| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Obstetrics and Gynecology (I.G.A., C-H.J.P., A.H.P.), Reproductive Sciences Program (I.G.A., C-H.J.P., A.H.P.), Department of Biological Chemistry (A.H.P.), and Department of Pediatrics (J.Z.K-V.), The University of Michigan, Ann Arbor, Michigan 48109; Division of Reproductive Biology, Department of Gynecology and Obstetrics, Stanford University Medical Center (I.G.A., A.H.P.), Stanford, California 94305; and Department of Biological Chemistry, Institute of Life Sciences, The Hebrew University of Jerusalem (J.A., J.O.), Jerusalem 91904, Israel
Address all correspondence and requests for reprints to: Anita H. Payne, Division of Reproductive Biology, Department of Gynecology and Obstetrics, Stanford University Medical Center, 300 Pasteur Drive, Stanford, California 94305.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
0.035 µM) and dehydroepiandrosterone (0.12
µM). 3ß-HSD VI is the earliest isoform to be expressed
during embryogenesis in cells of embryonic origin at 7 and 9.5 days
postcoitum (pc), and is the major isoform expressed in uterine tissue
at the time of implantation (4.5 days pc) and continues to be expressed
in uterine tissue at 6.5, 7.5, and 9.5 days pc. 3ß-HSD VI is
expressed in giant trophoblasts at 9.5 days pc and is expressed in the
placenta through day 15.5 pc. In the adult mouse, 3ß-HSD VI appears
to be the only isoform expressed in the skin and also is expressed in
the testis, but to a lesser extent than 3ß-HSD I. Mouse 3ß-HSD VI
cDNA is orthologous to human 3ß-HSD I cDNA. Human type I 3ß-HSD has
been shown to be the only isoform expressed in the placenta and skin.
The demonstration that mouse 3ß-HSD VI functions as a
dehydrogenase/isomerase and is the predominant isoform expressed during
the first half of pregnancy in uterine tissue and in embryonic cells
suggests that this isoform may be involved in local production of
progesterone, which is needed for successful implantation of the
blastocyst and/or maintenance of early pregnancy. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5-3ß-hydroxysteroids to
4-3-ketosteroids, a reaction that is essential for the
biosynthesis of all active steroid hormones, including the adrenal
steroid hormones, cortisol, corticosterone, and aldosterone, as well as
the gonadal steroid hormones progesterone, testosterone, and
estradiol. Recent reports have provided evidence for the expression of multiple isoforms in humans (1, 2, 3) and rodents (4, 5, 6, 7). For a classification of the human, mouse, and rat isoforms see Clarke et al. (8). These isoforms are products of distinct genes and are expressed in a tissue-specific manner. Our laboratory has studied the isoforms expressed in the mouse. To date, we have isolated and characterized five distinct but highly homologous mouse 3ß-HSD complementary DNAs (cDNAs), which are indicated by roman numerals (I-V) in the chronological order in which they have been isolated. The genes encoding the different isoforms are found closely linked on mouse chromosome 3 (9). The five isoforms not only are expressed in a tissue-specific manner, but also fall into two distinct functional groups. One group, as represented by 3ß-HSD I and III (and most likely II), functions as dehydrogenase/isomerases (10) and is essential for the biosynthesis of active steroid hormones, whereas the other group, represented by IV and V, functions as 3-ketosteroid reductases and appears to be involved in the inactivation of active steroid hormones (6, 7). 3ß-HSD I in the adult mouse is expressed in the gonads and adrenal glands (5). 3ß-HSD II and III are expressed in the liver and kidney (5), with much greater expression of III in the liver than in the kidney. The major site of expression of 3ß-HSD IV is in the proximal tubules of the kidney of male and female mice (6), with minor expression in the testis (7). The expression of 3ß-HSD V appears to occur only in the liver of the male mouse, with expression starting during the latter half of pubertal development (7, 11). This paper describes the isolation and tissue-specific expression of a new isoform, 3ß-HSD VI, which is the major isoform expressed during the first half of pregnancy in cells of embryonic origin and in uterine tissue. 