 min in fixing solution (2% paraformaldehyde, 0.2% glutaraldehyde, 0.1 M PBS, pH 7.4) and incubated at 37 C overnight in an X-gal solution [1 mg/ml X-gal (BRL), 3 mM MgCl2, 5 mM K3Fe(CN)6, and 5 mM K4Fe(CN)6 in PBS].

The samples from 12.5F to adult were fixed for 2 h in fixing solution (above) with 0.01% deoxycholic acid (DOC) and 0.02% NP-40 and incubated at 37 C overnight in an X-gal solution (above) with 0.01% DOC and 0.02% NP-40.

Histological analysis of transgene expression
Whole embryos and tissues were fixed for 2 h in fixing solution (above), and overnight in PBS, containing 4% paraformaldehyde and 20% sucrose. The samples were frozen in OCT (Miles Inc., Naperville, IL) on dry ice. Fourteen-micrometer sections were cut in a cryostat (American Optical Corporation, Southbridge, MA) and mounted on poly-L-lysine-coated slides, then incubated at 37 C overnight in an X-gal solution (above).

RT-PCR
Total RNA was extracted according to the manufacturer’s recommendations using TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH) from 100 mg tissue of nontransgenic CD-1 mice. The limbs at 14.5F, 15.5F, 17.5F, and face at 12.5F, 14.5F, 17.5F, were examined. As a positive control, we chose adult brain and adult liver. Four micrograms of RNA in 9 µl DEPC-treated water were added to 2 µl random-hexamer primers (0.5 mg/ml) (Promega) and 0.5 µl RNAsin (Promega) and heated to 65 C for 5 min. The tube was chilled on ice. Five microliters of 1.25 mM dNTPs and 4 µl 5x RT buffer (BRL) were added, and the 21.5 µl reaction was incubated at 37 C for 1.5 h. The reaction was stopped by heating to 95 C for 5 min and the volume was brought to 200 µl using TE buffer (pH 8.0). A 21-bp sense oligo (5' ACTCCTAACAGTATGACAGAA 3') and a 21-bp antisense oligo (5' TCTGGGCACTTGAGATGCTCT 3') were used to amplify a 250-bp fragment of the mouse TRß1 specific complementary DNA (cDNA) (33). The PCR reactions were carried out under standard conditions using 5 µl of first-strand cDNA, 1 pmol/µl primers, 5 µl 10x PCR buffer (above), 1 µl 10 mM dNTPs and 0.5 µl Taq DNA polymerase per reaction. Reactions proceeded for 30 cycles of denaturation at 94 C for 60 sec, annealing at 55 C for 60 sec, extension at 72 C for 60 sec, and final extension at 72 C for 10 min.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of the transgene in the developing limbs and face
Three transgenic animals (465, 471, and 472) were obtained and colonies were derived from their parents. The number of copies of this transgene in their DNA was estimated to be 5 to 20 and did not differ in relation to areas of expression. We were not able to check the copy number in the feti and neonates because the tails were too small to provide enough DNA. Because expression was not detected in mice that had no transgene, mice that had some staining have one or several copies of the transgene. Animals from the three strains (S465, S471, and S472) expressed ß-galactosidase in the same areas and same segments (Table 1Go).


View this table:
[in this window]
[in a new window]
  		Table 1. Transgene expression in fetal mice

