help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Gustafsson, J.-A.
Endocrinology Vol. 138, No. 3 863-870
Copyright © 1997 by The Endocrine Society


Articles

Comparison of the Ligand Binding Specificity and Transcript Tissue Distribution of Estrogen Receptors {alpha} and ß

George G. J. M. Kuiper1, Bo Carlsson, Kaj Grandien, Eva Enmark, Johan Häggblad, Stefan Nilsson and Jan-Åke Gustafsson2

Center for Biotechnology and Department of Medical Nutrition, Karolinska Institute (G.G.J.M.K., K.G., E.E., J.-Å.G.); and KaroBio AB (B.C., J.H., S.N.) Huddinge, Sweden

Address all correspondence and requests for reprints to: George Kuiper, Center for Biotechnology, Karolinska Institute, NOVUM, S-14186 Huddinge, Sweden. E-mail: george.kuiper{at}cbt.ki.se


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The rat estrogen receptor (ER) exists as two subtypes, ER{alpha} and ERß, which differ in the C-terminal ligand binding domain and in the N-terminal transactivation domain. In this study we investigated the messenger RNA expression of both ER subtypes in rat tissues by RT-PCR and compared the ligand binding specificity of the ER subtypes.

Saturation ligand binding analysis of in vitro synthesized human ER{alpha} and rat ERß protein revealed a single binding component for 16{alpha}-iodo-17ß-estradiol with high affinity [dissociation constant (Kd) = 0.1 nM for ER{alpha} protein and 0.4 nM for ERß protein]. Most estrogenic substances or estrogenic antagonists compete with 16{alpha}-[125I]iodo-17ß-estradiol for binding to both ER subtypes in a very similar preference and degree; that is, diethylstilbestrol > hexestrol > dienestrol > 4-OH-tamoxifen > 17ß-estradiol > coumestrol, ICI-164384 > estrone, 17{alpha}-estradiol > nafoxidine, moxestrol > clomifene > estriol, 4-OH-estradiol > tamoxifen, 2-OH-estradiol, 5-androstene-3ß,17ß-diol, genistein for the ER{alpha} protein and dienestrol > 4-OH-tamoxifen > diethylstilbestrol > hexestrol > coumestrol, ICI-164384 > 17ß-estradiol > estrone, genistein > estriol > nafoxidine, 5-androstene-3ß,17ß-diol > 17{alpha}-estradiol, clomifene, 2-OH-estradiol > 4-OH-estradiol, tamoxifen, moxestrol for the ERß protein. The rat tissue distribution and/or the relative level of ER{alpha} and ERß expression seems to be quite different, i.e. moderate to high expression in uterus, testis, pituitary, ovary, kidney, epididymis, and adrenal for ER{alpha} and prostate, ovary, lung, bladder, brain, uterus, and testis for ERß. The described differences between the ER subtypes in relative ligand binding affinity and tissue distribution could contribute to the selective action of ER agonists and antagonists in different tissues.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGENS INFLUENCE the growth, differentiation and functioning of many target tissues. These include tissues of the male and female reproductive systems such as mammary gland, uterus, ovary, testis, and prostate. Estrogens also play an important role in bone maintenance and in the cardiovascular system, where estrogens have certain cardioprotective effects (1). Estrogens are mainly produced in the ovaries and testis. They diffuse in and out of all cells, but are retained with high affinity and specificity in target cells by an intranuclear binding protein, termed the estrogen receptor (ER). Once bound by estrogens, the ER undergoes a conformational change, allowing the receptor to bind with high affinity to chromatin and to modulate transcription of target genes (2). Steroid hormone receptors consist of a hypervariable N-terminal domain that contributes to the transactivation function; a highly conserved central domain responsible for specific DNA binding, dimerization, and nuclear localization, and a C-terminal domain involved in ligand binding and ligand-dependent transactivation function (1). The rat ER cDNA was cloned from uterus and found to be highly homologous to the ER complementary DNAs (cDNAs) cloned from mouse, human, and chicken (3). We recently cloned a novel rat ER cDNA from prostate (4), which we suggested be named rat ERß subtype to distinguish it from the previously cloned ER cDNA (consequently ER{alpha} subtype). The rat ERß cDNA encodes a protein of 485 amino acid residues with a calculated mol wt of 54200. Rat ERß protein is highly homologous to rat ER{alpha} protein, particularly in the DNA binding domain (> 90% amino acid identity) and in the C-terminal ligand binding domain (LBD) (55%). Saturation ligand binding experiments with in vitro synthesized ERß protein revealed a single binding component for 17ß-estradiol (E2) with high affinity [dissociation constant (Kd) = 0.6 nM]. Expression of ERß was investigated by in situ hybridization, and prominent expression was found in rat prostate (secretory epithelial cells) and ovary (granulosa cells). In cotransfection experiments of Chinese hamster ovary (CHO) cells with an ERß expression vector and an estrogen-regulated reporter gene, maximal stimulation of reporter gene activity was found during incubation with 1 nM E2 (4).

The biological significance of the existence of two ER subtypes is at this moment unclear. Perhaps the existence of two ER subtypes provides, at least in part, an explanation for the selective actions of estrogens in different target tissues (5). In fact, the high degree of interspecies conservation of the individual ER subtypes throughout vertebrate evolution (Ref. 6 and our unpublished observations) could suggest that the basis for the selective effects of estrogens resides in the control of different subsets of estrogen-responsive promoters by the two ER subtypes. This would implicate differential expression of the ER subtypes in target tissues.

The overall homology between the rat ER{alpha} protein LBD and rat ERß protein LBD is not more than 55% (Fig. 1Go). Interestingly, the ERß protein LBD encompassing amino acid residues 223–457 has a low homolgy with the ER{alpha} protein LBD between amino acid residues 344–403, whereas outside this stretch the homology is considerably higher (amino acid residues 223–343 and 404–457). The structural core of the LBD of the human ER{alpha} protein has recently been mapped by restricted proteolysis, and only one single region within this core was found to be easily accessible to proteases (7). This surface-exposed protease accessible region (human ER{alpha} LBD amino acid residues 465–468) is in the center of the stretch showing lowest homology with ERß protein. The amino acid sequence stretches of the ERß LBD between amino acids 223–343 and 404–457 are probably, similarly to the highly homologous stretches in the ER{alpha} LBD, part of a compact hydrophobic (non-surface-exposed) entity directly contacting the ligand. Although several parts of these stretches are completely conserved, and the amino acid alterations often are conservative, it is possible that interesting differences in ligand binding affinity and/or specificity exist between the ER subtypes. Chemically quite diverse compounds (estrogens, some androgens, phytoestrogens, antiestrogens, and environmental estrogens) have been shown in the past to have estrogenizing activity and to interact with the ER from rat uterus and human breast tumor cells (Ref. 8 and references therein).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Alignment of amino acid sequences of rat ER{alpha} protein (GenBank database Y00102) LBD (amino acid residues 320–558), and rat ERß protein (GenBank database U57439) LBD (amino acid residues 223–457). For alignment, Clustal analysis using MEGALIGN/DNASTAR software was used.

 
In the present study we investigated the ligand binding specificity of the two ER subtypes and the transcript tissue distribution in the adult rat.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
The radioligand 16{alpha}-[125I]iodo-E2 ([125I]E2) was obtained from New England Nuclear (Boston, MA). The unlabeled steroids E2, 17{alpha}-estradiol, estrone, estriol, dehydroepiandrosterone, 5{alpha}-dihydrotestosterone, testosterone, progesterone, corticosterone, moxestrol (11ß-methoxy-17{alpha}-ethynyl-1,3,5(10)-estratrien-3,17ß-diol), 4-hydroxy-estradiol (1,3,5(10)-estratriene-3,4,17ß-triol), 2-hydroxy-estradiol (1,3,5(10)-estratriene-2,3,17ß-triol), 5-androstenediol (5-androstene-3ß,17ß-diol), 4-andro-stenediol (4-androstene-3ß,17ß-diol), 3{alpha}-androstanediol (5{alpha}-andro-stane-3{alpha},17ß-diol), 3ß-androstanediol (5{alpha}-androstane-3ß,17ß-diol), 5{alpha}-androstanedione (5{alpha}-androstane-3,17-dione), 5ß-androstanedione (5ß-androstane-3,17-dione), 4-androstenedione (4-androstene-3,17-dione), norethynodrel (17{alpha}-ethynyl-17-hydroxy-5(10)-estren-3-one), noreth-indrone (19nor-4-androsten-17{alpha}-ethynyl-17ß-ol-3-one), 19-nortestosterone (4-estren-17ß-ol-3-one), ß-sitosterol (24ß-ethyl-5-cholesten-3ß-ol), and estrone-3-sulfate (3-hydroxy-1,3,5(10)estratrien-17-one-3-sulfate) were obtained from Steraloids Inc. (Wilton, NH) except for dehydroepiandrosterone and moxestrol (RU 2858), which were obtained from Ikapharm (Ramat-Gan, Israel) and from Roussel Uclaf (Romainville, France), respectively.