3ß-HSD VI appears to be the only isoform expressed in skin. It is expressed in Leydig cells of the adult testis but to a lesser extent than 3ß-HSD I. Mouse 3ß-HSD VI appears to be orthologous to human 3ß-HSD I, which is expressed in the placenta and skin (3). The temporal expression of 3ß-HSD VI during the first half of pregnancy suggests that this isoform may serve an important role in the local production of progesterone needed either for implantation of the embryo and/or maintenance of early pregnancy.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Animals and tissue preparation
A variety of mice were used: from Jackson Laboratory (Bar
Harbor, ME), C57BLxSJL andC57BL/6J male and female mice, as well as
pregnant mothers, were delivered to the University of Michigan on day
7.5 postcoitum (pc). All procedures were within the Guideline of
Responsible Animal Care at the University of Michigan and had the
approval of the Institutional Committee on Animal Care and Use at the
University of Michigan. C57xBalb/C male and female mice were obtained
from Harlan Laboratories Ltd. (Jerusalem, Israel). All experiments
performed in Israel were reviewed by the Institutional Committee on
Animal Care and Use of the Faculty of Science, The Institute of Life
Sciences, The Hebrew University of Jerusalem and found to be compatible
with the standards for care and use of laboratory animals. The
C57BLxSJL or the C57xBalb/C mice were mated and the next morning
examined for vaginal plugs. 1200 h was designated day 0.5 pc.
Adult mice were killed by cervical dislocation, and the appropriate tissues were removed and immediately frozen on dry ice and stored at -70 C until needed for RNA or protein extraction. Pregnant mothers were killed in the same manner at indicated times.
9.5- and 10.5-day embryos. Uterine horns were removed and
placed in PBS on ice. The embryos were separated from the uterus. The
9.5-day embryos include the yolk sac and placenta. The 10.5-day embryos
were separated from the yolk sac and placenta, and only the embryos
were used for RNA extraction. Each embryo was frozen individually on
dry ice and stored at -70 C.
Uterine tissue and giant trophoblast cells. At 4.5 days pc,
uterine horns were flushed with PBS to validate the presence of
blastocysts, and the entire horn was used for RNA extraction; at 6.5
days pc the isolated implantation sites were trimmed free of the muscle
layers, and the stromal and decidual tissue, including the embryonic
tissue, was used for RNA extraction; at 7.5 and 9.5 days pc, the
implantation sites were trimmed free of the muscle layers and the
embryo, and its sacs were removed. RNA was extracted from the inner
layers of the giant trophoblast cells, which were carefully scraped
from hemi sites and separated from the decidua basalis and decidua
capsularis tissues. The latter tissues were used for RNA extraction of
the typical 9.5-day decidua preparation. The giant trophoblast cells
were used separately from the decidua basalis and the decidua
capsularis tissue for RNA extraction.
Placentas and yolk sacs. Placentas and yolk sacs were removed from 13.5-, 15.5-, and 17.5-day embryos. Placentas were used for extraction of RNA, and yolk sacs were used for extraction of DNA for determination of gender.
RT-PCR amplification
Total RNA from the 9.5- and 10.5-day embryos and from the adult
tissues was isolated using the acid-guanidinium-phenol-chloroform
method (12). RNA from uterine tissues and trophoblast cells was
extracted by homogenization of these tissues in RNAzol according to the
manufacturer’s instruction. The concentration and purity of total RNA
was determined by measuring the optical density at 260 and 280 nm.
Aliquots of total RNA (at amounts indicated in the figure legends) from
each mouse tissue were reverse transcribed using 25 U of AMV reverse
transcriptase in 20 µl total reaction. RT was performed as described
in the protocol from Perkin-Elmer (Norwalk, CT), using random hexamers.
Following the RT reaction, each sample (20 µl) was diluted with 80
µl PCR mixture (final concentrations: 2 mM
MgCl2, 0.15 µM of the appropriate primers and
2.5 U Taq polymerase) and incubated at 70 C for 5 min before PCR.
Sequential cycles of amplification were performed using a Perkin-Elmer
thermocycler for 35 cycles with each cycle consisting of 1 min at 95 C
and 1 min at 60 C. The primer pairs (5'–>3'): for amplification of
all forms of mouse 3ß-HSD: P1 (629 bp amplified product), sense
CAGACCATCCTAGATGT +283 to +300, antisense AGGAAGCTCACAGTTTCCA +893 to
+911; for complete coding region of 3ß-HSD II and VI, P2 (1137 bp
amplified product), sense TTCCTGTGTTGACCATG -14 to +3, antisense
ATCACTGAGACGTTGTG +1107 to +1123; P3 (c-abl 230 bp amplified product)
proto-oncogene (13), sense TTTATGGGGCAGCAGCCTGGAAAAGTACTTGGG,
antisense TCACTGGGTCCAGCGAGAAGGTTTTCCTTGGAGTT. Each primer pair spans
introns permitting amplified fragments of cDNA to be distinguished from
any fragments derived from genomic DNA.
Identification of the RT-PCR products was established by subjecting
equal aliquots of the amplified 3ß-HSD to digestion with one of five
specific restriction enzymes, and the resultant fragments separated by
2% agarose gel electrophoresis and visualized by ethidium bromide
staining. A few representative samples were subjected to Southern
analysis using a 32P-labeled 3ß-HSD I cDNA probe. Each
analysis represents results from at least two or three separate tissue
samples. Table 1
describes the size of the fragment that
is diagnostic for each of the 3ß-HSD cDNAs with the indicated
specific restriction enzyme. In some of the figures only the larger
diagnostic fragment described in Table 1 is seen, the smaller fragment
resulting from the enzyme digestion being below the sensitivity of the
assay. AvaII digests both 3ß-HSD IV and V.
|
-32P] deoxycytidine
5'-triphosphate (New England Nuclear Radiochemicals, Boston, MA) by
random hexanucleotide primer method to a specific activity of 1 x
108 to 109 cpm/µg. Hybridization and washing
procedures were performed as described previously (8).
DNA sequence analysis
For sequencing, the 1137-bp PCR product (obtained from four
separate RT-PCR reactions with testis RNA using the P2 primers) was
separated on 1% low melt agarose gel, eluted, and purified using the
SpinBind DNA Recovery System. Both strands of the purified fragment
were sequenced in the DNA Sequencing Core of the Biomedical Research
Core Facilities, University of Michigan, by automated fluorescent cycle
sequencing using dye labeled terminators and Applied Biosystems (Foster
City, CA) instrumentation. The primers used for sequencing were
synthetic oligonucleotides derived from highly conserved regions of
3ß-HSD cDNAs.
The 5' untranslated region of 3ß-HSD VI cDNA was deduced from a
genomic clone containing the 3ß-HSD VI gene, including exons 1 and 2,
which was isolated from a 129 Sv/J genomic library (Abbaszade and
Payne, unpublished observations). The 5' region of the 3ß-HSD gene
was amplified by PCR, as described above, using a T7 primer from the
vector and a 3ß-HSD VI-specific primer: 5'-GGAGCTGCCTGGTGAC-3' from
+11 to +26. Both strands of the 300-bp PCR product using the same
primers were sequenced. A 132-bp exonic sequence for 5' untranslated
region of 3ß-HSD VI cDNA was identified by homology to the sequence
of the 3ß-HSD I gene (5) and identification of the consensus
intron/exon splice sequences. The 3' untranslated sequence was
determined by the 3' rapid amplification of cDNA ends (RACE) method
(14). Pregnant mouse uterine RNA was reversed transcribed with the
adapter primer 5'-ACGGGCAAATTCTCCACAGCC-3' with added 17 dT residues.
The cDNA pool was then amplified using the 3ß-HSD VI specific primer
5'-ACGGGCAAATTCTCCACAGCC-3' (+643 to +663) as the forward primer and
the adapter primer without the poly dT. Both strands of the PCR product
were sequenced from two independent clones using the same two primers.
The sequence of the coding region and the 3' and 5' untranslated region
obtained as described above is presented in Fig. 1.
Sequencing of the 5' and 3' untranslated sequences was performed at the
DNA Sequencing Core (Protein and Nucleic Acid Biotech Facility of
Stanford University) by automated dye labeled terminator
sequencing.
|
Transient expression of mouse 3ß-HSD cDNAs
Monkey kidney tumor (COS-7) cells were grown in DMEM (GIBCO,
Grand Island, NY) supplemented with 10% calf bovine serum (Hyclone,
Logan, VT). One day before transfection, cells were plated at about
1.5–2 x 106 cells/100 mm. After 24 h
incubation, medium was removed, and cells were transfected either with
the pCMV5 parent vector or with pCMV5.3ß-HSD VI, I, III, IV, or V
containing recombinant plasmid by the dimethylaminoethyl-dextran
method. The latter four expression plasmid-transfected cells were used
only for the Western blot analysis illustrated in Fig. 7. Sixty-six
hours after transfection, cells were harvested, and homogenates were
prepared as previously described (3).
|
500 cpm) product was added to each incubation tube to monitor
product recovery. Steroids were extracted and separated by ITLC SA
sheets in chloroform-diethyl ether (70:3) and quantified as previously
described (7). The assays were performed in duplicate in two separate
experiments from two different preparations of COS-transfected cells.
Enzyme activity was determined as picomoles of product formed per min
per µg protein. Michaelis-Menten constant (Km) values
were determined by the enzyme Kinetics program (version 1.0c, 1989), a
Macintosh Hypercard stack by D. C. Gilberts (Biology Department,
Indiana University, Bloomington, IN).
Western blot analysis
Proteins were extracted from transfected COS-7 cells, 9.5-day
embryos, or testes from 50-day old mice and subjected to Western blot
analysis as described previously (5, 6, 7). 3ß-HSD immunoreactive
proteins were detected with a rabbit antiserum raised against the human
placental 3ß-HSD and horseradish peroxidase-labeled secondary
antibody using the Enhanced ChemiLuminescence kit.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. The sequence includes 132 bp of 5' untranslated sequences, 1122
bp of open reading frame encoding a protein of 373 amino acids
identical to the predicted number of amino acids of the other five
characterized mouse 3ß-HSD cDNAs, and the complete 375 bp 3'
untranslated sequences including 20 bp of polyadenylated tail. The A in
the first in frame ATG codon is designated as position +1. The ATG
codon is flanked by the eukaryotic consensus sequence for translation
initiation, including the invariant purine, preferably A, in position
-3 (15). Table 2 compares the percent identity of the
predicted amino acid sequence of mouse 3ß-HSD VI to the predicted
amino acid sequence of the other five mouse forms (7). Data in this
table show that the predicted amino acid sequence of 3ß-HSD VI is
most closely related to 3ß-HSD III and II and somewhat less to
3ß-HSD I. Amino acid identity of 3ß-HSD VI to 3ß-HSD IV and V,
which belong to the 3-ketosteroid reductase functional group, is
considerably less.
|
). Figure 2 indicates that the only isoform observed in
skin from a male adult mouse is 3ß-HSD VI. Southern blot analysis of
the gel using a 32P-labeled 3ß-HSD I cDNA (see
Materials and Methods) also did not detect any digested DNA
fragments with any of the restriction enzymes tested except with the
3ß-HSD VI specific enzyme, NdeI (data not shown). We also
observed expression of 3ß-HSD VI mRNA in skin of female mice and in
mice homozygous for the hairless mutation htg
(16) (data not shown).
|
illustrates the temporal expression of 3ß-HSD
VI and I in embryonic cells during the first half of pregnancy. The
only isoform observed in 7- and 9.5-day embryos was 3ß-HSD VI (Fig. 3, A and B). These embryo samples include the yolk sac and embryonic
membranes. The 10.5-day embryos that were free of placenta and yolk sac
expressed 3ß-HSD VI and I (Fig. 3, C and D). Figure 3, C and D
represent 10.5-day embryos from two different strains of mice. Figure 3C represents two different embryos from the same litter of a C57BL/6J
mother; Fig. 3D is a representative gel of one of several embryos
examined from a F2 litter of C57BL/6JxSJL/J parents.
Expression of both 3ß-HSD VI and I was observed in 10.5-day embryos
of either sex. These data indicate that 3ß-HSD VI is the earliest
isoform expressed in the embryo and/or embryonic membranes, with the
expression of 3ß-HSD I occurring in the embryo between days 9.5–10.5
pc.
|
, 3ß-HSD VI is
expressed as early as 4.5 days pc in the pregnant uterus, which is the
time of implantation, and continues to be expressed at 9.5 days pc
(Fig. 4, B and C). No 3ß-HSD isoforms were detected in the 3.5-day pc
pregnant uterus (data not shown). Illustrated in Fig. 4D is the
expression of 3ß-HSD VI in giant trophoblasts at 9.5 days pc.
|
shows that 3ß-HSD VI is the predominant isoform of
3ß-HSD expressed in the 9.5-day embryo (Fig. 5A) and in uterine
tissue (Fig. 5B) during the first half of mouse pregnancy with minimal
expression of 3ß-HSD I.
|
. Placentas from 13.5-day-old embryos express both
3ß-HSD VI and I, the expression of VI decreases in placentas from
15.5-day-old embryos and is no longer observed in placentas from
17.5-day-old embryos, which appear (by ethidium bromide staining) to
express only 3ß-HSD I. Placentas from several embryos were examined,
and the sex of the embryo was determined by PCR amplification of the
male-specific gene Sry (17). The temporal expression of the
two isoforms in placenta was identical whether it came from a female or
a male fetus.
|
indicates that 3ß-HSD I is the only form of
3ß-HSD expressed in the adrenals of both sexes and in the ovary,
whereas in the testis (using the more sensitive assay of RT-PCR) the
presence of 3ß-HSD VI mRNA was detected as well as 3ß-HSD I mRNA.
Examination of livers and kidneys from mature mice, which previously
have been shown to express different isoforms of 3ß-HSD (5, 6, 7, 11), indicated the absence of 3ß-HSD VI expression in the adult liver
and kidney of both sexes (data not shown).
To characterize the protein encoded by 3ß-HSD VI cDNA, COS-7 cells
were transiently transfected with pCMV5.3ß-HSD VI, an expression
vector containing the coding region of 3ß-HSD VI cDNA. The apparent
molecular weight of the expressed protein was compared by Western blot
analysis to transiently expressed 3ß-HSD I, III, IV, and V, as well
as the endogenous isoforms expressed in the mature testis and the
9.5-day embryo. Figure 8 shows that the mobility of
3ß-HSD VI (44 kDa) is identical to, or very similar to, the
mobility of 3ß-HSD III, but differs from the mobility of 3ß-HSD I,
IV, and V. Figure 8 also shows that a protein of identical mobility as
VI is expressed in the 9.5-day embryo and also in the testis. In the
testis, as previously reported, the major expressed protein is 3ß-HSD
I (42 kDa). No 3ß-HSD immunoreactive protein was observed in COS-7
cells transfected with the pCMV5 parent vector.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Both 3ß-HSD III and I have previously been shown to
function as NAD+-requiring dehydrogenase/isomerases (10).
3ß-HSD VI exhibits very low Km values for pregnenolone
(0.035 µM), somewhat lower than the Km
value reported for 3ß-HSD I, and markedly lower than the value
reported for 3ß-HSD III (Table 3). 3ß-HSD VI is the
earliest and predominant mouse 3ß-HSD isoform expressed during the
first half of pregnancy in cells of embryonic origin, and in the
pregnant uterus at the time of implantation. 3ß-HSD VI continues to
be expressed in placenta from 13.5-day embryos, but decreases by day
15.5, and is no longer observed at 17.5 days. Previous studies reported
expression of P450 side chain cleavage (scc) mRNA at the time of
implantation, and intrauterine administration of oil can mimic this
effect of implantation (18). Furthermore, P450scc (18) or 3ß-HSD mRNA
(19) are not expressed before implantation. Thus, decidual expression
of P450scc and 3ß-HSD VI mRNA at this time suggests that these two
enzymes may be needed for local biosynthesis of progesterone during the
first half of pregnancy. 3ß-HSD I mRNA was first detected in 9.5-day
embryos. 3ß-HSD I is the major or only isoform expressed in gonads
and adrenal glands of the mature mouse (this study; Ref.5). In a
previous study we reported the expression of 3ß-HSD I in fetal testes
as early as embryonic day 13.5 (17) and in adrenal glands of both sexes
from embryonic day 15.5 and throughout development (unpublished
observations). The previous studies on 3ß-HSD mRNA expression in
embryonic tissues were carried out before the identification of
3ß-HSD VI. The complete digestion of the RT-PCR product from fetal
testes and adrenal glands of both sexes by 3ß-HSD I-specific
restriction enzymes indicates that 3ß-HSD I is the only isoform
expressed in these fetal tissues.
|
The expression of 3ß-HSD VI mRNA and protein in the 50-day-old testis
was unexpected. Previous reports from our laboratory examining
immunoreactive proteins in Leydig cells and testes from CD-1 mice by
Western analysis indicated the presence of only one immunoreactive
protein with the mobility of 3ß-HSD I (5). On over exposure of these
immunoblots we did observe an immunoreactive protein with a lower
mobility than 3ß-HSD I (unpublished observations). In the current
study, a number of testicular samples from a variety of inbred strains
of mice (50–60 days old) were examined for expression of the
3ß-HSD immunoreactive protein with lower mobility. When larger
amounts of testicular protein (50 µg or greater) were analyzed, this
protein was detected. As shown in Fig. 8, expression of this protein is
considerably less than expression of the 3ß-HSD I protein. We also
examined 3ß-HSD mRNA isoforms in MA-10 Leydig tumor cells. Both
3ß-HSD I and VI mRNA were expressed in the MA-10 Leydig cells (data
not shown). This observation indicates that Leydig cells are the cell
of the testis in which both 3ß-HSD VI and I are expressed. The
function served by 3ß-HSD VI in the testis remains to be established.
Expression of 3ß-HSD VI appears to be male specific in the gonad,
because this isoform was not detected in ovaries (Fig. 7). Recently,
the expression of human 3ß-HSD type I transcripts were observed in
human testes (20). The observation that human testes as well as mouse
testes express these forms of 3ß-HSD provides additional evidence
that human type I and mouse type VI are orthologous. Keeney et
al. (21) reported the expression in mouse testes of an
immunoreactive protein with a lower mobility relative to mouse 3ß-HSD
I. These authors reported that this lower mobility protein was male
specific in the gonad and first appeared early during pubertal
development. From Northern analysis using an oligonucleotide based on
the partial sequence of the 3ß-HSD II cDNA published by our
laboratory (21), Keeney et al. concluded that the lower
mobility immunoreactive protein represented 3ß-HSD II. The
oligonucleotide used by these authors exhibits only one mismatch out of
25 bases when compared with 3ß-HSD VI. Therefore, this
oligonucleotide would not discriminate between 3ß-HSD II and VI. From
the current study (Figs. 7 and 8) it can be concluded that this
testicular 3ß-HSD isoform represents 3ß-HSD VI and not 3ß-HSD II
as reported (21).
In summary, a sixth form of the mouse 3ß-HSD multigene family, the orthologous form to human I, has been identified. The demonstration in this study that this form is expressed in the uterus at the time of implantation and in embryonic cells during the first half of pregnancy predicts a similar role for human 3ß-HSD I, and suggests that these isoforms of 3ß-HSD may be involved in the local production of progesterone that is needed for successful implantation of the blastocyst and/or maintenance of early pregnancy. The mouse is an ideal model for testing the functional role of 3ß-HSD VI by analysis of targeted mutations of mouse 3ß-HSD VI.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received December 4, 1996.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5
4 isomerase
from placenta: expression in nonsteroidogenic cells of a protein that
catalyzes the dehydrogenation/isomerization of C21 and C19 steroids.
Endocrinology 126:2493–2498[Abstract]
5-4-isomerase in human
adrenals and gonads. Mol Endocrinol 5:1147–1157[Abstract]
5-4 isomerase (3ß-HSD)
family. J Biol Chem 268:19659–196685-4 isomerase and
differential expression in gonads, adrenal glands, liver and kidneys of
both sexes. Proc Natl Acad Sci USA 88:8870–88745-4-isomerase. Mol
Endocrinol 7:1569–1578[Abstract]
5-4 isomerase are closely
linked on mouse chromosome 3. Genomics 16:219–223[CrossRef][Medline]
5-4-isomerase cDNAs
expressed in COS-1 cells. Endocrinology 132:1971–1976[Abstract]
54-isomerase in mouse tissues: male-specific
isoforms are expressed in the gonads and liver. Endocrinology 133:39–45[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  N. Sher, N. Yivgi-Ohana, and J. Orly Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Aizawa, M. Iemitsu, S. Maeda, S. Jesmin, T. Otsuki, C. N. Mowa, T. Miyauchi, and N. Mesaki Expression of steroidogenic enzymes and synthesis of sex steroid hormones from DHEA in skeletal muscle of rats Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E577 - E584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. I. Nicolau-Solano, J. D. McGivan, F. M. Whittington, G. J. Nieuwhof, J. D. Wood, and O. Doran Relationship between the expression of hepatic but not testicular 3{beta}-hydroxysteroid dehydrogenase with androstenone deposition in pig adipose tissue J Anim Sci, October 1, 2006; 84(10): 2809 - 2817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Payne and D. B. Hales Overview of Steroidogenic Enzymes in the Pathway from Cholesterol to Active Steroid Hormones Endocr. Rev., December 1, 2004; 25(6): 947 - 970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Gondo, T. Yanase, T. Okabe, T. Tanaka, H. Morinaga, M. Nomura, K. Goto, and H. Nawata SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells Genes Cells, December 1, 2004; 9(12): 1239 - 1247. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nagata, J. Yoshikawa, A. Hashimoto, M. Yamamoto, A. H. Payne, and K. Todokoro Proplatelet formation of megakaryocytes is triggered by autocrine-synthesized estradiol Genes & Dev., December 1, 2003; 17(23): 2864 - 2869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.J. O'Shaughnessy, L. Fleming, P.J. Baker, G. Jackson, and H. Johnston Identification of Developmentally Regulated Genes in the Somatic Cells of the Mouse Testis Using Serial Analysis of Gene Expression Biol Reprod, September 1, 2003; 69(3): 797 - 808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ben-Zimra, M. Koler, and J. Orly Transcription of Cholesterol Side-Chain Cleavage Cytochrome P450 in the Placenta: Activating Protein-2 Assumes the Role of Steroidogenic Factor-1 by Binding to an Overlapping Promoter Element Mol. Endocrinol., August 1, 2002; 16(8): 1864 - 1880. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Peng and A. H. Payne AP-2gamma and the Homeodomain Protein Distal-less 3 Are Required for Placental-specific Expression of the Murine 3beta -Hydroxysteroid Dehydrogenase VI Gene, Hsd3b6 J. Biol. Chem., March 1, 2002; 277(10): 7945 - 7954. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Arensburg, A. H. Payne, and J. Orly Expression of Steroidogenic Genes in Maternal and Extraembryonic Cells During Early Pregnancy in Mice Endocrinology, November 1, 1999; 140(11): 5220 - 5232. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. G. Mensah-Nyagan, J.-L. Do-Rego, D. Beaujean, V. Luu-The, G. Pelletier, and H. Vaudry Neurosteroids: Expression of Steroidogenic Enzymes and Regulation of Steroid Biosynthesis in the Central Nervous System Pharmacol. Rev., March 1, 1999; 51(1): 63 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. O'Shaughnessy, P. Baker, U. Sohnius, A.-M. Haavisto, H. M. Charlton, and I. Huhtaniemi Fetal Development of Leydig Cell Activity in the Mouse Is Independent of Pituitary Gonadotroph Function Endocrinology, March 1, 1998; 139(3): 1141 - 1146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Cohen, M. P. Hardy, and J. W. Pollard Colony-Stimulating Factor-1 Plays a Major Role in the Development of Reproductive Function in Male Mice Mol. Endocrinol., October 1, 1997; 11(11): 1636 - 1650. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||