 
High expression of ß-galactosidase was detected in the limb buds and face in 12.5F and 14.5F (Fig. 1Go, A and B), and this disappeared at 17.5F (Table 1Go). Limb buds were present, but fingers were not separated in the limbs at 12.5F (Fig. 1AGo), and high expression of ß-galactosidase was detected in the proximal part of hind limbs at 12.5F (Fig. 1AGo). Growing hind limbs and separating fingers were found at 14.5F, and transgene expression spread over the whole limbs (Fig. 1BGo). Expression was prominent in the interdigital tissue, and interphalangeal joints were also stained blue (Fig. 1CGo). In histological sections at this time, expression was confined to the tips of finger bones and the tissue between fingers (Fig. 1DGo). In the interdigital tissue, the expression was detected in the area just under the surface epithelium and in a deeper layer. Between the surface and the deeper layer, there is an area in which the cells were not stained well by neutral red, which is expected to color living cells. This suggests that the expression is detected around dying mesenchymal cells (surface and bottom of interdigital tissues) and/or in the ectodermal cells (surface of interdigital tissues) and has an important effect upon mesenchymal apoptosis. Complete limbs and fingers existed at 17.5F, and expression disappeared (Table 1Go).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 1. Expression of the transgene, showing the results of X-gal staining. The blue color shows the expression of the ß-galactosidase gene that was driven by the TRß1 promoter. A, The whole body at 12.5F (S465). High expression was detected in the limb buds and face. The feti from the other founding animals, S465 and S471, showed the same results. B, The whole body at 14.5F (S471). High expression was detected in the limb buds and face. Similar results were found in feti of lines S471 and S472. C, The hind limb at 14.5F (S471). High expression was detected in the interdigital tissues, and interphalangeal joints were also stained blue. Feti from lines S471 and S472 showed the same results. D, Histological section of the limb at 14.5F (S471). The counterstain was neutral red. Expression of the transgene was confined to the tips of finger bones and the tissue between fingers. E, Sagittal section of the whole body at 14.5F (S471). Signal was detected along the oral cavity, nasal cavity, and in the urogenital sinus and intestines.

 
At 12.5F, high expression was detected in the lower face, especially in the nose and mouth (Fig. 1AGo). The face developed the familiar shape of a mouse in 14.5F and high signal intensity was present in the nose, mouth, and around the eyes (Fig. 1BGo). Histological sections demonstrated expression in the root of whisker follicles and around the eyes (data not shown). This expression disappeared at 17.5F.

Expression of the transgene in other tissues at 14.5F
In sagittal section of whole body at 14.5F, signal was detected along the oral cavity, nasal cavity, and in the urogenital sinus and intestines (Fig. 1EGo). In histological sections at this time, expression was detected in the inner surface of intestines and the lungs also were stained blue (data not shown). These signals, except for intestines, disappeared at 17.5F (Table 1Go).

Expression of the transgene in adult and neonatal mice
Transgene expression was clearly detected in whole brain, cortex, cerebellum, and kidney of adult mice. Slight expression was detected in liver and spleen of adult mice, but no expression was detected in heart (data not shown). Expression in neonates was the same as in the adult except for the cortex. No expression was observed in the cortex at birth, but expression was detected in 5-day-old animals.

Expression of the transgene in the fetal brain
In the 9.5F, signal was detected in the midbrain and the auditory vesicles (Table 1Go) but was reduced between 12.5F and 17.5F and was detected again after birth as described above.

TRß1 mRNA of developing limbs and face
To compare the TRß1 mRNA levels of limbs and face between 12.5F and 17.5F, RT-PCR was performed using nontransgenic mice. For a positive control of the amplified 250-bp fragment of the mouse TRß1 specific cDNA, we used adult brain, adult liver, and the vector containing this cDNA. For a negative control, we used total RNA of adult brain without RT. The TRß1 signal was detected in 14.5F limbs, was weaker at 15.5F, and disappeared at 17.5F (Fig. 2AGo). RT-PCR is semiquantitative, but we can be certain TRß1 mRNA differs in amount in the limbs between 14.5F and 17.5F. TRß1 mRNA signal was detected in 12.5F and 14.5F in facial tissue and was weaker at 17.5F (Fig. 2BGo). To check the quality of total mRNA of each sample, a 352-bp fragment of hypoxanthine-guanine phosphoribosyl transferase (HPRT) gene, a housekeeping gene, was amplified (34). The band intensities were the same in the tissues (Fig. 2CGo), showing that the difference of TRß1 mRNA level between the 14.5F and 17.5F is not due to a difference in the quality of total mRNA.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 2. TRß1 mRNA of developing limbs and face, showing the results of RT-PCR. A, The results of amplification of a TRß1 gene fragment using RNA derived from limbs. From the left, adult brain without RT, adult brain, adult liver, 14.5F limbs, 15.5F limbs, 17.5F limbs, mouse TRß1 specific cDNA, and marker DNA. No bands were detected in adult brain without RT (negative control), and the amplified 250-bp fragment was detected in the positive controls (adult brain, adult liver, mouse TRß1 specific cDNA). The TRß1 signal detected in 14.5F limbs, was weaker at 15.5F and disappeared at 17.5F. B, The results of amplification of a TRß1 gene fragment using RNA derived from face. RT-PCR was performed using the same controls and RNA from the face at 12.5F, 14.5F, and 17.5F. TRß1 mRNA signal was detected in 12.5F and 14.5F face and was weaker at 17.5F. C, The results of amplification of a HPRT fragment using RNA from limbs and face. A 352-bp fragment of HPRT gene, a housekeeping gene, was amplified using the same samples as Fig. 2Go, A and B. The band intensities were the same in the limbs at 14.5F, 15.5F, and 17.5F. The band intensities were also the same in the RNA from face at 12.5F, 14.5F, and 17.5F. We repeated these experiments three times using different animals, and the results were always similar.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Presumably the transgene is integrated randomly in our animals, but our three lines showed expression in the same areas and in the same time sequence. Because transgenic mice reported by others using a different promoter show different results (31), and nontransgenic mice have no staining, we believe that our results reflect TRß1 promoter function.

High expression of transgene in the limbs and face only during rapid differentiation suggests that TRß1 is related to formation of these tissues. Expression in the hands and feet, in the tips of the finger bones, and the interdigital tissues, coincides with reported timing and areas of apoptosis (11). The fetal limbs and face are stained more strongly than any adult tissues. We do not think apoptosis is the major effect of thyroid hormone, but rather that it occurs in certain selected tissues in certain areas, at certain times of development. We do not think that overlapping between apoptosis and TRß1 expression in the developing limbs is only due to accident. The pattern of the signal in the limbs and face, especially in the interdigital tissues and the root of whisker follicles, overlaps with reported areas of RAR expression (9, 35). RAR and TRs are probably important in the developing limbs and face and may be involved in apoptosis. Our RT-PCR study shows that TRß1 mRNA exists in the developing limbs and face and that the levels of TRß1 mRNA in the limbs change in parallel with the transgene expression. This means TRß1 is regulated at the transcriptional level and is associated with development of these tissues.

We note that patients with thyroid hormone resistance caused by deletion of TRß gene do not have gross abnormalities in the limbs and face (36). Possibly TR{alpha} can make up for the lack of TRß in certain aspects of development, or TRß acts to induce morphogenesis efficiently through accelerating function of RA or other factors.

In our system, there was no expression of the transgene in the heart. While there are reports of TRß1 mRNA exists in the heart (37), expression of protein, as measured by antibody, is restricted to TR{alpha}1 (38). We believe that TRß1 is expressed in the heart at a very low level at the transcriptional and protein level.

Expression of TRß1 mRNA has been reported in the auditory vesicles of the 12.5-day-old rat fetus (18). Our results support this observation. The time of expression of our transgene is earlier than the previously reported observation of TRß mRNA. This may be due to a species difference between mouse and rat. The expression in several tissues was detected mainly at 14.5F when the whole body was dynamically differentiating and disappeared at 17.5F when differentiation was almost complete. Expression of TRß1 gene could be associated with development of mouse tissues at this time and with human embryogenesis.

Transient expression of TRß1 gene in the developing fetal limbs and face, suggest that 1) TRß gene expression during mammalian embryogenesis is similar to expression of TRß gene during the climax of amphibian metamorphosis; 2) TRß1 is expressed in the developing limbs and face at the same time as RAR; 3) thyroid hormone and TRß1 may be associated with mammalian apoptosis as well as differentiation in the developing limbs; and 4) activation of TRß1 promoter has two peaks, first during morphogenesis (possibly related to anatomical change), and secondly after birth (possibly related to environmental change and elevation of thyroid hormone in the blood) (37).


   Acknowledgments
 
We thank E. B. Crenshaw, III for making the transgenic mice and W. M. Wood for a kind gift of the vector containing mouse TRß1-specific cDNA.