The phytoestrogen coumestrol (2-(2,4-dihydroxyphenyl)-6-hydroxy-3-benzofurancarboxylic acid lactone) was obtained from Eastman Kodak (Rochester, NY) and genistein (4,5,7-trihydroxyisoflavone) and ß-zearalanol (2,4-dihydroxy-6-[6ß,10-dihydroxyundecyl]benzoic acid µ-lactone) were from Sigma (St. Louis, MO).

The synthetic estrogens diethylstilbestrol (4,4'-(1,2-diethyl-1, 2-ethene-diyl)bisphenol), hexestrol (4,4'-(1,2-diethyl-1,2-ethane-diyl)bisphenol), and dienestrol (4,4'-(1,2-diethylidene-1,2-ethane-diyl)bisphenol) were obtained from Sigma. The antiestrogens tamoxifen (1-p-ß-dimethylamino-ethoxyphenyl-trans-1,2-diphenylbut-1-ene), 4-OH-tamoxifen (1-(p-dimethylaminoethoxyphenyl)1-(4-hydroxyphenyl)-2-phenyl-but-1-ene), clomiphene (1-(p-(ß-diethylaminoethoxy)phenyl)-1,2-diphenylchloro-ethylene), nafoxidine 1-(2-[p-(3,4-dihydro-6-methoxy-2-phenyl-1-naphtyl)-phenoxy]-ethyl)pyrrolidine hydrochloride, and ICI-164384 (N-n-butyl-11-(3,17ß-dihydroxyestra-1,3,5(10)trien-7{alpha}-yl)-N-methylundecanamide) were obtained from Sigma or synthesized by KaroBio AB (ICI-164384) (Huddinge, Sweden). The environmental estrogens Bisphenol A (2,2-bis(4-hydroxyphenyl)propane) and methoxychlor (1,1,1-trichloro-2,2-bis(p-methoxy-phenyl)ethane) were obtained from Aldrich (Germany). The structural formulas and chemical properties of all the competitors used can be found in the Merck Index or elsewhere (8, 9, 10).

Sephadex G25 columns (QS-2A) were obtained from Isolab (Akron, OH). All other chemicals were of the highest purity available.

In vitro transcription and translation
The 2.6 kbp rat ERß cDNA (4) was subcloned into the EcoRI site of pBluescript (Stratagene, La Jolla, CA). The plasmid pT7ßhER (11) containing the wild type (HEGO) human ER{alpha} sequence was a kind gift from Dr. B.W. O’Malley and co-workers (Baylor College of Medicine, Houston, TX). Human ER{alpha} and rat ERß protein was synthesized in vitro using the TnT-coupled reticulocyte lysate system (Promega, Madison, WI) with T7-RNA polymerase, during a 90 min reaction at 30 C. Translation reaction mixtures (50-µl portions) were snap-frozen and stored at -70 C until further use.

Saturation ligand binding analysis
Translation reaction mixtures were diluted in buffer A (20 mM HEPES, pH = 7.9; 150 mM NaCl, 10% wt/vol glycerol, 1 mM EDTA, 6 mM monothioglycerol, and 10 mM Na2 MoO4) and kept at 4 C. Aliquots equivalent to 0.25 µl ER{alpha} translation mixture or 2 µl ERß translation mixture were incubated in duplo with 10–800 pM [125I]-E2 in the presence or absence of a 300-fold excess of diethylstilbestrol for 16 h at 4 C. The final incubation volume was 200 µl, and to the ER{alpha} incubation series unprogrammed reticulocyte lysate was added to equalize the total protein concentrations. Free and unbound radioligand was separated by gelfiltration over G-25 columns at 4 C as described (12). Bound radioactivity was measured in a Wallac {gamma}-counter (Turku, Finland) with 70% efficiency. Specific binding was determined by subtracting nonspecific binding from total binding, and the free ligand concentration was estimated by subtracting total bound ligand from added ligand. The equilibrium Kd was calculated as the free concentration of radioligand at half-maximal binding by fitting data to the Hill equation (13) and by linear Scatchard transformation (14). Curve fitting was done in KaleidaGraph 2.1.3 (Abelbeck Software, PA).

Ligand competition experiments
Competitors were dissolved in dimethylsulfoxide at a concentration of 1 mM, except for coumestrol, genistein, and ß-zearalanol, which were dissolved in ethanol. Translation reaction mixtures were diluted with buffer A and kept at 4 C. Aliquots equivalent to 0.25 µl ER{alpha} translation mixture or 2 µl ERß translation mixture were added to dilutions containing [125I]-E2 and the respective competitors. The final concentration of radioligand was 125–150 pM, and the incubation time was 16 h at 4 C. Unprogrammed reticulocyte lysate was added to the ER{alpha} series to equalize protein concentrations. Competitors were present at concentrations between 10-4 M and 10-10 M; each competition curve consisting of eight concentrations in duplicates. Free and bound ligand were separated by gelfiltration over Sephadex G-25 columns as described (12). The data were evaluated by a nonlinear four-parameter logistic model (15) to estimate the IC50 value (the concentration of competitor at half-maximal specific binding). Relative binding affinity (RBA) of each competitor was calculated as the ratio of concentrations of E2 and competitor required to reduce the specific radioligand binding by 50% (= ratio of IC50 values). The RBA value for E2 was arbitrarily set at 100. The Cheng-Prusoff equation (13, 14) was used to calculate the Ki of the various competitors.

PCR analysis of rat tissue total RNA
Male and female rats (6–8 weeks old) were killed by cervical dislocation, and tissues were collected. Tissue samples were immediately processed for total RNA isolation according to the acid guanidinium thiocyanate-phenol-chloroform single-step extraction protocol (16). The integrity and quality of the purified RNA was controlled by formaldehyde denaturing agarose gel electrophoresis and by measurement of the A260/A280 nm ratio. Only RNA samples exhibiting an A260/A280 ratio >1.6 and showing integrity of the RNA by electrophoresis were used in further experiments. The RNA isolated from spleen and brain cortex appeared degraded and was discarded.

Random hexamer-primer cDNA synthesis was performed as described (17, 18). For the PCR amplification, 5% of the synthesized cDNA was added to a PCR reaction mixture as described (17) and amplified for 30 cycles by incubation at 95 C for 30 sec, 57 C for 15 sec, 72 C for 60 sec, and a final incubation at 72 C for 3 min, all in a PCR 9600 thermocycler (Perkin-Elmer, Norwalk, CT). The oligonucleotides erbkg1: 5'TTCCCGGCAGCACCAGTAACC (+38 relative to ATG) and erbkg2: 5'TCCCTCTTTGCGTTTGGACTA (+279 relative to ATG) were used for amplification of a 262-bp fragment of the ERß messenger RNA (mRNA). The oligonucleotides kgb5: 5'AATTCTGACAATCGACGCCAG (+472 relative to ATG) and kgb6: 5'GTGCTTCAACATTCTCCCTCCTC (+794 relative to ATG) were used for amplification of a 344-bp fragment of the rat ER{alpha} mRNA. The oligonucleotides used for the amplification of actin mRNA are previously described (17). After agarose gel electrophoresis and blotting to nitrocellulose filters, the PCR products were hybridized to the internal oligonucleotides: ERUR 4: 5'GGGACTCTTTTGAGGTTCTGC (+163-182 relative to ATG) for ERß, KG50: 5'GCAGCGAGAAGGGAAACATGA (+518-538 relative to ATG) for ER{alpha}, and actin primer: 5'GATGACCCAGATCATGTTTGA (+434-454 relative ATG) for actin according to a previously described protocol (17).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Saturation ligand binding analysis of ER protein
The ER can be isolated from the cytosol of target cell extracts as a large nontransformed (i.e. non-DNA binding) 7–8S oligomeric complex, which contains hsp90 and hsp70 (2). It is believed that heat-shock proteins function to help fold the ER protein properly and to protect the hydrophobic hormone binding domain from inappropriate interactions (2). Rabbit reticulocyte lysates contain large amounts of several heat-shock proteins as hsp90 and hsp70, and have been used extensively for the study of ER complex formation with hsps, as well as for the study of requirements for steroid binding and interactions with DNA (2, 6, 11). When ERß protein was synthesized in vitro and labeled with a saturating dose of [3H]-E2 and analyzed on sucrose density gradients, a single peak of specifically bound radioactivity was observed. The sedimentation coefficient of this complex was about 7S, and it shifted to 4S in the presence of 0.4 M NaCl (not shown). It was therefore decided to use human ER{alpha} and rat ERß protein synthesized in reticulocyte lysates for the ligand binding experiments.

To obtain optimal conditions for the determination of equilibrium Kds and RBAs of various ligands, the ER concentration in the binding assay was lowered to 10–20 pM. At these low ER concentrations radioligand and/or competitor depletion can be excluded while maintaining high receptor recovery during separation of bound and unbound ligand by the use of a gel filtration assay instead of the traditional charcoal adsorption assay (12). The low ER concentration made it necessary to employ radioiodinated estradiol as a probe, because the specific radioactivity of tritiated estradiol was too low to maintain sufficient accuracy. Radioiodinated E2 (16{alpha}-[125I]iodo-E2) binds to the ER with high affinity and specificity as shown by its use in dry-mount autoradiographic techniques and various ligand binding assays (19, 20).

In Fig. 2Go the result of a saturation ligand binding assay with [125I]-E2 is shown. Single point assays (not shown) were used to equalize the amount of ER{alpha} and ERß protein used (10–15 pM). The nonspecific binding was <=8% of total binding over the whole radioligand concentration range used. The Kd values calculated from the saturation curves (Fig. 2Go) were 0.06 nM for ER{alpha} protein and 0.24 nM for ERß protein. Linear transformation of saturation data (Scatchard plots in Fig. 2Go) revealed a single population of binding sites for 16{alpha}-iodo-E2 with a Kd of 0.1 nM for the ER{alpha} protein and 0.4 nM for the ERß protein. The measured Kd values are in agreement with the finding that almost maximal stimulation of reporter gene activity by ER{alpha} and ERß protein was previously found during incubation with 1 nM E2 (4). Although the ERß protein has a four times lower affinity for 16{alpha}-iodo-E2 in this system compared with the ER{alpha} protein, both Kd values are within the range (0.1–1 nM) generally reported for estradiol binding to ERs in various systems (1).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Binding of 16{alpha}-[125I]iodo-E2 to in vitro synthesized ER{alpha} and ERß protein in presence or absence of a 300-fold excess of diethylstilbestrol for 16 h at 4 C. Unbound radioactivity was removed as described, and specific bound counts (ER{alpha} = {circ}; ERß = •) were calculated by subtracting nonspecific bound counts from total bound counts. Inset, Scatchard analysis of specific binding giving a Kd of 0.1 nM for ER{alpha} protein and a Kd of 0.4 nM for ERß protein.

 
Ligand binding specificity of ER{alpha} and ERß protein
Measurements of the equilibrium binding of the radioligand in the presence of different concentrations of unlabeled competitors provides readily interpretable information about the affinities of the latter, provided that radioligand and/or competitor depletion are avoided. Competition experiments were performed using ER{alpha} and ERß protein concentrations of 10–15 pM and a [125I]-E2 concentration of about 150 pM, so that for both ERs the total receptor concentration was <=0.1 Kd and the radioligand concentration was >=10 times the ER concentration. Under such experimental conditions radioligand or competitor depletion can be excluded (14).

In total 37 substances were tested for both ER subtypes (Fig. 3Go and Table 1Go). In Fig. 3Go several examples of typical competitor curves obtained are shown. In all cases monophasic curves were obtained for compounds with significant affinity. The slopes of the curves were almost similar, enabling the use of IC50 values to calculate RBA values (Table 1Go), with an RBA value of 100 for E2 for each receptor. For the ER{alpha} as well as ERß protein, the estradiol binding was stereospecific because 17{alpha}-estradiol showed a two times and 10 times lower affinity, respectively (Table 1Go), compared with E2, which is in agreement with previous findings on stereospecific binding of estradiol by the ER (21). However, in making such comparisons, it should be kept in mind that most, if not all, ER ligand binding studies done in the past 30 yr actually involved mixtures of ER{alpha} and ERß protein. This is certainly the case for many studies in which rat uterus cytosol was used (see following). The present study is the first in which the ligand binding properties of both ER subtypes are measured separately, and caution is needed when comparing RBAs from this study with the previous studies involving mixtures of ER subtypes.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Competition by several nonradioactive estrogenic substances and antiestrogens for 16{alpha}-[125I]iodo-E2 binding to in vitro synthesized ER{alpha} protein ({circ}) and ERß protein (•). Incubation was for 16 h at 4 C, and bound and unbound radioligand were separated as described.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Binding affinity of various compounds for ER{alpha} and ERß

 
For the physiological estrogens, the order of competition was E2 > estrone, 17{alpha}-estradiol (ER{alpha}) > estriol > catecholestrogens, 17{alpha}-estradiol (ERß) > estrone-3-sulfate. Overall the ER{alpha} and ERß proteins show the binding characteristics and relative affinity for the physiological estrogens found to be characteristic for an ER protein (1, 8, 22). The stilbene estrogens, which consist of a composite diphenolic ring structure, bind with high affinity to both ER subtypes. However, different orders of competition were found: diethylstilbestrol > hexestrol > dienestrol > (E2) for ER{alpha} and dienestrol > diethylstilbestrol > hexestrol > (E2) for ERß.

The extra methoxy group at C11 and the ethynyl group at C17 of moxestrol (RU 2858) lowered the affinity compared with E2 for the ER{alpha} protein by only a factor of 2 but for the ERß protein by a factor of 20. Moxestrol is in use as a radioligand in ER assays, and is known to have a lower binding affinity than E2 under certain assay conditions (23).

The triphenylethylene (anti)estrogens were developed by successive chemical modifications of the triphenylethylene nucleus, formed by the addition of an extra phenyl ring to the stilbene nucleus as present in for instance diethylstilbestrol (9, 10). Interestingly, the measured order of affinity for the tested triphenylethylene (anti)estrogens was the same for both ER subtypes: 4OH-tamoxifen >> nafoxidine > clomifene > tamoxifen. The steroidal antiestrogen ICI 164384 had a high affinity for ER{alpha} as well as for ERß, confirming that extensions at C7 do not preclude ligand-ER interactions (9, 24).

It has been known for a long time that a number of compounds classified as androgens (C19 steroids) can evoke estrogen-like effects in the female genital tract and in the mammary glands (25). Of all the androgens tested only those with a hydroxyl group at C3 and C17 had significant affinity for both ER subtypes (Table 1Go). The relative flatness of the A-ring with respect to the B-ring is also important, given the clear difference in affinity for both ER subtypes between 5-androstenediol and 4-androstenediol. The binding affinity of 3ß-androstanediol and 5-androstenediol for both ER subtypes is in agreement with previous studies showing specific binding to the rat uterus ER and estrogenic responses in rat uterus and mammary tumors for both steroids (26, 27).

Norethynodrel and norethindrone, progestins derived from 19-nor-testosterone, and 19-nor-testosterone itself have an intrinsic estrogenic potential as shown by the induction of alkaline phosphatase activity in ER-positive human endometrial cancer Ishikawa cells (28). The apparent binding affinity of norethynodrel and norethindrone for both ER subtypes was however, only about 1/500th of that for E2 (Table 1Go), and the need for a conversion into more active metabolites by aromatization or hydroxylation at C-3 has been suggested (28).

Several plant-derived nonsteroidal compounds such as genistein and coumestrol have estrogenic activity (8). These compounds increase rat uterine weight and stimulate growth of breast tumor cells and compete with E2 for binding to ER protein as well as stimulate the activity of reporter genes in the presence of ER protein (Ref. 29 and references therein). Both coumestrol and genistein had a significantly higher affinity for ERß protein (Table 1Go), which is interesting in the light of the high expression of ERß mRNA in the secretory epithelial cells of the prostate, and the prostate cancer protective properties that have been associated with these compounds (30). Zearalanols are fungal metabolites or derivatives thereof that have been associated with estrogenizing syndromes in cattle fed with mold-infected grain (8). Despite the fact that zearalanols are structurally very different to known steroidal and nonsteroidal estrogens, they interact with the rat uterus cytosolic ER (31). Also, in our competition assays ß-zearalanol interacted with both ER subtypes with a similar affinity (Table 1Go), as was reported previously for the rat uterus ER protein (31).

Abnormal sexual development in reptiles as well as the increasing incidence of certain human reproductive tract abnormalities (such as hypospadias) has been associated with increased exposure to and body burdens of so-called estrogenic environmental chemicals (32, 33). These effects from estrogenic chemicals as, for instance, the pesticide methoxychlor and the plastics ingredient bisphenol A, are postulated to be mediated via the ER because these compounds have estrogenic effects (increase of uterine weight) in female rats (8, 32, 33). Bisphenol A and methoxychlor both inhibited the binding of [125I]-E2 by the ER{alpha} and ERß protein, and the inhibition seemed to be stronger for the ERß protein (Table 1Go). However, it was clearly a very low affinity interaction, and the fact cannot be excluded that it involved different sites on the ER than those involved in the binding of E2.

Expression of ER{alpha} and ERß mRNA in rat tissues
To determine the relative distribution of ER{alpha} and ERß mRNA, total RNA was isolated from rat tissues and used for RT-PCR using primers specific for each ER subtype. All tissues were taken from 6- to 8-week-old male rats, except uterus and ovary, which were taken from 8-week-old female rats. Although this assay was only semiquantitative, it is clear that the relative distribution of both ER subtypes was quite different (Fig. 4Go). Highest expression of ERß mRNA was found in the ovary and prostate, which is in agreement with our previous in situ hybridization experiments using male and female rats of similar ages (4). In addition, testis, uterus, bladder, and lung showed moderate expression, whereas pituitary, epididymis, thymus, various brain sections, and spinal cord reveal low expression of ERß mRNA. The ER{alpha} mRNA was highly expressed in epididymis, testis, pituitary, uterus, kidney, and adrenal, which all showed moderate or no expression of ERß mRNA. Aside from weak expression in thalamus/hypothalamus, the brain sections tested were negative for ER{alpha} mRNA. Ovary and uterus, which are known to contain high amounts of ER protein (1), clearly expressed both ER subtypes. All organs from male rats previously described to display specific binding of [3H]-E2 to an 8S cytosolic protein, i.e. liver, lung, adrenal, pituitary, prostate, epididymis, and testis, showed clear expression of either ER subtype mRNA or both (34, 35).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. Rat tissue distribution of ER{alpha} mRNA and ERß mRNA determined by RT-PCR (see Materials and Methods). Autoradiograms are shown of blots after hybridization with oligonucleotide probes specific for ERß (top), ER{alpha} (middle), and actin (bottom). Sn, Substantia nigra, preopticus; Th, thalamus; Hth, hypothalamus; Olfactory L., olfactory lobes; Small Int., small intestine.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ligand binding affinity of ER{alpha} and ERß protein is overall quite similar for the physiological ligands, certainly when only the order of competition is compared. The most interesting difference was found for 17{alpha}-estradiol, which has a five times higher affinity for ER{alpha} protein. The physiological action of 17{alpha}-estradiol is quite different from that of E2, because 17{alpha}-estradiol is a short-acting estrogen and actually a time-dependent mixed agonist-antagonist in the rat/mouse uterus (1). Short-acting estrogens (estrone, estriol, and 17{alpha}-estradiol) do cause nuclear binding of the hormone-receptor complex but only for a short period of time (1). It would be interesting to see whether the difference found for 17{alpha}-estradiol in our ligand binding assays is also present in a transactivation assay system. For the other types of ligands tested, i.e. antiestrogens, androgenic steroids, and phyto-estrogens, there are some interesting differences in the RBAs (Table 1Go), but it remains to be seen whether these differences are also reflected in a transactivation assay system using different cellular backgrounds. The ERß protein clearly displays all the ligand binding characteristics of a classical ER protein (1, 8, 9, 10, 21, 22, 26, 27, 28, 29, 31, 36), and therefore it seems unlikely that a unique physiological ligand for the ERß protein exists. The relative order of ligand binding for various estrogens (diethylstilbestrol, estrone, and estriol) is slightly different in this study than in our previous study (4). Our previous rather preliminary assay (4) was hampered by relatively high levels of nonspecific radioligand binding (30–40% compared with about 5% in this report), which might explain the difference.

A question of considerable interest is why, despite the numerous ligand binding assays performed for the ER protein, an indication for the existence of two ER subtypes was never published. Of course, distinguishing between a mixed population of receptor subtypes and a homogeneous receptor population by saturation or homologous/heterologous competition assays is generally difficult. This is only possible with certainty when the two subtypes differ sufficiently in affinity (10- to 100-fold), and the range of ligand concentrations examined is wide. Furthermore, the proportions of the two subtypes must be appropriate (37). Of all the radioligands used in ER assays (E2, DES, hexestrol, moxestrol, 16{alpha}-iodo-estradiol), the difference in affinity for moxestrol between both ER subtypes is the greatest (8-fold) in our experiments. In this regard, it should be realized that to detect the existence of receptor subtypes the higher affinity subtype should be less abundant than the lower affinity subtype (37). Most ER ligand binding assays have been done with uterus extracts and breast tumor extracts or cell lines, and it could be that the right conditions for the detection of receptor subtypes are not fulfilled in these cases. We have been unable to detect the ERß mRNA in various breast tumor cell lines (MCF-7, T47D, ZR75-1) by RT-PCR (our unpublished observations), whereas both subtypes are expressed in rat (Fig. 4Go) and human uterus (not shown).

In prostate and ovary, the two tissues that express high levels of ERß mRNA, it has been difficult to demonstrate the presence of ERs by immunostaining with the available ER antibodies, although specific binding of E2 could be measured (1, 8, 34). In human and rat prostate at best only weak staining in stromal smooth muscle cells was found (38, 39), which is in contrast with our results showing high expression of ERß mRNA in the prostate secretory epithelial cells (4). In the rat and human ovary, specific binding of estradiol was found in intact follicles and granulosa cells (40, 41), but no ER could be detected with available ER antibodies (41). These discrepancies could be explained by the fact that the most frequently used ER protein antibodies, H-222 and H-226 (42), do not cross-react with rat ERß protein on immunoblots (our unpublished observations). The above findings and our results could indicate that the ERß protein is the predominant if not the only ER subtype present in rat prostate and ovary. Of course this remains to be proven when specific ERß protein antibodies become available. The fact that disruption of the ER{alpha} gene in vivo did not eliminate the ability of small follicles to grow, as is evident from the presence of secondary follicles and antral follicles in the ER{alpha} knockout mouse (43), also argues for the presence of alternative ER (ERß?) molecules. In fact, rat uterus, ovary, testis, epididymis, and pituitary clearly express both ER subtypes mRNAs. Although we have no data on ERß mRNA expression or protein concentration in tissues of the ER{alpha} knock-out mouse (43), the possible presence of ERß protein should be kept in mind when interpreting experiments using the ER{alpha} knock-out mouse. Furthermore, in the uterus of the ER{alpha} knock-out mouse, residual E2 binding could be measured (43), which is likely caused by the presence of ERß protein. In the brain of the ER{alpha} knock-out mouse, specific binding of E2 and modulation of progesterone receptor gene expression by E2 was observed (44). Again this is most likely caused by the presence of ERß protein, because the ERß mRNA is broadly expressed in the rat brain and probably also in the mouse brain at a low level. Detailed mapping of ER{alpha} and ERß expression in rat/mouse brain by in situ hybridization or using specific antibodies for each subtype is of clear interest given the fact that for the localization of ERs in the brain of various species antibodies that do not recognize ERß have been used (45).


    Acknowledgments
 
The authors thank Drs. Margaret Warner and Albert Brinkmann for advice and suggestions and Dr. Geoffry Greene for providing ER antibodies.


    Footnotes
 
1 Supported in part by grants from The Netherlands Organization for Scientific Research (NWO) and from the Karolinska Institute. Back

2 Supported by grants from the Swedish Cancer Society and from the European Union (EU-PL95-1223) Climate and Environment Program. Back

Received September 27, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Clark JH, Schrader WT, O’Malley BW 1992 Mechanisms of action of steroid hormones. In: Wilson J, Foster DW (eds) Textbook of Endocrinology. WB Saunders Company, Philadelphia, pp 35–90
  2. Murdoch FE, Gorski J 1991 The role of ligand in estrogen receptor regulation of gene expression. Mol Cell Endocrinol 78:C103–C108
  3. Koike S, Sakai M, Muramatsu M 1987 Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res 15:2499–2513[Abstract/Free Full Text]
  4. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JÅ 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  5. Katzenellenbogen JA, O’Malley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol Endocrinol 10:119–131[Free Full Text]
  6. Gronemeyer H, Laudet V 1995 Transcription factors 3: nuclear receptors. Protein Profiles 2:1173–1305[Medline]
  7. Seielstad DA, Carlson KE, Kushner PJ, Greene GL, Katzenellenbogen JA 1995 Analysis of the structural core of the human estrogen receptor ligand binding domain by selective proteolysis/mass spectrometric analysis. Biochemistry 34:12605–12615[CrossRef][Medline]
  8. Korach KS, Migliaccio S, Davis VL 1995 Estrogens. In: Munson PL (ed) Principles of Pharmacology. Basic Concepts and Clinical Applications. Chapman and Hall, New York, pp 809–825
  9. Jordan VC 1995 Antiestrogens. In: Munson PL (ed) Principles of Pharmacology. Basic Concepts and Clinical Applications. Chapman and Hall, New York, pp 827–836
  10. Grainger DJ, Metcalfe JC 1996 Tamoxifen: teaching an old drug new tricks? Nature Med 2:381–385[CrossRef][Medline]
  11. Beekman JM, Allan GF, Tsai SY, Tsai M-J, O‘Malley BW 1993 Transcriptional activation by the estrogen receptor requires a conformational change in the ligand binding domain. Mol Endocrinol 7:1266–1272[Abstract/Free Full Text]
  12. Salomonsson M, Carlsson B, Häggblad J 1994 Equilibrium hormone binding to human estrogen receptors in highly diluted cell extracts is non-cooperative and has a Kd of approximately 10 pM. J Steroid Biochem Mol Biol 50:313–318[CrossRef][Medline]
  13. Wells JW 1992 Analysis and interpretation of binding at equilibrium. In: Hulme EC (ed) Receptor Ligand Interactions. A Practical Approach. IRL Press, Oxford UK, pp 289–397
  14. Hulme EC, Birdsall NJM 1992 Strategy and tactics in receptor-binding studies. In: Hulme EC (ed) Receptor Ligand Interactions. A Practical Approach. IRL Press, Oxford UK, pp 163–176
  15. Schults JR, Ruppel PI, Johnson MA 1988 Pharmaceutical lead discovery and optimization. In: Peace KE (ed) Biopharmaceutical Statistics for Drug Development. Marcel Dekker, New York, pp 21–82
  16. Chomczynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  17. Grandien K, Bäckdahl M, Ljunggren Ö, Gustafsson J-Å, Berkenstam A 1995 Estrogen target tissue determines alternative promoter utilization of the human estrogen receptor gene in osteoblasts and tumor cell lines. Endocrinology 136:2223–2229[Abstract]
  18. Grandien KFH, Berkenstam A, Nilsson S, Gustafsson JÅ 1993 Localization of DNase I hypersensitive sites in the human oestrogen receptor gene correlates with the transcriptional activity of two differentially used promoters. J Mol Endocrinol 10:269–277[Abstract/Free Full Text]
  19. Hochberg RB, Rosner W 1980 Interaction of 16{alpha}-[125I]iodo-estradiol with estrogen receptor and other steroid-binding proteins. Proc Natl Acad Sci USA 77:328–332[Abstract/Free Full Text]
  20. Berns EMJJ, Rommerts FGG, Mulder E 1985 Rapid and sensitive detection of oestrogen receptors in cells and tissue sections by autoradiography with [125I]-oestradiol. Histochem J 17:1185–1196[CrossRef][Medline]
  21. Noteboom WD, Gorski J 1965 Stereospecific binding of estrogens in the rat uterus. Arch Biochem Biophys 111:559–568[CrossRef][Medline]
  22. Hähnel R, Twaddle E, Ratajczak T 1973 The specificity of the estrogen receptor of human uterus. J Steroid Biochem 4:21–31[CrossRef][Medline]
  23. Pieslor PC, Gibson RE, Eckelman WC, Oates KK, Cook B, Reba RC 1982 Three radioligands compared for determining cytoplasmic estrogen receptor content of human breast carcinomas. Clin Chem 28:532–537[Abstract/Free Full Text]
  24. Wakeling AE 1996 Physiological effects of pure antiestrogens. In: Katzenellenbogen BS, Pasqualini JR (eds) Hormone-Dependent Cancer. Marcel Dekker, New York, pp 107–118
  25. Huggins CV, Jensen EV, Cleveland AS 1954 Chemical structure of steroids in relation to promotion of growth of the vagina and uterus of the hypophysectomized rat. J Exp Med 100:225–236[Abstract]
  26. Garcia M, Rochefort H 1979 Evidence and characterization of the binding of two 3H-labeled androgens to the estrogen receptor. Endocrinology 104:1797–1804[Abstract/Free Full Text]
  27. van Doorn LG, Poortman J, Thijssen JHH, Schwarz F 1981 Actions and interactions of 5-androstene-3ß,17ß-diol and 17ß-estradiol in the immature rat uterus. Endocrinology 108:1587–1593[Abstract/Free Full Text]
  28. Botella J, Duranti E, Viader V, Duc I, Delansorne R, Paris J 1995 Lack of estrogenic potential of progesterone or 19-Nor-progesterone-derived progestins as opposed to testosterone or 19-Nor-testosterone derivatives on endometrial Ishikawa cells. J Steroid Biochem Mol Biol 55:77–84[CrossRef][Medline]
  29. Mäkelä, S, Davis VL, Tally W, Korkman J, Salo L, Vihko R, Santti R, Korach K 1994 Dietary estrogens act through estrogen receptor-mediated processes and show no antiestrogenicity in cultured breast cancer cells. Environ Health Perspect 102:572–581[Medline]
  30. Adlercreutz H, Markkanen H, Watanabe S 1993 Plasma concentrations of phyto-estrogens in Japanese men. Lancet 342:1209–1210[CrossRef][Medline]
  31. Katzenellenbogen BS, Katzenellenbogen J, Mordecai D 1979 Zearalenones: characterization of the estrogenic potenties and receptor interactions of a series of fungal ß-resorcylic acid lactones. Endocrinology 105:33–40[Abstract/Free Full Text]
  32. Kelce WR, Stone CR, Laws SC, Gray LE, Kemppainen JA, Wilson EM 1995 Persistent DDT metabolite p,p'-DDE is a potent androgen receptor antagonist. Nature 375:581–585[CrossRef][Medline]
  33. Arnold SF, Klotz DM, Collins BM, Vonier PM, Guilette LJ, McLachlan JA 1996 Synergistic activation of estrogen receptor with combinations of environmental chemicals. Science 272:1489–1492[Abstract]
  34. van Beurden-Lamers WMO, Brinkmann AO, Mulder E, van der Molen HJ 1974 High-affinity binding of oestradiol-17ß by cytosols from testis interstitial tissue, pituitary, adrenal, liver and accessory sex glands of the male rat. Biochem J 140:495–502[Medline]
  35. Morishige WK, Uetake C-A 1978 Receptors for androgen and estrogen in the rat lung. Endocrinology 102:1827–1836[Abstract/Free Full Text]
  36. Notides AC 1970 Binding affinity and specificity of the estrogen receptor of the rat uterus and anterior pituitary. Endocrinology 87:987–992[Abstract/Free Full Text]
  37. Swillens S, Waelbroeck M, Champeil P 1995 Does a radiolabelled ligand bind to a homogeneous population of non-interacting receptor sites? Trends Pharmaceutical Sci 16:151–155
  38. Prins GS, Birch L 1995 The developmental pattern of androgen receptor expression in rat prostate lobes is altered after neonatal exposure to estrogen. Endocrinology 136:1303–1314[Abstract]
  39. Brolin J, Skoog L, Ekman P 1992 Immunohistochemistry and biochemistry in detection of androgen, progesterone and estrogen receptors in benign and malignant human prostatic tissues. Prostate 20:281–295[Medline]
  40. Kudolo GB, Elder MG, Myatt L 1984 A novel oestrogen-binding species in rat granulosa cells. J Endocrinol 102:83–91[Abstract/Free Full Text]
  41. Hild-Petito S, Stouffer RL, Brenner RM 1988 Immuno-cytochemical localization of estradiol and progesterone receptors in the monkey ovary throughout the menstrual cycle. Endocrinology 123:2896–2904[Abstract/Free Full Text]
  42. Greene GL, Jensen EV 1982 Monoclonal antibodies as probes for estrogen receptor detection and characterization. J Steroid Biochem 16:353–359[CrossRef][Medline]
  43. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166[Abstract/Free Full Text]
  44. Merchenthaler I, Shughrue PJ, Lubahn DB, Negro-Vilar A, Korach KS 1996 Estrogen responses in estrogen receptor-disrupted mice: an in vivo autoradiographic and in situ hybridization study. Program of the 10th International Congress of Endocrinology, San Francisco, CA, 1996, p 744 (Abstract)
  45. Blaustein JD 1992 Cytoplasmic estrogen receptor in rat brain: immunocytochemical evidence using three antibodies with distinct epitopes. Endocrinology 131:1336–1342[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
X. Sun, L. Jackson, S. K. Dey, and T. Daikoku
In Pursuit of Leucine-Rich Repeat-Containing G Protein-Coupled Receptor-5 Regulation and Function in the Uterus
Endocrinology, November 1, 2009; 150(11): 5065 - 5073.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Kim, T. Nakajima, S. Hayashi, P. Chambon, H. Watanabe, T. Iguchi, and T. Sato
Effects of Diethylstilbestrol on Programmed Oocyte Death and Induction of Polyovular Follicles in Neonatal Mouse Ovaries
Biol Reprod, November 1, 2009; 81(5): 1002 - 1009.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
F. O'Mahony, W. Thomas, and B. J. Harvey
Novel female sex-dependent actions of oestrogen in the intestine
J. Physiol., November 1, 2009; 587(21): 5039 - 5044.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. R. Stiles, J. G. McDonald, D. R. Bauman, and D. W. Russell
CYP7B1: One Cytochrome P450, Two Human Genetic Diseases, and Multiple Physiological Functions
J. Biol. Chem., October 16, 2009; 284(42): 28485 - 28489.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
H. Chen, K. Yang, S. Choi, J. H. Fischer, and H. Jeong
Up-Regulation of UDP-Glucuronosyltransferase (UGT) 1A4 by 17{beta}-Estradiol: A Potential Mechanism of Increased Lamotrigine Elimination in Pregnancy
Drug Metab. Dispos., September 1, 2009; 37(9): 1841 - 1847.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. Comitato, K. Nesaretnam, G. Leoni, R. Ambra, R. Canali, A. Bolli, M. Marino, and F. Virgili
A novel mechanism of natural vitamin E tocotrienol activity: involvement of ER{beta} signal transduction
Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E427 - E437.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. Singhal, K. Shankar, T. M Badger, and M. J Ronis
Hepatic gene expression following consumption of soy protein isolate in female Sprague-Dawley rats differs from that produced by 17{beta}-estradiol treatment
J. Endocrinol., July 1, 2009; 202(1): 141 - 152.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
L. Hooper, J.J. Ryder, M.S. Kurzer, J.W. Lampe, M.J. Messina, W.R. Phipps, and A. Cassidy
Effects of soy protein and isoflavones on circulating hormone concentrations in pre- and post-menopausal women: a systematic review and meta-analysis
Hum. Reprod. Update, July 1, 2009; 15(4): 423 - 440.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
K. L. Porter, G. Shetty, G. A. Shuttlesworth, C. C. Y. Weng, I. Huhtaniemi, P. Pakarinen, and M. L. Meistrich
Estrogen Enhances Recovery From Radiation-Induced Spermatogonial Arrest in Rat Testes
J Androl, July 1, 2009; 30(4): 440 - 451.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Shao, M. Nutu, L. Karlsson-Lindahl, A. Benrick, B. Weijdegard, S. Lager, E. Egecioglu, J. Fernandez-Rodriguez, K. Gemzell-Danielsson, C. Ohlsson, et al.
Downregulation of cilia-localized Il-6R{alpha} by 17{beta}-estradiol in mouse and human fallopian tubes
Am J Physiol Cell Physiol, July 1, 2009; 297(1): C140 - C151.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Yang, S. Hu, J. Chen, M. A. Choudhry, L. W. Rue III, K. I. Bland, and I. H. Chaudry
Mechanism of hepatoprotection in proestrus female rats following trauma-hemorrhage: heme oxygenase-1-derived normalization of hepatic inflammatory responses
J. Leukoc. Biol., June 1, 2009; 85(6): 1015 - 1026.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. M. Boue, S. L. Tilghman, S. Elliott, M. C. Zimmerman, K. Y. Williams, F. Payton-Stewart, A. P. Miraflor, M. H. Howell, B. Y. Shih, C. H. Carter-Wientjes, et al.
Identification of the Potent Phytoestrogen Glycinol in Elicited Soybean (Glycine max)
Endocrinology, May 1, 2009; 150(5): 2446 - 2453.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
M. Messina and A. H Wu
Perspectives on the soy-breast cancer relation
Am. J. Clinical Nutrition, May 1, 2009; 89(5): 1673S - 1679S.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
E. Sonestedt, M. I. L. Ivarsson, S. Harlid, U. Ericson, B. Gullberg, J. Carlson, H. Olsson, H. Adlercreutz, and E. Wirfalt
The Protective Association of High Plasma Enterolactone with Breast Cancer Is Reasonably Robust in Women with Polymorphisms in the Estrogen Receptor {alpha} and {beta} Genes
J. Nutr., May 1, 2009; 139(5): 993 - 1001.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Keay and J. W. Thornton
Hormone-Activated Estrogen Receptors in Annelid Invertebrates: Implications for Evolution and Endocrine Disruption
Endocrinology, April 1, 2009; 150(4): 1731 - 1738.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Trukhacheva, Z. Lin, S. Reierstad, Y.-H. Cheng, M. Milad, and S. E. Bulun
Estrogen Receptor (ER) {beta} Regulates ER{alpha} Expression in Stromal Cells Derived from Ovarian Endometriosis
J. Clin. Endocrinol. Metab., February 1, 2009; 94(2): 615 - 622.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
V. Ajdzanovic, B. Sosic-Jurjevic, B. Filipovic, S. Trifunovic, M. Manojlovic-Stojanoski, M. Sekulic, and V. Milosevic
Genistein-Induced Histomorphometric and Hormone Secreting Changes in the Adrenal Cortex in Middle-Aged Rats
Experimental Biology and Medicine, February 1, 2009; 234(2): 148 - 156.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Su and R. C.M. Simmen
Soy isoflavone genistein upregulates epithelial adhesion molecule E-cadherin expression and attenuates {beta}-catenin signaling in mammary epithelial cells
Carcinogenesis, February 1, 2009; 30(2): 331 - 339.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Sato, T. Suzuki, Y. Katayose, K. Miura, K. Shiiba, H. Tateno, Y. Miki, J. Akahira, Y. Kamogawa, S. Nagasaki, et al.
Steroid Sulfatase and Estrogen Sulfotransferase in Colon Carcinoma: Regulators of Intratumoral Estrogen Concentrations and Potent Prognostic Factors
Cancer Res., February 1, 2009; 69(3): 914 - 922.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
M. S. Driscoll and J. M. Grant-Kels
Estrogen Receptor Expression in Cutaneous Melanoma
Arch Dermatol, January 1, 2009; 145(1): 73 - 75.
[Full Text] [PDF]


Home page
EndocrinologyHome page
M. Chen, I. Hsu, A. Wolfe, S. Radovick, K. Huang, S. Yu, C. Chang, E. M. Messing, and S. Yeh
Defects of Prostate Development and Reproductive System in the Estrogen Receptor-{alpha} Null Male Mice
Endocrinology, January 1, 2009; 150(1): 251 - 259.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Weiss, M. L. Bernhardt, M. M. Laronda, L. A. Hurley, C. Glidewell-Kenney, S. Pillai, M. Tong, K. S. Korach, and J. L. Jameson
Estrogen Actions in the Male Reproductive System Involve Estrogen Response Element-Independent Pathways
Endocrinology, December 1, 2008; 149(12): 6198 - 6206.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
J. M. Weiss, J. V. Lacey Jr., X.-O. Shu, B.-T. Ji, L. Hou, G. Yang, H. Li, N. Rothman, A. Blair, Y.-T. Gao, et al.
Menstrual and Reproductive Factors in Association With Lung Cancer in Female Lifetime Nonsmokers
Am. J. Epidemiol., December 1, 2008; 168(11): 1319 - 1325.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L Lundholm, G Bryzgalova, H Gao, N Portwood, S Falt, K D Berndt, A Dicker, D Galuska, J R Zierath, J-A Gustafsson, et al.
The estrogen receptor {alpha}-selective agonist propyl pyrazole triol improves glucose tolerance in ob/ob mice; potential molecular mechanisms
J. Endocrinol., November 1, 2008; 199(2): 275 - 286.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Jiang, N. M. Patterson, Y. Ling, J. Xie, W. G. Helferich, and D. J. Shapiro
Low Concentrations of the Soy Phytoestrogen Genistein Induce Proteinase Inhibitor 9 and Block Killing of Breast Cancer Cells by Immune Cells
Endocrinology, November 1, 2008; 149(11): 5366 - 5373.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
S. S. Shirke, S. R. Jadhav, and A. G. Jagtap
Methanolic Extract of Cuminum cyminum Inhibits Ovariectomy-Induced Bone Loss in Rats
Experimental Biology and Medicine, November 1, 2008; 233(11): 1403 - 1410.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z. F. Ba and I. H. Chaudry
Role of estrogen receptor subtypes in estrogen-induced organ-specific vasorelaxation after trauma-hemorrhage
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H2061 - H2067.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. A. Molenda-Figueira, S. D. Murphy, K. L. Shea, N. K. Siegal, Y. Zhao, J. G. Chadwick Jr., L. A. Denner, and M. J. Tetel
Steroid Receptor Coactivator-1 from Brain Physically Interacts Differentially with Steroid Receptor Subtypes
Endocrinology, October 1, 2008; 149(10): 5272 - 5279.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. R. Bhavnani, S.-P. Tam, and X. Lu
Structure Activity Relationships and Differential Interactions and Functional Activity of Various Equine Estrogens Mediated via Estrogen Receptors (ERs) ER{alpha} and ER{beta}
Endocrinology, October 1, 2008; 149(10): 4857 - 4870.
[Abstract] [Full Text] [PDF]


Home page
Evid Based Complement Alternat MedHome page
K.-M. Suzuki, Y. Isohama, H. Maruyama, Y. Yamada, Y. Narita, S. Ohta, Y. Araki, T. Miyata, and S. Mishima
Estrogenic Activities of Fatty Acids and a Sterol Isolated from Royal Jelly
Evid. Based Complement. Altern. Med., September 1, 2008; 5(3): 295 - 302.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Ikeda, H. Tanaka, and M. Esaki
Effects of Gestational Diethylstilbestrol Treatment on Male and Female Gonads during Early Embryonic Development
Endocrinology, August 1, 2008; 149(8): 3970 - 3979.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
R. Raju and I. H. Chaudry
Sex Steroids/Receptor Antagonist: Their Use as Adjuncts After Trauma-Hemorrhage for Improving Immune/Cardiovascular Responses and for Decreasing Mortality from Subsequent Sepsis
Anesth. Analg., July 1, 2008; 107(1): 159 - 166.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J.-Y. Deng, P.-S. Hsieh, J.-P. Huang, L.-S. Lu, and L.-M. Hung
Activation of Estrogen Receptor Is Crucial for Resveratrol-Stimulating Muscular Glucose Uptake via Both Insulin-Dependent and -Independent Pathways
Diabetes, July 1, 2008; 57(7): 1814 - 1823.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
P. de Cremoux, D. Rosenberg, J. Goussard, C. Bremont-Weil, F. Tissier, C. Tran-Perennou, L. Groussin, X. Bertagna, J. Bertherat, and M.-L. Raffin-Sanson
Expression of progesterone and estradiol receptors in normal adrenal cortex, adrenocortical tumors, and primary pigmented nodular adrenocortical disease
Endocr. Relat. Cancer, June 1, 2008; 15(2): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
Z. Hammoud, B. Tan, S. Badve, and R. M Bigsby
Estrogen promotes tumor progression in a genetically defined mouse model of lung adenocarcinoma
Endocr. Relat. Cancer, June 1, 2008; 15(2): 475 - 483.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Wahlgren, K. Svechnikov, M.-L. Strand, K. Jahnukainen, M. Parvinen, J.-A. Gustafsson, and O. Soder
Estrogen Receptor {beta} Selective Ligand 5{alpha}-Androstane-3{beta}, 17{beta}-Diol Stimulates Spermatogonial Deoxyribonucleic Acid Synthesis in Rat Seminiferous Epithelium in Vitro
Endocrinology, June 1, 2008; 149(6): 2917 - 2922.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
T. K. Nayak, H. J. Hathaway, C. Ramesh, J. B. Arterburn, D. Dai, L. A. Sklar, J. P. Norenberg, and E. R. Prossnitz
Preclinical Development of a Neutral, Estrogen Receptor-Targeted, Tridentate 99mTc(I)-Estradiol-Pyridin-2-yl Hydrazine Derivative for Imaging of Breast and Endometrial Cancers
J. Nucl. Med., June 1, 2008; 49(6): 978 - 986.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
D. Asai, T. Tokunaga, K. Kondo, T. Kawaguchi, S. Takayanagi, T. Shinmyozu, M. Nakai, Y. Yakabe, and Y. Shimohigashi
Direct Measure of Fluorescence Intensity for Efficient Receptor-binding Assay: Conjugates of Ethinylcarboxyestradiol and 5(and 6)-Carboxyfluorescein via {alpha},{omega}-Diaminoalkanes as a Tracer for Estrogen Receptor
J. Biochem., June 1, 2008; 143(6): 781 - 792.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen
Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding
Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. A. Rasbach and R. G. Schnellmann
Isoflavones Promote Mitochondrial Biogenesis
J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 536 - 543.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Grossini, C. Molinari, D. A. S. G. Mary, F. Uberti, P. P. Caimmi, N. Surico, and G. Vacca
Intracoronary Genistein Acutely Increases Coronary Blood Flow in Anesthetized Pigs through {beta}-Adrenergic Mediated Nitric Oxide Release and Estrogenic Receptors
Endocrinology, May 1, 2008; 149(5): 2678 - 2687.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. R. Cederroth, M. Vinciguerra, A. Gjinovci, F. Kuhne, M. Klein, M. Cederroth, D. Caille, M. Suter, D. Neumann, R. W. James, et al.
Dietary Phytoestrogens Activate AMP-Activated Protein Kinase With Improvement in Lipid and Glucose Metabolism
Diabetes, May 1, 2008; 57(5): 1176 - 1185.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Dip, S. Lenz, J.-P. Antignac, B. Le Bizec, H. Gmuender, and H. Naegeli
Global gene expression profiles induced by phytoestrogens in human breast cancer cells
Endocr. Relat. Cancer, March 1, 2008; 15(1): 161 - 173.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. A. Mattingly, M. M. Ivanova, K. A. Riggs, N. S. Wickramasinghe, M. J. Barch, and C. M. Klinge
Estradiol Stimulates Transcription of Nuclear Respiratory Factor-1 and Increases Mitochondrial Biogenesis
Mol. Endocrinol., March 1, 2008; 22(3): 609 - 622.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. L. Sperry and J. P. Minei
Gender dimorphism following injury: making the connection from bench to bedside
J. Leukoc. Biol., March 1, 2008; 83(3): 499 - 506.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K.A. Walters, C.M. Allan, and D.J. Handelsman
Androgen Actions and the Ovary
Biol Reprod, March 1, 2008; 78(3): 380 - 389.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H. Buteau-Lozano, G. Velasco, M. Cristofari, P. Balaguer, and M. Perrot-Applanat
Xenoestrogens modulate vascular endothelial growth factor secretion in breast cancer cells through an estrogen receptor-dependent mechanism
J. Endocrinol., February 1, 2008; 196(2): 399 - 412.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. Mardon, J. Mathey, S. Kati-Coulibaly, C. Puel, M.-J. Davicco, P. Lebecque, M.-N. Horcajada, and V. Coxam
Influence of Lifelong Soy Isoflavones Consumption on Bone Mass in the Rat
Experimental Biology and Medicine, February 1, 2008; 233(2): 229 - 237.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Levy, D. Tatomer, C. B. Herber, X. Zhao, H. Tang, T. Sargeant, L. J. Ball, J. Summers, T. P. Speed, and D. C. Leitman
Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene
Mol. Endocrinol., February 1, 2008; 22(2): 287 - 303.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. D. DuSell, M. Umetani, P. W. Shaul, D. J. Mangelsdorf, and D. P. McDonnell
27-Hydroxycholesterol Is an Endogenous Selective Estrogen Receptor Modulator
Mol. Endocrinol., January 1, 2008; 22(1): 65 - 77.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Damdimopoulos, G. Spyrou, and J.-A. Gustafsson
Ligands Differentially Modify the Nuclear Mobility of Estrogen Receptors {alpha} and
Endocrinology, January 1, 2008; 149(1): 339 - 345.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Cvoro, D. Tatomer, M.-K. Tee, T. Zogovic, H. A. Harris, and D. C. Leitman
Selective Estrogen Receptor- Agonists Repress Transcription of Proinflammatory Genes
J. Immunol., January 1, 2008; 180(1): 630 - 636.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. G. Schwartz, A. S. Wenzlaff, G. M. Prysak, V. Murphy, M. L. Cote, S. C. Brooks, D. F. Skafar, and F. Lonardo
Reproductive Factors, Hormone Use, Estrogen Receptor Expression and Risk of Non Small-Cell Lung Cancer in Women
J. Clin. Oncol., December 20, 2007; 25(36): 5785 - 5792.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E. B Alabraba, P. Taniere, G. M Reynolds, P. M Stewart, S. J Wigmore, and S. R Bramhall
Expression and functional consequences of oestrogen and progesterone receptors in human insulinomas
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1081 - 1088.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P.-A. Scott, A. Tremblay, M. Brochu, and J. St-Louis
Vasorelaxant action of 17 -estradiol in rat uterine arteries: role of nitric oxide synthases and estrogen receptors
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3713 - H3719.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Sun, Z. Nawaz, and J. M. Slingerland
Long-Range Activation of GREB1 by Estrogen Receptor via Three Distal Consensus Estrogen-Responsive Elements in Breast Cancer Cells
Mol. Endocrinol., November 1, 2007; 21(11): 2651 - 2662.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. M. Cho, N. Peng, J. T. Clark, L. Novak, S. Roysommuti, J. Prasain, and J. M. Wyss
Genistein Attenuates the Hypertensive Effects of Dietary NaCl in Hypertensive Male Rats
Endocrinology, November 1, 2007; 148(11): 5396 - 5402.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Y.-C. Chen, P. Kraft, P. Bretsky, S. Ketkar, D. J. Hunter, D. Albanes, D. Altshuler, G. Andriole, C. D. Berg, H. Boeing, et al.
Sequence Variants of Estrogen Receptor {beta} and Risk of Prostate Cancer in the National Cancer Institute Breast and Prostate Cancer Cohort Consortium
Cancer Epidemiol. Biomarkers Prev., October 1, 2007; 16(10): 1973 - 1981.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. M. Tammemagi, M. T. Freedman, T. R. Church, M. M. Oken, W. G. Hocking, P. A. Kvale, P. Hu, T. L. Riley, L. R. Ragard, P. C. Prorok, et al.
Factors Associated with Human Small Aggressive Non Small Cell Lung Cancer
Cancer Epidemiol. Biomarkers Prev., October 1, 2007; 16(10): 2082 - 2089.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
C. A Pearl, E. At-Taras, T. Berger, and J. F Roser
Reduced endogenous estrogen delays epididymal development but has no effect on efferent duct morphology in boars
Reproduction, October 1, 2007; 134(4): 593 - 604.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Wang, E. R. Prossnitz, and S. K. Roy
Expression of G Protein-Coupled Receptor 30 in the Hamster Ovary: Differential Regulation by Gonadotropins and Steroid Hormones
Endocrinology, October 1, 2007; 148(10): 4853 - 4864.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Q. Xue, Z. Lin, Y.-H. Cheng, C.-C. Huang, E. Marsh, P. Yin, M. P Milad, E. Confino, S. Reierstad, J. Innes, et al.
Promoter Methylation Regulates Estrogen Receptor 2 in Human Endometrium and Endometriosis
Biol Reprod, October 1, 2007; 77(4): 681 - 687.
[Abstract] [Full Text] [PDF]


Home page
International Journal of ToxicologyHome page
R. A. Ansari and J. Gandy
Determining the Transrepression Activity of Xenoestrogen on Nuclear Factor-{kappa}B in Cos-1 Cells by Estrogen Receptor-{alpha}
International Journal of Toxicology, September 1, 2007; 26(5): 441 - 449.
[Abstract] [Full Text] [PDF]


Home page
CA Cancer J ClinHome page
C. Duffy, K. Perez, and A. Partridge
Implications of Phytoestrogen Intake for Breast Cancer
CA Cancer J Clin, September 1, 2007; 57(5): 260 - 277.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. T. Akingbemi, T. D. Braden, B. W. Kemppainen, K. D. Hancock, J. D. Sherrill, S. J. Cook, X. He, and J. G. Supko
Exposure to Phytoestrogens in the Perinatal Period Affects Androgen Secretion by Testicular Leydig Cells in the Adult Rat
Endocrinology, September 1, 2007; 148(9): 4475 - 4488.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, K. I. Bland, and I. H. Chaudry
Estrogen receptor-{alpha} predominantly mediates the salutary effects of 17beta-estradiol on splenic macrophages following trauma-hemorrhage
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C978 - C984.
[Abstract] [Full Text] [PDF]


Home page
The Annals of PharmacotherapyHome page
A. A Grippo, K. Capps, B. Rougeau, and B. J Gurley
Analysis of Flavonoid Phytoestrogens in Botanical and Ephedra-Containing Dietary Supplements
Ann. Pharmacother., September 1, 2007; 41(9): 1375 - 1382.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Drummond, M. Tellbach, M. Dyson, and J. K. Findlay
Fibroblast Growth Factor-9, a Local Regulator of Ovarian Function
Endocrinology, August 1, 2007; 148(8): 3711 - 3721.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
V. H. Dang, T. H. Nguyen, K.-C. Choi, and E.-B. Jeung
A Calcium-Binding Protein, Calbindin-D9k, Is Regulated through an Estrogen-Receptor Mediated Mechanism following Xenoestrogen Exposure in the GH3 Cell Line
Toxicol. Sci., August 1, 2007; 98(2): 408 - 415.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. Arreguin-Arevalo, T. L. Davis, and T. M. Nett
Differential Modulation of Gonadotropin Secretion by Selective Estrogen Receptor 1 and Estrogen Receptor 2 Agonists in Ovariectomized Ewes
Biol Reprod, August 1, 2007; 77(2): 320 - 328.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. E. Mann, D. J. Rowlands, F. Y.L. Li, P. de Winter, and R. C.M. Siow
Activation of endothelial nitric oxide synthase by dietary isoflavones: Role of NO in Nrf2-mediated antioxidant gene expression
Cardiovasc Res, July 15, 2007; 75(2): 261 - 274.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartman, M. Tujague, A. Strom, E. Treuter, M. Warner, et al.
Estrogen Receptors: How Do They Signal and What Are Their Targets
Physiol Rev, July 1, 2007; 87(3): 905 - 931.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. R. Pak, W. C. J. Chung, L. R. Hinds, and R. J. Handa
Estrogen Receptor-{beta} Mediates Dihydrotestosterone-Induced Stimulation of the Arginine Vasopressin Promoter in Neuronal Cells
Endocrinology, July 1, 2007; 148(7): 3371 - 3382.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, and I. H. Chaudry
Salutary effects of 17beta-estradiol on T-cell signaling and cytokine production after trauma-hemorrhage are mediated primarily via estrogen receptor-{alpha}
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2103 - C2111.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
L. Li, M. E Andersen, S. Heber, and Q. Zhang
Non-monotonic dose-response relationship in steroid hormone receptor-mediated gene expression
J. Mol. Endocrinol., May 1, 2007; 38(5): 569 - 585.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. Kipp, S. M. Kilen, S. Bristol-Gould, T. K. Woodruff, and K. E. Mayo
Neonatal Exposure to Estrogens Suppresses Activin Expression and Signaling in the Mouse Ovary
Endocrinology, May 1, 2007; 148(5): 1968 - 1976.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. C Garrido-Gracia, A. Gordon, C. Bellido, R. Aguilar, I. Barranco, Y. Millan, J. M. de las Mulas, and J. E Sanchez-Criado
The integrated action of oestrogen receptor isoforms and sites with progesterone receptor in the gonadotrope modulates LH secretion: evidence from tamoxifen-treated ovariectomized rats
J. Endocrinol., April 1, 2007; 193(1): 107 - 119.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
G.-E. Costin and V. J. Hearing
Human skin pigmentation: melanocytes modulate skin color in response to stress
FASEB J, April 1, 2007; 21(4): 976 - 994.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y.-C. Hsieh, H.-P. Yu, M. Frink, T. Suzuki, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry
G Protein-Coupled Receptor 30-Dependent Protein Kinase A Pathway Is Critical in Nongenomic Effects of Estrogen in Attenuating Liver Injury after Trauma-Hemorrhage
Am. J. Pathol., April 1, 2007; 170(4): 1210 - 1218.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. K. Gruvberger-Saal, P.-O. Bendahl, L. H. Saal, M. Laakso, C. Hegardt, P. Eden, C. Peterson, P. Malmstrom, J. Isola, A. Borg, et al.
Estrogen Receptor {beta} Expression Is Associated with Tamoxifen Response in ER{alpha}-Negative Breast Carcinoma
Clin. Cancer Res., April 1, 2007; 13(7): 1987 - 1994.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Corbacho, J. P. Eiserich, L. A. Zuniga, G. Valacchi, and A. C. Villablanca
Compromised Aortic Vasoreactivity in Male Estrogen Receptor-{alpha}-Deficient Mice during Acute Lipopolysaccharide-Induced Inflammation
Endocrinology, March 1, 2007; 148(3): 1403 - 1411.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. L. Quinn, J. M. Regan, J. M. Tobin, B. J. Marinik, J. M. McMahon, D. A. McNett, C. M. Sushynski, S. D. Crofoot, P. A. Jean, and K. P. Plotzke
In Vitro and In Vivo Evaluation of the Estrogenic, Androgenic, and Progestagenic Potential of Two Cyclic Siloxanes
Toxicol. Sci., March 1, 2007; 96(1): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
P. Moroni, G. Pisoni, G. Savoini, E. van Lier, S. Acuna, J. P. Damian, and A. Meikle
Influence of Estrus of Dairy Goats on Somatic Cell Count, Milk Traits, and Sex Steroid Receptors in the Mammary Gland
J Dairy Sci, February 1, 2007; 90(2): 790 - 797.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. A. Carey, J. W. Card, J. A. Bradbury, M. P. Moorman, N. Haykal-Coates, S. H. Gavett, J. P. Graves, V. R. Walker, G. P. Flake, J. W. Voltz, et al.
Spontaneous Airway Hyperresponsiveness in Estrogen Receptor-{alpha}-deficient Mice
Am. J. Respir. Crit. Care Med., January 15, 2007; 175(2): 126 - 135.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. A. Harris
Estrogen Receptor-{beta}: Recent Lessons from in Vivo Studies
Mol. Endocrinol., January 1, 2007; 21(1): 1 - 13.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. Huang, F. Shi, T. Lei, Y. Song, C. L. Hughes, and G. Liu
Effect of the Isoflavone Genistein Against Galactose-Induced Cataracts in Rats
Experimental Biology and Medicine, January 1, 2007; 232(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. Assinder, R. Davis, M. Fenwick, and A. Glover
Adult-only exposure of male rats to a diet of high phytoestrogen content increases apoptosis of meiotic and post-meiotic germ cells
Reproduction, January 1, 2007; 133(1): 11 - 19.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
T. Suzuki, T. Shimizu, H.-P. Yu, Y.-C. Hsieh, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry
Tissue compartment-specific role of estrogen receptor subtypes in immune cell cytokine production following trauma-hemorrhage
J Appl Physiol, January 1, 2007; 102(1): 163 - 168.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z. F. Ba, A. Lu, T. Shimizu, L. Szalay, M. G. Schwacha, L. W. Rue III, K. I. Bland, and I. H. Chaudry
17beta-Estradiol modulates vasoconstriction induced by endothelin-1 following trauma-hemorrhage
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H245 - H250.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Fan, M. Warner, and J.-A. Gustafsson
Estrogen receptor beta expression in the embryonic brain regulates development of calretinin-immunoreactive GABAergic interneurons
PNAS, December 19, 2006; 103(51): 19338 - 19343.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S. Rice and S. A Whitehead
Phytoestrogens and breast cancer -promoters or protectors?
Endocr. Relat. Cancer, December 1, 2006; 13(4): 995 - 1015.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Coll. Nutr.Home page
H. J. Teede, D. Giannopoulos, F. S. Dalais, J. Hodgson, and B. P. McGrath
Randomised, Controlled, Cross-Over Trial of Soy Protein with Isoflavones on Blood Pressure and Arterial Function in Hypertensive Subjects
J. Am. Coll. Nutr., December 1, 2006; 25(6): 533 - 540.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
K. Dahlman-Wright, V. Cavailles, S. A. Fuqua, V. C. Jordan, J. A. Katzenellenbogen, K. S. Korach, A. Maggi, M. Muramatsu, M. G. Parker, and J.-A. Gustafsson
International Union of Pharmacology. LXIV. Estrogen Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 773 - 781.
[Full Text] [PDF]


Home page
Poult. Sci.Home page
K. W. Wilhelms, C. G. Scanes, and L. L. Anderson
Lack of estrogenic or antiestrogenic actions of soy isoflavones in an avian model: the Japanese quail.
Poult. Sci., November 1, 2006; 85(11): 1885 - 1889.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Lindzey, F. L Jayes, M. M Yates, J. F Couse, and K. S Korach
The bi-modal effects of estradiol on gonadotropin synthesis and secretion in female mice are dependent on estrogen receptor-{alpha}.
J. Endocrinol., October 1, 2006; 191(1): 309 - 317.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
G. Delbes, C. Levacher, and R. Habert
Estrogen effects on fetal and neonatal testicular development.
Reproduction, October 1, 2006; 132(4): 527 - 538.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Messina, W. McCaskill-Stevens, and J. W. Lampe
Addressing the soy and breast cancer relationship: review, commentary, and workshop proceedings.
J Natl Cancer Inst, September 20, 2006; 98(18): 1275 - 1284.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Gustafsson, J.-A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals