Endocrinology Vol. 138, No. 3 1276-1281
Copyright © 1997 by The Endocrine Society
Thyroid Hormone Receptor ß1 Expression in Developing Mouse Limbs and Face1
Takeshi Nagasawa,
Satoru Suzuki,
Teiji Takeda and
Leslie J. DeGroot
Thyroid Study Unit, Department of Medicine, The University of
Chicago, Chicago, Illinois 60637
Address all correspondence and requests for reprints to: Leslie J. DeGroot, M.D., Thyroid Study Unit, Mail Code 3090, Department of Medicine, The University of Chicago, 5841 South Maryland Avenue, Chicago, Illinois 60637.
 |
Abstract
|
|---|
Thyroid hormone, acting through thyroid hormone receptors (TRs), plays
an important role in amphibian metamorphosis and vertebrate
development. To identify where and when TRß1 promoter is activated
during fetal life, we carried out an in vivo functional
study of a 1.3 kilobase (kb) TRß1 gene promoter using transgenic mice
that express the ß-galactosidase gene under control of the TRß1
promoter. Transactivation of the gene was determined by blue staining
of tissues after incubation with X-gal. High expression of transgene
was detected in the limbs and face of the 12.5-day-old fetus (12.5F)
and 14.5F, reminiscent of the changes occurring during amphibian
metamorphosis, and this disappeared at 17.5F. The expression was
confined to the tip of finger bones, between fingers in the limb buds,
and was detected in the root of whisker follicles, nose, and around the
eyes. Signal was detected in the oral cavity, nasal cavity, lung, and
urogenital sinus of 14.5F, and disappeared at 17.5F. Signal was
detected in the midbrain and auditory vesicles of 9.5F but was reduced
between 12.5F and 17.5F, and there was no expression in the cerebral
cortex layer of 0 days old neonates (P0). Expression was detected in
the cortex after P5. There was signal in the cerebral cortex,
cerebellum, kidney, and liver of adult mice. TRß1 messenger RNA was
detected by RT-PCR in the developing limbs and face. Transgene
expression in the interdigital tissues, which regress during
development, suggests that TRß1 is expressed in mammals in areas
undergoing apoptosis as well as in areas undergoing differentiation.
 |
Introduction
|
|---|
THYROID HORMONE is well known as a
biological effector of amphibian metamorphosis and mammalian
development (1). Hormone action is mediated through nuclear thyroid
hormone receptors (TRs) (2). There are two isoforms of TRs,
and ß
(3, 4), and each isoform has subtypes derived through alternative
splicing or use of different promoters (5). The level of TRß
messenger RNA (mRNA) rises in parallel with thyroid hormone secretion
during amphibian metamorphosis, especially in the developing limbs and
regressing tail, and drops after metamorphosis (6). The mRNA for
retinoic acid receptor (RAR) that is associated with morphogenesis (7, 8) is present in the developing limbs of mice (9). RAR and TRs are
known to interact functionally and to form heterodimers (10). Apoptosis
occurs during limb morphogenesis, especially in the interdigital
tissues of the mouse at embryonic day 13 and 14 (11). Apoptosis is
involved not only in regression of the amphibian tail, but also in
organogenesis (12) and in oncogenesis (13, 14).
TRß mRNA expression can be detected in cerebral ventricular
epithelium and the external granular layer of the cortex at embryonic
day 9 and increases dramatically in fetal brain and liver just before
birth on embryonic days 19 through 21 in chickens (15, 16). TRß1 mRNA
was detected in rat diencephalon and mesencephalon at embryonic day
12.5 (17), in rat auditory vesicles at embryonic day 12.5 (18), and in
rat liver at embryonic day 14.5 (19). Total maximum binding capacity
for T3 was measurable in the whole rat fetus on embryonic
day 13 and in rat brain on embryonic day 14 (20), and increases 30- to
100-fold from fetal day 16 to postnatal day 20 in rat brain (21).
TRß1 protein was detected in the brain and liver of fetal rats
beginning on embryonic day 14 (22) and in rat liver on embryonic day 16
(23). T3 was barely measurable in human limbs at 68 weeks
gestation (24). There are, however, no reports that show a relation
between thyroid hormone function and the differentiation of mammalian
limbs, or apoptosis in mammals.
Transgenic mice have been very useful for understanding expression of
genes during fetal development, including role of the
anti-Müllerian hormone (25), pituitary
-subunit promoter (26),
and the estrogen receptor promoter (27). We carried out an in
vivo functional study of the 1.3 kilobase (kb) TRß1 gene
promoter (28) using transgenic mice, to identify when and where TRß1
gene promoter is activated during mammalian fetal life, including limb
buds. We also confirmed TRß1 mRNA in the limbs and face by RT-PCR
methodology.
 |
Materials and Methods
|
|---|
Construction of thyroid hormone receptor ß1 promoter fused to
ß-galactosidase and making transgenic mice
The fragment from -1325 to +44 of the TRß1 promoter gene,
HindIII to SalI, was excised from 5UTBPGEM3Z1
(29), and a 3.5-kb BamHI to HindIII fragment was
excised from pCH110 (Pharmacia Biotech, Uppsala, Sweden). These two
fragments were subcloned into the Bluescript (Stratagene, La Jolla,
CA). This subcloned plasmid was digested with BamHI. The
fragment including -1325 to +44 of the TRß1 promoter gene fused to
ß-galactosidase was purified for microinjection by the sucrose
gradient method (30). The purified fragment was microinjected into
zygotes as described previously with minor modification (26, 31).
Identification of transgenic mice
Genomic DNA prepared from tail biopsies was screened for the
presence of the transgene by (32) using the DNA Thermal Cycler
(Perkin-Elmer Cetus, Norwalk, CT). A 24-bp sense oligo (5'
GATCTCTATAATCTCGCGCAACCT 3') and a 24-bp antisense oligo (5'
GGACGACGACAGTATCGGCCTCAG 3') were used to amplify a 522-bp fragment of
the ß-galactosidase gene. The PCR reactions were carried out under
standard conditions using 400 ng genomic DNA, 1 pmol/µl primers, 5
µl 10x PCR buffer (15 mM MgCl2, 100 mM
Tris-HCl, pH 9.0, 500 mM KCl, 1% Triton X-100), 1 µl 10
mM dNTPs, and 0.5 µl Taq DNA polymerase
(Promega, Madison, WI). Reactions proceeded for 30 cycles of
denaturation at 94 C for 30 sec, annealing at 55 C for 1.5 min,
extension at 72 C for 2 min, and final extension at 72 C for 10
min.
Determination of fetus age
Midday after detection of a vaginal plug was considered to
represent a 0.5 day-old fetus (0.5F).
Fixation and X-gal staining of whole embryos and
tissues
Whole 9.5F embryos were fixed for 30 min in fixing solution (2%
paraformaldehyde, 0.2% glutaraldehyde, 0.1 M PBS, pH 7.4)
and incubated at 37 C overnight in an X-gal solution [1 mg/ml X-gal
(BRL), 3 mM MgCl2, 5 mM K3Fe(CN)6, and 5
mM K4Fe(CN)6 in PBS].
The samples from 12.5F to adult were fixed for 2 h in fixing
solution (above) with 0.01% deoxycholic acid (DOC) and 0.02% NP-40
and incubated at 37 C overnight in an X-gal solution (above) with
0.01% DOC and 0.02% NP-40.
Histological analysis of transgene expression
Whole embryos and tissues were fixed for 2 h in fixing
solution (above), and overnight in PBS, containing 4% paraformaldehyde
and 20% sucrose. The samples were frozen in OCT (Miles Inc.,
Naperville, IL) on dry ice. Fourteen-micrometer sections were cut in a
cryostat (American Optical Corporation, Southbridge, MA) and mounted on
poly-L-lysine-coated slides, then incubated at 37 C
overnight in an X-gal solution (above).
RT-PCR
Total RNA was extracted according to the manufacturers
recommendations using TRI REAGENT (Molecular Research Center, Inc.,
Cincinnati, OH) from 100 mg tissue of nontransgenic CD-1 mice. The
limbs at 14.5F, 15.5F, 17.5F, and face at 12.5F, 14.5F, 17.5F, were
examined. As a positive control, we chose adult brain and adult liver.
Four micrograms of RNA in 9 µl DEPC-treated water were added to 2
µl random-hexamer primers (0.5 mg/ml) (Promega) and 0.5 µl RNAsin
(Promega) and heated to 65 C for 5 min. The tube was chilled on ice.
Five microliters of 1.25 mM dNTPs and 4 µl 5x RT buffer
(BRL) were added, and the 21.5 µl reaction was incubated at 37 C for
1.5 h. The reaction was stopped by heating to 95 C for 5 min and
the volume was brought to 200 µl using TE buffer (pH 8.0). A 21-bp
sense oligo (5' ACTCCTAACAGTATGACAGAA 3') and a 21-bp antisense oligo
(5' TCTGGGCACTTGAGATGCTCT 3') were used to amplify a 250-bp fragment of
the mouse TRß1 specific complementary DNA (cDNA) (33). The PCR
reactions were carried out under standard conditions using 5 µl of
first-strand cDNA, 1 pmol/µl primers, 5 µl 10x PCR buffer (above),
1 µl 10 mM dNTPs and 0.5 µl Taq DNA
polymerase per reaction. Reactions proceeded for 30 cycles of
denaturation at 94 C for 60 sec, annealing at 55 C for 60 sec,
extension at 72 C for 60 sec, and final extension at 72 C for 10
min.
 |
Results
|
|---|
Expression of the transgene in the developing limbs and face
Three transgenic animals (465, 471, and 472) were obtained and
colonies were derived from their parents. The number of copies of this
transgene in their DNA was estimated to be 5 to 20 and did not differ
in relation to areas of expression. We were not able to check the copy
number in the feti and neonates because the tails were too small to
provide enough DNA. Because expression was not detected in mice that
had no transgene, mice that had some staining have one or several
copies of the transgene. Animals from the three strains (S465, S471,
and S472) expressed ß-galactosidase in the same areas and same
segments (Table 1
).
High expression of ß-galactosidase was detected in the limb buds and
face in 12.5F and 14.5F (Fig. 1
, A and B), and this
disappeared at 17.5F (Table 1
). Limb buds were present, but fingers
were not separated in the limbs at 12.5F (Fig. 1A
), and high expression
of ß-galactosidase was detected in the proximal part of hind limbs at
12.5F (Fig. 1A
). Growing hind limbs and separating fingers were found
at 14.5F, and transgene expression spread over the whole limbs (Fig. 1B
). Expression was prominent in the interdigital tissue, and
interphalangeal joints were also stained blue (Fig. 1C
). In
histological sections at this time, expression was confined to the tips
of finger bones and the tissue between fingers (Fig. 1D
). In the
interdigital tissue, the expression was detected in the area just under
the surface epithelium and in a deeper layer. Between the surface and
the deeper layer, there is an area in which the cells were not stained
well by neutral red, which is expected to color living cells. This
suggests that the expression is detected around dying mesenchymal cells
(surface and bottom of interdigital tissues) and/or in the ectodermal
cells (surface of interdigital tissues) and has an important effect
upon mesenchymal apoptosis. Complete limbs and fingers existed at
17.5F, and expression disappeared (Table 1
).

View larger version (57K):
[in this window]
[in a new window]
|
Figure 1. Expression of the transgene, showing the results
of X-gal staining. The blue color shows the expression of the
ß-galactosidase gene that was driven by the TRß1 promoter. A, The
whole body at 12.5F (S465). High expression was detected in the limb
buds and face. The feti from the other founding animals, S465 and S471,
showed the same results. B, The whole body at 14.5F (S471). High
expression was detected in the limb buds and face. Similar results were
found in feti of lines S471 and S472. C, The hind limb at 14.5F (S471).
High expression was detected in the interdigital tissues, and
interphalangeal joints were also stained blue. Feti from lines S471 and
S472 showed the same results. D, Histological section of the limb at
14.5F (S471). The counterstain was neutral red. Expression of the
transgene was confined to the tips of finger bones and the tissue
between fingers. E, Sagittal section of the whole body at 14.5F (S471).
Signal was detected along the oral cavity, nasal cavity, and in the
urogenital sinus and intestines.
|
|
At 12.5F, high expression was detected in the lower face, especially in
the nose and mouth (Fig. 1A
). The face developed the familiar shape of
a mouse in 14.5F and high signal intensity was present in the nose,
mouth, and around the eyes (Fig. 1B
). Histological sections
demonstrated expression in the root of whisker follicles and around the
eyes (data not shown). This expression disappeared at 17.5F.
Expression of the transgene in other tissues at 14.5F
In sagittal section of whole body at 14.5F, signal was detected
along the oral cavity, nasal cavity, and in the urogenital sinus and
intestines (Fig. 1E
). In histological sections at this time, expression
was detected in the inner surface of intestines and the lungs also were
stained blue (data not shown). These signals, except for intestines,
disappeared at 17.5F (Table 1
).
Expression of the transgene in adult and neonatal mice
Transgene expression was clearly detected in whole brain, cortex,
cerebellum, and kidney of adult mice. Slight expression was detected in
liver and spleen of adult mice, but no expression was detected in heart
(data not shown). Expression in neonates was the same as in the adult
except for the cortex. No expression was observed in the cortex at
birth, but expression was detected in 5-day-old animals.
Expression of the transgene in the fetal brain
In the 9.5F, signal was detected in the midbrain and the auditory
vesicles (Table 1
) but was reduced between 12.5F and 17.5F and was
detected again after birth as described above.
TRß1 mRNA of developing limbs and face
To compare the TRß1 mRNA levels of limbs and face between 12.5F
and 17.5F, RT-PCR was performed using nontransgenic mice. For a
positive control of the amplified 250-bp fragment of the mouse TRß1
specific cDNA, we used adult brain, adult liver, and the vector
containing this cDNA. For a negative control, we used total RNA of
adult brain without RT. The TRß1 signal was detected in 14.5F limbs,
was weaker at 15.5F, and disappeared at 17.5F (Fig. 2A
).
RT-PCR is semiquantitative, but we can be certain TRß1 mRNA differs
in amount in the limbs between 14.5F and 17.5F. TRß1 mRNA signal was
detected in 12.5F and 14.5F in facial tissue and was weaker at 17.5F
(Fig. 2B
). To check the quality of total mRNA of each sample, a 352-bp
fragment of hypoxanthine-guanine phosphoribosyl transferase (HPRT)
gene, a housekeeping gene, was amplified (34). The band intensities
were the same in the tissues (Fig. 2C
), showing that the difference of
TRß1 mRNA level between the 14.5F and 17.5F is not due to a
difference in the quality of total mRNA.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 2. TRß1 mRNA of developing limbs and face, showing
the results of RT-PCR. A, The results of amplification of a TRß1 gene
fragment using RNA derived from limbs. From the left, adult brain
without RT, adult brain, adult liver, 14.5F limbs, 15.5F limbs, 17.5F
limbs, mouse TRß1 specific cDNA, and marker DNA. No bands were
detected in adult brain without RT (negative control), and the
amplified 250-bp fragment was detected in the positive controls (adult
brain, adult liver, mouse TRß1 specific cDNA). The TRß1 signal
detected in 14.5F limbs, was weaker at 15.5F and disappeared at 17.5F.
B, The results of amplification of a TRß1 gene fragment using RNA
derived from face. RT-PCR was performed using the same controls and RNA
from the face at 12.5F, 14.5F, and 17.5F. TRß1 mRNA signal was
detected in 12.5F and 14.5F face and was weaker at 17.5F. C, The
results of amplification of a HPRT fragment using RNA from limbs and
face. A 352-bp fragment of HPRT gene, a housekeeping gene, was
amplified using the same samples as Fig. 2 , A and B. The band
intensities were the same in the limbs at 14.5F, 15.5F, and 17.5F. The
band intensities were also the same in the RNA from face at 12.5F,
14.5F, and 17.5F. We repeated these experiments three times using
different animals, and the results were always similar.
|
|
 |
Discussion
|
|---|
Presumably the transgene is integrated randomly in our animals,
but our three lines showed expression in the same areas and in the same
time sequence. Because transgenic mice reported by others using a
different promoter show different results (31), and nontransgenic mice
have no staining, we believe that our results reflect TRß1 promoter
function.
High expression of transgene in the limbs and face only during rapid
differentiation suggests that TRß1 is related to formation of these
tissues. Expression in the hands and feet, in the tips of the finger
bones, and the interdigital tissues, coincides with reported timing and
areas of apoptosis (11). The fetal limbs and face are stained more
strongly than any adult tissues. We do not think apoptosis is the major
effect of thyroid hormone, but rather that it occurs in certain
selected tissues in certain areas, at certain times of development. We
do not think that overlapping between apoptosis and TRß1 expression
in the developing limbs is only due to accident. The pattern of the
signal in the limbs and face, especially in the interdigital tissues
and the root of whisker follicles, overlaps with reported areas of RAR
expression (9, 35). RAR and TRs are probably important in the
developing limbs and face and may be involved in apoptosis. Our RT-PCR
study shows that TRß1 mRNA exists in the developing limbs and face
and that the levels of TRß1 mRNA in the limbs change in parallel with
the transgene expression. This means TRß1 is regulated at the
transcriptional level and is associated with development of these
tissues.
We note that patients with thyroid hormone resistance caused by
deletion of TRß gene do not have gross abnormalities in the limbs and
face (36). Possibly TR
can make up for the lack of TRß in certain
aspects of development, or TRß acts to induce morphogenesis
efficiently through accelerating function of RA or other factors.
In our system, there was no expression of the transgene in the heart.
While there are reports of TRß1 mRNA exists in the heart (37),
expression of protein, as measured by antibody, is restricted to TR
1
(38). We believe that TRß1 is expressed in the heart at a very low
level at the transcriptional and protein level.
Expression of TRß1 mRNA has been reported in the auditory vesicles of
the 12.5-day-old rat fetus (18). Our results support this observation.
The time of expression of our transgene is earlier than the previously
reported observation of TRß mRNA. This may be due to a species
difference between mouse and rat. The expression in several tissues was
detected mainly at 14.5F when the whole body was dynamically
differentiating and disappeared at 17.5F when differentiation was
almost complete. Expression of TRß1 gene could be associated with
development of mouse tissues at this time and with human
embryogenesis.
Transient expression of TRß1 gene in the developing fetal limbs and
face, suggest that 1) TRß gene expression during mammalian
embryogenesis is similar to expression of TRß gene during the climax
of amphibian metamorphosis; 2) TRß1 is expressed in the developing
limbs and face at the same time as RAR; 3) thyroid hormone and TRß1
may be associated with mammalian apoptosis as well as differentiation
in the developing limbs; and 4) activation of TRß1 promoter has two
peaks, first during morphogenesis (possibly related to anatomical
change), and secondly after birth (possibly related to environmental
change and elevation of thyroid hormone in the blood) (37).
 |
Acknowledgments
|
|---|
We thank E. B. Crenshaw, III for making the transgenic mice and
W. M. Wood for a kind gift of the vector containing mouse
TRß1-specific cDNA.
 |
Footnotes
|
|---|
1 Supported by the David Wiener Research Fund and NIH Grant P60-DK
20595. 
Received August 26, 1996.
 |
References
|
|---|
-
Frieden E 1967 Thyroid hormones and the
biochemistry of amphibian metamorphosis. Res Prog Horm Res 23:139194
-
Evans RM 1988 The steroid and thyroid hormone
receptor superfamily. Science 240:889895[Abstract/Free Full Text]
-
Sap J, Muñoz A, Damm K, Goldberg Y, Ghysdael J,
Leutz A, Berg H, Vennström B 1986 The c-erb-A protein is a
high-affinity receptor for thyroid hormone. Nature 324:635640[CrossRef][Medline]
-
Weinberger C, Thompson CC, Ong ES, Lebo R, Evans
RM 1986 The c-erb-A gene encodes a thyroid hormone receptor.
Nature 324:641646[CrossRef][Medline]
-
Lazar MA, Chin WW 1990 Nuclear thyroid hormone
receptors. J Clin Invest 86:17771782
-
Yaoita Y, Brown DD 1990 A correlation of thyroid
hormone receptor gene expression with amphibian metamorphosis. Genes
Dev 4:19171924[Abstract/Free Full Text]
-
Maden M 1982 Vitamin A and pattern formation in
the regenerating limbs. Nature 295:672675[CrossRef][Medline]
-
Tickle C, Alberts B, Wolpert L, Lee J 1982 Local
application of retinoic acid to the limb bond mimics the action of the
polarizing region. Nature 296:564566[CrossRef][Medline]
-
Dollé P, Ruberte E, Kastner P, Petkovich M,
Stoner CM, Gudas LJ, Chambon P 1989 Different expression of genes
encoding
, ß and
retinoic acid receptors and CRABP in the
developing limbs of the mouse. Nature 342:702704
-
Glass CK, Lipkin SM, Devary OV, Rosenfeld MG 1989 Positive and negative regulation of gene transcription by a retinoic
acid-thyroid hormone receptor heterodimer. Cell 59:697708[CrossRef][Medline]
-
Mori C, Nakamura N, Kimura S, Irie H, Takigawa T, Shiota
K 1995 Programmed cell death in the interdigital tissue of the
fetal mouse limb is apoptosis with DNA fragmentation. Anat Rec 242:103110[CrossRef][Medline]
-
Glucksmann A 1951 Cell deaths in normal vertebrate
ontogeny. Biol Rev 26:5986
-
Tsujimoto Y, Cossman J, Jaffe E, Croce CM 1985 Involvement of the bcl-2 gene in human follicular lymphoma. Science 228:14401443[Abstract/Free Full Text]
-
Vaux DL, Cory S, Adams JM 1988 Bcl-2 gene promotes
haemopoietic cell survival and cooperates with c-myc to immortalize
pre-B cells. Nature 335:440442[CrossRef][Medline]
-
Forrest D, Sjöberg M, Vennström B 1990 Contrasting developmental and tissue-specific expression of
and ß
thyroid hormone receptor genes. EMBO J 9:15191528[Medline]
-
Forrest D, Hallböök F, Persson H,
Vennström B 1991 Distinct functions for thyroid hormone
receptors
and ß in brain development indicated by differential
expression of receptor genes. EMBO J 10:269275[Medline]
-
Bradley DJ, Towle HC, Young III WS 1992 Spatial and
temporal expression of
- and ß- thyroid hormone receptor mRNAs,
including the ß2-subtype, in the developing mammalian nervous system.
J Neurosci 12:22882302[Abstract]
-
Bradley DJ, Towle HC, Young III WS 1994
and ß
thyroid hormone receptor (TR) gene expression during auditory
neurogenesis: Evidence for TR isoform-specific transcriptional
regulation in vivo. Proc Natl Acad Sci USA 91:439443[Abstract/Free Full Text]
-
Mellström B, Naranjo JR, Santos A, Gonzalez AM,
Bernal J 1991 Independent expression of the
and ß c-erbA
genes in developing rat brain. Mol Endocrinol 5:13391350[Abstract]
-
Perez-Castillo A, Bernal J, Ferreiro B, Pans T 1985 The early ontogenesis of thyroid hormone receptor in the rat fetus.
Endocrinology 117:24572461[Abstract]
-
Rodríguez M, Jolin T 1993 Triiodothyronine
receptor complex in developing rat brain and pituitary. American
Physiological Society, pp E804E809
-
Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E,
DeGroot LJ 1994 Evaluation of the ontogeny of thyroid hormone
receptor isotypes in rat brain and liver using an immunohistochemical
technique. Eur J Endocrinol 130:97106[Abstract]
-
Rodd C, Schwartz HL, Strait KA, Oppenheimer JH 1992 Ontogeny of hepatic nuclear triiodothyronine receptor isoforms in the
rat. Endocrinology 131:25592564[Abstract]
-
Costa A, Arisio R, Benedetto C, Bertino E, Fabris C,
Giraudi G, Marozio L, Maulà V, Pagliano 1991 Thyroid
hormones in tissues from human embryos and fetuses. J Endocrinol Invest 14:559568[Medline]
-
Behringer RR, Cate RL, Froelick GJ, Palmiter RD,
Brinster RL 1990 Abnormal sexual development in transgenic mice
chronically expressing Müllerian inhibiting substance. Nature 345:167170[CrossRef][Medline]
-
Kendall SK, Gordon DF, Birkmeier TS, Petrey D, Sarapura
VD, OShea KS, Wood WM, Lloyd RV, Ridgway EC, Camper SA 1994 Enhancer-mediated high level expression of mouse pituitary glycoprotein
hormone
-subunit transgene in thyrotropes, gonadotropes, and
developing pituitary gland. Mol Endocrinol 8:14201433[Abstract]
-
Cicatiello L, Cobellis G, Addeo R, Papa M, Altucci L,
Sica V, Bresciani F, LeMeur M, Kumar VL, Chambon P, Weisz A 1995 In vivo functional analysis of the mouse estrogen receptor gene
promoter: a transgenic mouse model to study tissue-specific and
developmental regulation of estrogen receptor gene transcription. Mol
Endocrinol 9:10771090[Abstract]
-
Sakurai A, Miyamoto T, DeGroot LJ 1992 Cloning and
characterization of the human thyroid hormone receptor ß1 gene
promoter. Biochem Biophys Res Commun 185:7884[CrossRef][Medline]
-
Suzuki S, Miyamoto T, Opsahl A, Sakurai A, DeGroot
LJ 1994 Two thyroid hormone response elements are present in the
promoter of human thyroid hormone receptor ß1. Mol Endocrinol 8:305314[Abstract]
-
Maniatis T, Fritsch EF, Sarubrook J 1982 Molecular
cloning a laboratory manual. Cold Springfield Harbor, Cold Spring
Harbor Laboratory, pp 2.852.87
-
Crenshaw III EB, Russo AF, Swanson LW, Rosenfeld MG 1987 Neuron-specific alternative RNA processing in transgenic mice
expressing a metallothionein-calcitonin fusion gene. Cell 49:389398[CrossRef][Medline]
-
Miller SA, Dykes DD, Polesky HF 1988 A simple
salting out procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res 16:1215[Free Full Text]
-
Wood WM, Ocran KW, Gordon DF, Ridgway EC 1991 Isolation and characterization of mouse complementary DNAs encoding
alpha and beta thyroid hormone receptors from thyrotrope cells: the
mouse pituitary-specific beta 2 isoform differs at the amino terminus
from the corresponding species from rat pituitary tumor cells. Mol
Endocrinol 5:10491061[Abstract]
-
Reiner SL, Zheng S, Corry DB, Locksley RM 1993 Constructing polycompetitor cDNAs for quantitative PCR. J Immunol
Meth 165:3746[CrossRef][Medline]
-
Ruberte E, Dolle P, Krust A, Zelent A, Morriss-Kay G,
Chambon P 1990 Specific spatial and temporal distribution of
retinoic acid receptor gamma transcripts during mouse embryogenesis.
Development 108:213222[Abstract]
-
Takeda K, Sakurai A, DeGroot LJ, Refetoff S 1992 Recessive inheritance of thyroid hormone resistance caused by complete
deletion of the protein-coding region of the thyroid hormone receptor
ß gene. J Clin Endocrinol Metab 74:4955[Abstract]
-
Strait KA, Schwartz HL, Perez-Castillo A, Oppenheimer
JH 1990 Relationship of c-erbA mRNA content to tissue
triiodothyronine nuclear binding capacity and function in developing
and adult rats. J Biol Chem 265:1051410521[Abstract/Free Full Text]
-
Falcone M, Miyamoto T, Fierro-Renoy F, Macchia E,
DeGroot LJ 1992 Antipeptide polyclonal antibodies specifically
recognize each human thyroid hormone receptor isoform. Endocrinology 131:24192429[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
K. R. LaMontagne Jr., M. A. Moses, D. Wiederschain, S. Mahajan, J. Holden, H. Ghazizadeh, D. A. Frank, and J. L. Arbiser
Inhibition of MAP Kinase Kinase Causes Morphological Reversion and Dissociation between Soft Agar Growth and in Vivo Tumorigenesis in Angiosarcoma Cells
Am. J. Pathol.,
December 1, 2000;
157(6):
1937 - 1945.
[Abstract]
[Full Text]
[PDF]
|
 |
|