   Footnotes
 
1 Supported by the David Wiener Research Fund and NIH Grant P60-DK 20595. Back

Received August 26, 1996.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Frieden E 1967 Thyroid hormones and the biochemistry of amphibian metamorphosis. Res Prog Horm Res 23:139–194
  2. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  3. Sap J, Muñoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Berg H, Vennström B 1986 The c-erb-A protein is a high-affinity receptor for thyroid hormone. Nature 324:635–640[CrossRef][Medline]
  4. Weinberger C, Thompson CC, Ong ES, Lebo R, Evans RM 1986 The c-erb-A gene encodes a thyroid hormone receptor. Nature 324:641–646[CrossRef][Medline]
  5. Lazar MA, Chin WW 1990 Nuclear thyroid hormone receptors. J Clin Invest 86:1777–1782
  6. Yaoita Y, Brown DD 1990 A correlation of thyroid hormone receptor gene expression with amphibian metamorphosis. Genes Dev 4:1917–1924[Abstract/Free Full Text]
  7. Maden M 1982 Vitamin A and pattern formation in the regenerating limbs. Nature 295:672–675[CrossRef][Medline]
  8. Tickle C, Alberts B, Wolpert L, Lee J 1982 Local application of retinoic acid to the limb bond mimics the action of the polarizing region. Nature 296:564–566[CrossRef][Medline]
  9. Dollé P, Ruberte E, Kastner P, Petkovich M, Stoner CM, Gudas LJ, Chambon P 1989 Different expression of genes encoding {alpha}, ß and {gamma} retinoic acid receptors and CRABP in the developing limbs of the mouse. Nature 342:702–704
  10. Glass CK, Lipkin SM, Devary OV, Rosenfeld MG 1989 Positive and negative regulation of gene transcription by a retinoic acid-thyroid hormone receptor heterodimer. Cell 59:697–708[CrossRef][Medline]
  11. Mori C, Nakamura N, Kimura S, Irie H, Takigawa T, Shiota K 1995 Programmed cell death in the interdigital tissue of the fetal mouse limb is apoptosis with DNA fragmentation. Anat Rec 242:103–110[CrossRef][Medline]
  12. Glucksmann A 1951 Cell deaths in normal vertebrate ontogeny. Biol Rev 26:59–86[CrossRef]
  13. Tsujimoto Y, Cossman J, Jaffe E, Croce CM 1985 Involvement of the bcl-2 gene in human follicular lymphoma. Science 228:1440–1443[Abstract/Free Full Text]
  14. Vaux DL, Cory S, Adams JM 1988 Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335:440–442[CrossRef][Medline]
  15. Forrest D, Sjöberg M, Vennström B 1990 Contrasting developmental and tissue-specific expression of {alpha} and ß thyroid hormone receptor genes. EMBO J 9:1519–1528[Medline]
  16. Forrest D, Hallböök F, Persson H, Vennström B 1991 Distinct functions for thyroid hormone receptors {alpha} and ß in brain development indicated by differential expression of receptor genes. EMBO J 10:269–275[Medline]
  17. Bradley DJ, Towle HC, Young III WS 1992 Spatial and temporal expression of {alpha}- and ß- thyroid hormone receptor mRNAs, including the ß2-subtype, in the developing mammalian nervous system. J Neurosci 12:2288–2302[Abstract]
  18. Bradley DJ, Towle HC, Young III WS 1994 {alpha} and ß thyroid hormone receptor (TR) gene expression during auditory neurogenesis: Evidence for TR isoform-specific transcriptional regulation in vivo. Proc Natl Acad Sci USA 91:439–443[Abstract/Free Full Text]
  19. Mellström B, Naranjo JR, Santos A, Gonzalez AM, Bernal J 1991 Independent expression of the {alpha} and ß c-erbA genes in developing rat brain. Mol Endocrinol 5:1339–1350[Abstract/Free Full Text]
  20. Perez-Castillo A, Bernal J, Ferreiro B, Pans T 1985 The early ontogenesis of thyroid hormone receptor in the rat fetus. Endocrinology 117:2457–2461[Abstract/Free Full Text]
  21. Rodríguez M, Jolin T 1993 Triiodothyronine receptor complex in developing rat brain and pituitary. American Physiological Society, pp E804–E809
  22. Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E, DeGroot LJ 1994 Evaluation of the ontogeny of thyroid hormone receptor isotypes in rat brain and liver using an immunohistochemical technique. Eur J Endocrinol 130:97–106[Abstract/Free Full Text]
  23. Rodd C, Schwartz HL, Strait KA, Oppenheimer JH 1992 Ontogeny of hepatic nuclear triiodothyronine receptor isoforms in the rat. Endocrinology 131:2559–2564[Abstract/Free Full Text]
  24. Costa A, Arisio R, Benedetto C, Bertino E, Fabris C, Giraudi G, Marozio L, Maulà V, Pagliano 1991 Thyroid hormones in tissues from human embryos and fetuses. J Endocrinol Invest 14:559–568[Medline]
  25. Behringer RR, Cate RL, Froelick GJ, Palmiter RD, Brinster RL 1990 Abnormal sexual development in transgenic mice chronically expressing Müllerian inhibiting substance. Nature 345:167–170[CrossRef][Medline]
  26. Kendall SK, Gordon DF, Birkmeier TS, Petrey D, Sarapura VD, O’Shea KS, Wood WM, Lloyd RV, Ridgway EC, Camper SA 1994 Enhancer-mediated high level expression of mouse pituitary glycoprotein hormone {alpha}-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol Endocrinol 8:1420–1433[Abstract/Free Full Text]
  27. Cicatiello L, Cobellis G, Addeo R, Papa M, Altucci L, Sica V, Bresciani F, LeMeur M, Kumar VL, Chambon P, Weisz A 1995 In vivo functional analysis of the mouse estrogen receptor gene promoter: a transgenic mouse model to study tissue-specific and developmental regulation of estrogen receptor gene transcription. Mol Endocrinol 9:1077–1090[Abstract/Free Full Text]
  28. Sakurai A, Miyamoto T, DeGroot LJ 1992 Cloning and characterization of the human thyroid hormone receptor ß1 gene promoter. Biochem Biophys Res Commun 185:78–84[CrossRef][Medline]
  29. Suzuki S, Miyamoto T, Opsahl A, Sakurai A, DeGroot LJ 1994 Two thyroid hormone response elements are present in the promoter of human thyroid hormone receptor ß1. Mol Endocrinol 8:305–314[Abstract/Free Full Text]
  30. Maniatis T, Fritsch EF, Sarubrook J 1982 Molecular cloning – a laboratory manual. Cold Springfield Harbor, Cold Spring Harbor Laboratory, pp 2.85–2.87
  31. Crenshaw III EB, Russo AF, Swanson LW, Rosenfeld MG 1987 Neuron-specific alternative RNA processing in transgenic mice expressing a metallothionein-calcitonin fusion gene. Cell 49:389–398[CrossRef][Medline]
  32. Miller SA, Dykes DD, Polesky HF 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215[Free Full Text]
  33. Wood WM, Ocran KW, Gordon DF, Ridgway EC 1991 Isolation and characterization of mouse complementary DNAs encoding alpha and beta thyroid hormone receptors from thyrotrope cells: the mouse pituitary-specific beta 2 isoform differs at the amino terminus from the corresponding species from rat pituitary tumor cells. Mol Endocrinol 5:1049–1061[Abstract/Free Full Text]
  34. Reiner SL, Zheng S, Corry DB, Locksley RM 1993 Constructing polycompetitor cDNAs for quantitative PCR. J Immunol Meth 165:37–46[CrossRef][Medline]
  35. Ruberte E, Dolle P, Krust A, Zelent A, Morriss-Kay G, Chambon P 1990 Specific spatial and temporal distribution of retinoic acid receptor gamma transcripts during mouse embryogenesis. Development 108:213–222[Abstract]
  36. Takeda K, Sakurai A, DeGroot LJ, Refetoff S 1992 Recessive inheritance of thyroid hormone resistance caused by complete deletion of the protein-coding region of the thyroid hormone receptor ß gene. J Clin Endocrinol Metab 74:49–55[Abstract]
  37. Strait KA, Schwartz HL, Perez-Castillo A, Oppenheimer JH 1990 Relationship of c-erbA mRNA content to tissue triiodothyronine nuclear binding capacity and function in developing and adult rats. J Biol Chem 265:10514–10521[Abstract/Free Full Text]
  38. Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E, DeGroot LJ 1992 Antipeptide polyclonal antibodies specifically recognize each human thyroid hormone receptor isoform. Endocrinology 131:2419–2429[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
K. R. LaMontagne Jr., M. A. Moses, D. Wiederschain, S. Mahajan, J. Holden, H. Ghazizadeh, D. A. Frank, and J. L. Arbiser
Inhibition of MAP Kinase Kinase Causes Morphological Reversion and Dissociation between Soft Agar Growth and in Vivo Tumorigenesis in Angiosarcoma Cells
Am. J. Pathol., December 1, 2000; 157(6): 1937 - 1945.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagasawa, T.
Right arrow Articles by DeGroot, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagasawa, T.
Right arrow Articles by DeGroot, L. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals