help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niwa, H.
Right arrow Articles by Cram, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niwa, H.
Right arrow Articles by Cram, D. S.
Endocrinology Vol. 138, No. 4 1419-1426
Copyright © 1997 by The Endocrine Society


ARTICLES

Identification of Pancreatic ß Cell-Related Genes by Representational Difference Analysis1

Hideo Niwa2, Leonard C. Harrison, Henry J. DeAizpurua and David S. Cram

Burnet Clinical Research Unit, The Walter and Eliza Hall Institute of Medical Research, Post Office, Royal Melbourne Hospital, Parkville 3050, Australia

Address all correspondence and requests for reprints to: Dr. David Cram, Burnet Clinical Research Unit, The Walter and Eliza Hall Institute of Medical Research, Post Office, Royal Melbourne Hospital, Parkville 3050, Australia. E-mail: cram{at}wehi.edu.au


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A knowledge of ß cell-specific gene expression provides a basis for identifying proteins potentially involved in ß cell function and pathology. To identify candidate ß cell-specific genes, we applied the PCR-based subtractive hybridization technique of representational difference analysis (RDA) to the mouse SV40-transformed endocrine cell lines, ßTC3 and {alpha}TC1. Following three successive subtractions of {alpha}TC1 complementary DNA from ßTC3 complementary DNA, difference products were cloned into pUC19 and nucleotide sequences determined. Comparison of 91 sequences against the databases identified 11 known and 8 novel genes. Known genes included previously reported ß cell-specific genes, insulin I/II and islet amyloid polypeptide, as well as other non-ß cell-specific genes such as those for insulin-like growth factor II, selenoprotein P, neuronatin, prohormone convertase, and type 1 protein kinase A regulatory subunit. By Northern blot hybridization, expression of the majority of known and novel genes was restricted to ßTC3 cells. Novel genes BA-12, -13, -14, and -18 were expressed not only in ßTC3 cells, but also in normal pancreatic islets and a limited number of other tissues. The deduced amino acid sequence of BA-14 showed significant homology with members of the cadherin superfamily indicating that BA-14 may encode a cadherin-like molecule potentially involved in ß cell adhesion events during islet ontogeny. In ßTC3 cells, none of the novel genes were regulated at the RNA level by high glucose. However, in parallel studies, transcription of BA-12 was significantly increased by both sodium butyrate and nicotinamide, suggesting that this gene may play a role in pancreatic ß cell growth and/or differentiation.

In this study, we have demonstrated that cRDA is an effective strategy for systematically mapping differences in gene expression between two related but functionally-distinct endocrine cells. Its application to experimental animal models of islet-cell regeneration may facilitate the discovery of potential factors that mediate ß cell growth and differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PANCREATIC ISLETS of Langerhans contain {alpha}, ß, {delta}, and PP endocrine cells that secrete the hormones glucagon, insulin, somatostatin, and pancreatic polypeptide, respectively. The predominant ß cells are the sole source of insulin, and their selective destruction by autoimmune T cells leads to insulin-dependent diabetes mellitus (IDDM) (1). The identification of ß cell-specific molecules involved in growth and differentiation, insulin biosynthesis, or autoimmunity could lead to new approaches to the treatment of IDDM.

Many studies have attempted to characterize ß cell molecules using traditional bio- or immuno-chemical techniques. However, only a few have attempted to systematically and comprehensively analyze gene expression in ß cells. In one study, Tanaka et al. (2) sequenced randomly selected clones from a human islet complementary DNA (cDNA) library and catalogued several hundred genes. Velculescu et al. (3) analyzed large numbers of pancreatic transcripts by serial analysis of sequence tags (SAGE) and identified 13 novel genes. Recently, Neophytou et al. (4) identified differentially expressed mouse ß cell genes by subtraction of a glucagonoma ({alpha} cell tumor) from an insulinoma (ß cell tumor). Despite these studies, the genes uniquely expressed in ß cells have not been reported.

With the advent of PCR-based subtraction techniques, it is now possible to rapidly map unique differences in gene expression between related cells. As a model system for defining genes expressed specifically in endocrine ß cells, we have applied cDNA representational difference analysis (cRDA) (5) to the well characterized SV40-transformed mouse cell lines, ßTC3 (6), and {alpha}TC1 (7), that secrete the hormones insulin and glucagon, respectively. These cell lines are relatively differentiated and are thought to be derived from a common endocrine precursor. In this study, subtraction of {alpha}TC1 from ßTC3 cDNA by cRDA identified both known and novel difference products expressed uniquely in ßTC3 cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Islet cell lines and tissues
ßTC3 and {alpha}TC1 cell lines were kindly provided by Professor D. Hanahan (University of California, San Francisco, CA). Both cell lines were cultured in DMEM (5 mM glucose) containing 10% FCS under a 10% CO2 atmosphere at 37 C. For functional studies, ßTC3 cells were exposed for 6 h to either 25 mM glucose, 1 mM sodium butyrate or 2 mM nicotinamide. Brain, liver, kidney, lung, heart, skeletal muscle, spleen, and pancreas were immediately excised from 8-week-old CBA mice killed by cervical dislocation, rapidly washed in ice-cold phosphate buffered saline (PBS), snap-frozen in a dry ice/hexane bath, and stored at -70 C before RNA extraction. Islets were dissociated from the pancreas of 8 week old CBA mice by collagenase digestion and purified on BSA gradients (8).

Oligonucleotides and enzymes
Oligonucleotides for RDA were as follows: R-Bgl-12, 5'-GATCtgcggtga-3'; R-Bgl-24, 5'-AGCACTCTCCAGCCTCtcaccgca-3'; J-Bgl-12, 5'-GATCtgttcatg-3'; J-Bgl-24, 5'-ACCGACGTCGACTATCcatgaaca-3'; N-Bgl-12, 5'-GATCttccctcg-3'; N-Bgl-24, 5'-AGGCAACTGTGCTATCcgagggaa-3' Lower case letters signify regions of complementarity between the oligonucleotide pairs. All enzymes for DNA manipulations except Taq polymerase (Perkin Elmer, Roche Molecular Systems Inc., Branchburg, NJ) were purchased from New England Biolabs, Beverly, MA.

Generation of amplicons and RDA PCR subtraction
Cytoplasmic RNA was purified from ßTC3 and {alpha}TC1 cells grown to 50% confluency and directly lyzed with RNAzol B (Biotecx Laboratories, Inc., Friendswood, TX). The polyA+ RNA fraction of cytoplasmic RNA was isolated by oligo dT chromatography using the PolyATtract messenger RNA (mRNA) isolation system (Promega, Madison, WI), and cDNA was synthesized from polyA+ RNA using the Riboclone cDNA Synthesis System (Promega) according to the manufacturer’s instructions.

The cDNA RDA method was essentially as described by Hubank and Schatz (5), except for minor modifications. Double-stranded cDNA (2 µg) was digested with DpnII and purified by phenol extraction and ethanol precipitation. Digested cDNA (1.2 µg) was annealed with R-Bgl-24 (8 µg) and R-Bgl-12 (4 µg) and ligated with 1,200 U T4 DNA ligase at 14 C for 12–16 h in a 50-µl volume. Aliquots of the ligation mix (adjusted to 6 µg/ml) were amplified in multiple PCR reactions using R-Bgl-24. Diluted ligation mix (1 µl) was added to 100 µl of PCR buffer containing 67 mM Tris-HCl (pH 8.8), 4 mM MgCl2, 16 mM (NH4)2SO4, 20 mg/ml BSA, 0.25 mM dNTPs, and 10 µg/ml R-Bgl-24 and heated at 72 C for 3 min to melt away the adapter R-Bgl-12. Following the addition of 5 U Taq polymerase and further incubation at 72 C for 5 min to fill the 5' ends, the mixtures were amplified by 20 cycles of PCR (95 C, 1 min; 72 C, 3 min) with a final extension at 72 C for 10 min. Products were combined, phenol extracted, and resuspended in TE (10 mM Tris, 1 mM EDTA, pH 8.0) at a final concentration of 0.5 µg/ml. To generate the driver amplicon, R adapters were removed from the representation by DpnII digestion followed by phenol extraction and ethanol precipitation. Twenty micrograms of this representation were subjected to agarose gel electrophoresis and purified using Qiaex resin (Qiagen) to yield tester amplicon, which was finally ligated to the J-Bgl-12/24 combination as described above.

The first round of subtraction hybridization and amplification was performed using 0.4 µg of J-ligated tester and 40 µg of driver (tester:driver = 1:100). The mixture was phenol extracted, ethanol precipitated, and resuspended in 4 ml EE x 3 buffer [30 mM N-(2-hydroxy-ethyl) piperazine-N'-3-propane sulfonic acid (Sigma Chemical Co., St. Louis, MO); 3 mM EDTA (pH 8.0)]. The solution was overlaid with mineral oil at 98 C for 5 min to denature the DNA and the salt concentration adjusted by the addition of 1 µl of 5 M NaCl. After annealing for 20 h at 67 C, the reaction mixture was diluted to 400 µl with TE containing transfer RNA carrier. For every subtraction, eight 100-µl PCR reactions were set up as before with 10 µl of diluted hybridization mixture. Reactions were incubated at 72 C for 3 min to melt away J-Bgl-12 adapter and a further 5 min with 5 U Taq polymerase to extend the ends. Products from ten cycles of amplification (95 C, 1 min; 70 C, 3 min) were pooled after phenol extraction and isopropanol precipitation, resuspended in 400 µl of 0.2 x TE, and digested with 40 U mung bean nuclease for 35 min at 30 C. Reactions were terminated by addition of 160 µl of 50 mM Tris-HCl (pH 8.9), heated at 98 C for 5 min, and chilled on ice. The first difference product (DP1) was reamplified in eight separate PCR reactions containing 10 µl mung bean nuclease digestion reaction, 2 µg J-Bgl-24, and 5 U Taq polymerase for 18 cycles (95 C, 1 min; 70 C, 3 min).

DpnII-digested PCR cDNA products were ligated to new adapters, either N-Bgl-12 after the first subtraction or J-Bgl-12 after the second subtraction. The RDA process was repeated as before using this amplicon as tester with N-Bgl-24 or J-Bgl-24 as the PCR amplification primers. To generate the second difference products (DP2), 50 ng of N-ligated DP1 was hybridized with 40 µg driver (tester:driver = 1:800). Likewise, to generate the third difference products (DP3), 100 pg J-ligated DP2 was mixed with 40 µg driver (tester:driver = 1:400,000). Amplification, however, was performed for 22 cycles to maximize the yield of difference product for cloning. Difference product cDNA was digested with DpnII and subcloned into the BamHI site of the pUC19 vector. Double-stranded plasmid DNA was prepared from each clone, and sequence determined by dideoxy terminator cycle sequencing using an ABI DNA sequenator (Applied Biosystems, Foster City, CA). Nucleotide sequences were compared to GenBank and dbEST databases and protein translation sequences were compared with SWISSPLOT Protein and GenBank Protein Translation databases using the FASTA search program (W.R. Pearson, University of Virginia).

Northern blotting
Total RNA was fractionated on formaldehyde agarose gels and transferred to Hybond-N nylon membrane (Amersham, Buckinghamshire, UK). DNA probes extracted from polyacrylamide gels were labeled with [{alpha}-32P] dATP using the Megaprime DNA labeling system (Amersham) and unincorporated 32P removed using nick translation columns (Pharmacia Biotech, Uppsala, Sweden). Prehybridizations (4 h) and hybridizations with labeled cDNAs (16 h) were performed at 65 C in 6 x SSC, 2 x Denhardt’s solution, 0.1% SDS, and 200 µg/ml salmon sperm DNA. Membranes were rinsed in 2 x SSC, 0.1% SDS, washed in 2 x SSC, 0.1% SDS for 30 min at 65 C, and, if necessary, washed further in 0.2 x SSC, 0.1% SDS for 30 min at 65 C to reduce background before autoradiography.

RT-PCR
DNase I-treated mouse islet RNA (1 µg) was reverse-transcribed with 200U of MMLV RT (Life Technologies, Gaithersburg, MD) in the presence of 0.5 µM random hexanucleotides (Bresatec, Australia) and 200 µM dNTPs. Aliquots (one-tenth volumes) of the first-strand synthesis reactions were amplified by PCR in PCR buffer (Perkin Elmer) containing 200 µM dNTPs, 1 µM each of the gene-specific oligonucleotides and 1 U Taq polymerase. PCR reactions were performed for 25–30 cycles (95 C, 45 sec; 50–60 C, 1 min; 72 C, 1 min) and amplified products analyzed in 1.5% agarose gels.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Hormone gene expression in {alpha}TC1 and ßTC3 cells
To confirm the specificity of marker gene expression in {alpha}TC1 and ßTC3 cells, Northern blots of total RNAs from cells grown to mid-log phase were hybridized with insulin, glucagon, and somatostatin cDNA probes (9). ßTC3 cells expressed high levels of mRNA for insulin, but not for glucagon or somatostatin, whereas {alpha}TC1 cells expressed only mRNA for glucagon (Fig. 1Go).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 1. Islet hormone mRNA expression in {alpha}TC1 and ßTC3 cells. Total RNA (10 µg) isolated from {alpha}TC1 ({alpha}) and ßTC3 (ß) was resolved by formaldehyde agarose gel electrophoresis, transferred to nylon membrane and probed with [32P]-labeled insulin (INS), glucagon (GLU), or somatostatin (SOM) cDNA. Equivalent RNA loading was assessed by ethidium bromide staining of the agarose gel. The relative positions of 28S and 18S ribosomal RNA are indicated.

 
Generation and characterization of difference products
The cDNAs derived from ßTC3 and {alpha}TC1 polyA+ RNA were of similar size and concentration as judged by ethidium bromide staining (Fig. 2AGo) and provided the templates for generating representative amplicons. The ßTC3 and {alpha}TC1 amplicons both contained cDNAs ranging from 200–800 bp in size (Fig. 2BGo), indicating that there was no discernible bias in the initial amplification step. To generate ß cell differences, the tester (ßTC3) and the driver ({alpha}TC1) amplicons were subjected to three successive rounds of subtraction. Difference products, DP1, DP2, DP3, were generated by using hybridization tester:driver ratios at 1:100, 1:800 and 1:400,000, respectively. After three subtraction steps, indistinct amplicon bands evident in DP1 were significantly resolved as individual cDNA species in DP3 (Fig. 2CGo). The bands were excised from the gel and subcloned into the BamHI site of the vector pUC19.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Agarose gel electrophoresis analysis of cDNA, amplicons and difference products. A, Double-stranded cDNA derived from {alpha}TC1 ({alpha}) and ßTC3 (ß) cells. B, Tester and driver amplicons generated from ßTC3 and {alpha}TC1 cell cDNA. C, DP1 and DP3, representative of the first and the third difference products, respectively.

 
Nucleotide sequences were determined for the DpnII inserts of 91 DP3 clones and compared against GenBank and dbEST databases using the FASTA program (Table 1Go). Eighty-two DP3 clones contained sequences of known cDNAs that represented a total of 11 different genes that included insulin I/II, islet amyloid polypeptide (IAPP), type I protein kinase A (PKA) regulatory subunit, insulin-like growth factor II (IGF II), selenoprotein P, and neuronatin. The remaining eight DP3 clones contained cDNA sequences that lacked similarity with any database sequences and in total comprised seven potentially novel genes. In some cases, several of the known DP3 clones were found to contain contiguous DpnII fragments of the same gene. For example, two subfragments each of IAPP, type I PKA regulatory subunit, selenoprotein P, insulin I/II and IGF II cDNAs were identified.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of ßTC3 difference products

 
To assess whether DP3 genes were uniquely expressed in ßTC3 cells, gene-specific mRNA levels in {alpha}TC1 and ßTC3 cells were compared with Northern blotting (Fig. 3Go). In all cases, except BA-10 (vacuolar H+-ATPase), BA-11 (ATP citrate lyase) and BA-19 (novel), a signal representing mRNA for each DP3 gene was only detected in ßTC3 cells. Even when autoradiographs were overexposed or {alpha}TC1 cell RNA loading increased 2-fold over ßTC3 cell RNA, no expression of these DP3 genes was observed in {alpha}TC1 cells (data not shown). These results indicate that the majority of DP3 genes identified are exclusively expressed in ßTC3 cells.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. Analysis of DP3 gene mRNA expression in ßTC3 and {alpha}TC1 cells. Total RNA (20 µg) isolated from {alpha}TC1 ({alpha}) or ßTC3 (ß) was blotted to nylon membrane and probed with [32P]-labeled cDNA from each difference product. The relative positions of 28S and 18S ribosomal RNA are indicated. The positions of BA-9 transcripts are indicated by arrows.

 
Tissue distribution of novel gene transcripts
Tissue-specific mRNA expression of the seven differentially expressed novel clones BA-12 to -18 was further examined by Northern blotting of total RNA from adult mouse brain, liver, kidney, lung, heart, skeletal muscle, spleen, and pancreas (Fig. 4Go). Each clone displayed a different tissue-restricted pattern. Transcripts for BA-14 appeared to be expressed exclusively in ßTC3 cells, whereas those for BA-12, -13, -17, and -18 were expressed in at least one other tissue. Conversely, transcripts for BA-15 and BA-16 were ubiquitously expressed. None of these genes were, however, expressed in the pancreas (Fig. 4Go) or in isolated islets (data not shown). To confirm the restricted tissue mRNA expression for genes BA-12, -13, -14, -17, and -18, and further investigate their expression in pancreas and islet tissue, the RNA samples analyzed by Northern blotting were subjected to the more sensitive technique of RT-PCR using gene-specific oligonucleotides (Fig. 5Go). Overall, the tissue distribution of mRNA for BA-12, -13, -14, and -18 determined by RT-PCR was similar to that seen by Northern blotting, although ubiquitous expression for BA-17 was detected by RT-PCR. Furthermore, by RT-PCR, mRNA for all these five novel genes was detected in both pancreas and islet tissue. These results indicate that these genes are expressed not only in ßTC3 cells but also in normal islets.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. Tissue specificity of novel DP3 gene mRNA expression by Northern blotting. Total RNA of adult mouse tissues (20 µg) was blotted to nylon membrane and probed with [32P]-labeled cDNA from each of the indicated clones. The relative positions of 28S and 18S ribosomal RNA are indicated.

 


View larger version (62K):
[in this window]
[in a new window]
 
Figure 5. Tissue specificity of novel DP3 gene expression by RT-PCR. Gene-specific oligonucleotides were as follows:

BA-12 5' TGCTTATCTCTGGGCACCATTACC 3', 5' CTAGAACCAAGAGCCAACCATGGC 3'; BA-13 5' TCATTCCCCTGGCTGTGTTTGGCC 3', 5' CAAGACTCCACTTCCCAATATTCC 3'; BA-14 5' GTCCACTATTCCATCTATGGGACC 3', 5' ATTGTCTTTTCCGTCCCCAGTACC 3'; BA-17 5' AGAGTGCGATCTGCGGTGAGAGGC 3', 5' TTAAACATCTCTGACCACCCAAGC 3'; BA-18 5' GGACTGGATAGACCTTGTGGTTGC 3', 5' TCCTTGCTCCACCTCTTGCTGGCC 3'. Amplified products were run on 1.5% agarose gels. The positions and sizes of the expected bands generated by PCR of each control cDNA (*) are indicated at the right.

 
Characterization and functional studies of novel genes
To further establish the identity of BA-12, -13, -14, -15, -16, -17, and -18, amino acid sequences predicted from their nucleotide sequences were compared against SWISSPLOT Protein and GenBank Protein Translation databases. An open reading frame of 177 amino acid residues translated from the nucleotide sequence of BA-14 showed significant homology with members of the classical cadherin family. A 20-amino acid region of BA-14 that displayed high homology with mouse P-, N-, R-, and E-cadherins (10, 11, 12, 13) is shown in Fig. 6Go. Within the BA-14 sequence, nine residues were identical with P- and R-cadherin and eight with N- and E-cadherin, and the remaining nonidentical residues were largely conserved. No significant homology with known protein sequences was found in the predicted amino acid sequences of the other novel genes.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Homology of BA-14 with members of the cadherin family. A 20 amino acid sequence of BA-14 is aligned with those of four mouse cadherins. mPcad, mNcad, mRcad, and mEcad denote mouse P-cadherin (10), N-cadherin (11), R-cadherin (12), and E-cadherin (13), respectively. Identical amino acid residues are enclosed in boxes. The numbers indicate the relative positions of the indicated amino acid residues in each protein.

 
To gain insight into the potential role(s) of these novel genes in ß cell function, we examined whether their expression could be regulated at the RNA level. For these studies, ßTC3 cells were exposed for 6 h to either 25 mM glucose, 1 mM sodium butyrate, or 2 mM nicotinamide. High glucose has been previously reported to induce insulin secretion in ßTC3 cells (6), whereas sodium butyrate and nicotinamide have been shown to induce the differentiation of rat insulinoma (RIN) cell lines (14, 15) and fetal islets (16, 17), respectively. The effect of these agents on the level of mRNA expression in ßTC3 cells for the genes BA-12, -13, -14, -17, and -18 and insulin (control) was assessed by Northern blotting. Changes in mRNA levels from basal were quantitated by densitometry of band intensities, adjusted for variations in RNA loading using GAPDH as an internal control. The level of insulin mRNA expressed in ßTC3 cells after exposure to high glucose or sodium butyrate was not significantly different from basal but was increased 2-fold by nicotinamide (Fig. 7Go). None of the three agents induced significant changes in the levels of BA-13, -14, -17, or -18 mRNA (data not shown). However, sodium butyrate and nicotinamide stimulated 2.6- and 2.8-fold increases, respectively, in mRNA expression for BA-12.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 7. Effect of high glucose, sodium butyrate, and nicotinamide on expression of BA-12 and insulin mRNA. ßTC3 cells were treated with 25 mM glucose, 1 mM sodium butyrate or 2 mM nicotinamide for 6 h. Total RNA isolated from treated and nontreated cells was blotted to nylon membrane and probed with [32P]-labeled cDNA for BA-12 and insulin. After autoradiography, blots were stripped and reprobed with [32P]-labeled GAPDH cDNA. Changes in the basal level of novel gene mRNA expression in ßTC3 cells following exposure to the above agents were determined quantitatively by densitometry of band intensities, adjusted for variations in GAPDH mRNA expression.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As a model system for the systematic analysis of ß cell-specific gene expression, we applied the recently developed PCR-based cDNA subtraction technique, cRDA, to the ßTC3 and {alpha}TC1 cell lines. These cell lines, representative of pancreatic islet ß cells and {alpha} cells, respectively, were established from SV40 T antigen transgenic mice derived insulinomas (ßTC3) and glucagonomas ({alpha}TC1). Thus, we expected that most, if not all, difference products between ßTC3 and {alpha}TC1 cells would probably be involved in ß cell-specific functions. Apart from the type I PKA regulatory subunit that has been reported to be up-regulated in tumor cell lines (18), we could find no evidence in the literature that the expression of any of the identified difference products is altered following cellular transformation events.

The majority of DP3 genes were expressed uniquely in ßTC3 cells. Insulin and IAPP, which are known to be ß cell specific, were present among the difference products, indicating that the RDA procedure selectively amplified authentic differences in gene expression between the two endocrine cells. Of the ßTC3 cell-unique genes identified, IAPP, insulin and type I PKA regulatory subunit were the most frequent. However, by Northern blot analysis of ßTC3 RNA, significantly higher levels of IAPP and insulin mRNA than type I PKA regulatory subunit mRNA were detected, indicating that cRDA has efficiently selected difference products regardless of gene mRNA expression levels.

Although cRDA identified a set of genes expressed in ß but not {alpha} cells, the majority of the known genes, except insulin and IAPP, have been previously reported to be expressed in other tissues. Nevertheless, it is interesting to speculate on the possible roles of several of these genes in the ß cell, for example, selenoprotein P and IGF II. Selenoprotein P is a secreted glycoprotein that contains the essential trace element selenium in the form of selenocysteine residues. Although its physiological role has not been clarified, it has been postulated that selenoprotein P may be involved in regulating the redox state of the cell by incorporating and releasing selenium (19). Free selenium in the cell is readily converted into selenodiglutathione, a highly efficient oxidant of reduced thioredoxin (20). ß cells modify proinsulin posttranslationally to biologically active insulin by the formation of two interchain and one intrachain disulfide bonds, whereas glucagon synthesis in {alpha} cells has no requirement for disulfide bond formation. Selenoprotein P might therefore contribute to the formation and maintenance of insulin disulfide bonds by regulating the redox state of the insulin-secreting granules.

Insulin-like growth factors IGF-I and IGF-II are expressed in the developing pancreas (21, 22). Our finding of IGF II mRNA in ßTC3 cells is consistent with previous immunohistochemical studies (22) that localize IGF II mRNA and protein to ß cells in human and animal islets. Although a direct role of IGF II in islet cell growth and differentiation has not been demonstrated directly (21), IGF II produced by ß cells could potentially act as an autocrine or paracrine factor during islet neogenesis. Interestingly, the IGF II gene in human (23), rat (24) and mouse (25), is physically located near the 3' end of the insulin (human) or insulin II (rat and mouse) gene and transcribed in the same direction. It has been postulated that this arrangement may allow these genes to share common regulatory elements (26) and raises the possibility that coordinate expression of insulin and IGF II may be important for ß cell development.

Apart from these known genes, eight novel genes were also found among the difference products. Expression of BA-12 to -18 was demonstrated in ßTC3 cells and in adult pancreatic islets that predominantly contain ß cells. From database searches, one gene, BA-14, encoded a protein with the molecular characteristics of a cadherin-like molecule. It is well documented that cadherins play a central role in cellular differentiation and organ morphogenesis by mediating calcium-dependent homotypic intercellular adhesion (27, 28). In the pancreas, E-, N-, and R-cadherins are expressed predominantly in islet tissue (29, 30, 31). In vitro studies of cultured rat islets suggest that E-cadherin mediates most of the cell adhesion events during islet ontogeny (29). Recently, transgenic expression of a dominant negative mutant of E-cadherin in ß cells has demonstrated directly that this molecule is important in the regulation of ß cell aggregation into islets (30). By analogy, it is conceivable that the cadherin-like molecule encoded by BA-14 may have a similar function in the developing islet. As it appears to be expressed in ß but not {alpha} cells, it could potentially play a role in the central clustering of ß cells within the islet.

From regulation studies of novel gene expression in ßTC3 cells, mRNA for one gene BA-12 was significantly up-regulated by both sodium butyrate and nicotinamide. Sodium butyrate is a lipophilic acid that induces differentiation of pluripotent RIN cell lines (14, 15). Nicotinamide, an inhibitor of poly ADP-ribose synthetase, has been shown to stimulate ß cell differentiation of fetal islets (16, 17). The increase in transcription of BA-12 in ßTC3 cells exposed to these agents leads us to speculate that this gene may have a potential role in the growth and/or differentiation of ß cells. When ßTC3 cells were exposed to 25 mM glucose for 6 h, there was no significant change in the levels of mRNA for any of the novel genes or insulin. The inability of high glucose to alter insulin mRNA levels has also been reported in the closely related cell line ßTC1(6). Thus, under these experimental conditions, we have no evidence as yet that any of these novel genes are regulated by glucose.

Another possibility is that one or more of these gene products could be a target of ß cell autoimmunity in IDDM. Of the recognized autoantigens insulin (32), glutamic acid decarboxylase (33), and tyrosine phosphatase IA-2 (34), only the former is expressed uniquely in ß cells. The molecular and biological characterization of these novel genes may reveal if they are relevant to ß cell development, function, and autoimmunity.


    Acknowledgments
 
We thank Dr. Lynn Corcoran for advice and discussions and Margaret Thompson for secretarial assistance.


    Footnotes
 
1 This study was supported by a Diabetes Interdisciplinary Program Grant from the Juvenile Diabetes Foundation International and NIH. Back

2 Supported by Kaneka Corporation (Japan). Back

Received September 9, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Harrison LC, Campbell IL, Colman PG, Chosich N, Kay TWH, Tait BD, Bartholomeusz RK, DeAizpurua HJ, Joseph JL, Chu S, Kielczynski WE 1990 Type 1 diabetes: immunopathology and immunotherapy. Adv Endocrinol Metab 1:35–94
  2. Tanaka M, Katashima R, Murakami D, Adzuma K, Takahashi Y, Tomonari A, Iwahana H, Yoshimoto K, Itakura M 1995 Molecular cloning of a group of mouse pancreatic islet beta-cell-related genes by random cDNA sequencing. Diabetologia 38:381–386[Medline]
  3. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW 1995 Serial analysis of gene expression. Science 270:484–487[Abstract/Free Full Text]
  4. Neophytou PI, Muir EM, Hutton JC 1996 A subtractive cloning approach to the identification of mRNAs specifically expressed in pancreatic ß-cells. Diabetes 45:127–133[Abstract]
  5. Hubank M, Schatz DG 1994 Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res 22:5640–5648[Abstract/Free Full Text]
  6. Efrat S, Linde S, Kofod H, Spector D, Delannoy M, Grant S, Hanahan D, Baekkeskov S 1988 Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene. Proc Natl Acad Sci USA 85:9037–9041[Abstract/Free Full Text]
  7. Efrat S, Teitelman G, Anwar M, Ruggiero D, Hanahan D 1988 Glucagon gene regulatory region directs oncoprotein expression to neurons and pancreatic {alpha} cells. Neuron 1:605–613[CrossRef][Medline]
  8. Lake SP, Anderson J, Chamberlain J, Gardner SJ, Bell PR, James RFL 1987 Bovine serum albumin density gradient isolation of rat pancreatic islets. Transplantation 43:805–808[Medline]
  9. Faulkner-Jones BE, Cram DS, Kun J, Harrison LC 1993 Localization and quantitation of expression of two glutamate decarboxylase genes in pancreatic beta-cells and other peripheral tissues of mouse and rat. Endocrinology 133:2962–2972[Abstract/Free Full Text]
  10. Nose A, Nagafuchi A, Takeichi M 1987 Isolation of placental cadherin cDNA: identification of a novel gene family of cell-cell adhesion molecules. EMBO J 6:3655–3661[Medline]
  11. Miyatani S, Shimamura K, Hatta M, Nagafuchi A, Nose A, Matsunaga M, Hatta K, Takeichi M 1989 Neural cadherin: role in selective cell-cell adhesion. Science 245:631–635[Abstract/Free Full Text]
  12. Matsunami H, Miyatani S, Inoue T, Copeland NG, Gilbert DJ, Jenkins NA, Takeichi M 1993 Cell binding specificity of mouse R-cadherin and chromosomal mapping of the gene. J Cell Sci 106:401–409[Abstract]
  13. Nagafuchi A, Shirayoshi Y, Okazaki K, Yasuda K, Takeichi M 1987 Transformation of cell adhesion properties by exogenously introduced E-cadherin cDNA. Nature 329:341–343[CrossRef][Medline]
  14. Philippe J, Drucker DJ, Chick WL, Habener JF 1987 Transcriptional regulation of genes encoding insulin, glucagon, and angiotensinogen by sodium butyrate in a rat islet cell line. Mol Cell Biol 7:560–563[Abstract/Free Full Text]
  15. Bartholomeusz RK, Campbell IL, Harrison LC 1989 Pancreatic islet A2B5- and 3G5-reactive gangliosides are markers of differentiation in rat insulinoma cells. Endocrinology 124:2680–2685[Abstract/Free Full Text]
  16. Otonkoski T, Beattie GM, Mally MI, Ricordi C, Hayek A 1993 Nicotinamide is a potent inducer of endocrine differentiation in cultured human fetal pancreatic cells. J Clin Invest 92:1459–1466
  17. Sandler S, Andersson A, Korsgren O, Tollemar J, Borg H, Petersson B, Groth CG, Hellerstrom C 1989 Tissue culture of human fetal pancreas. Effects of nicotinamide on insulin production and formation of islet-like cell clusters. Diabetes 8:168–171
  18. Cho-Chung YS 1990 Role of cyclic AMP receptor proteins in growth, differentiation, and suppression of malignancy: new approaches to therapy. Cancer Res 50:7093–7100[Abstract/Free Full Text]
  19. Burk RF 1991 Molecular biology of selenium with implications for its metabolism. FASEB J 5:2274–2279[Abstract]
  20. Ren X, Björnstedt M, Shen B, Ericson ML, Holmgren A 1993 Mutagenesis of structural half-cystine residues in human thioredoxin and effects on the regulation of activity by selenodiglutathione. Biochemistry 32:9701–9708[CrossRef][Medline]
  21. Miettinen PJ, Otonkoski T, Voutilainen R 1993 Insulin-like growth factor-II and transforming growth factor-{alpha} in developing human fetal pancreatic islets. J Endocrinol 138:127–136[Abstract/Free Full Text]
  22. Maake C, Reinecke M 1993 Immunohistochemical localization of insulin-like growth factor 1 and 2 in the endocrine pancreas of rat, dog, and man, and their coexistence with classical islet hormones. Cell Tissue Res 273:249–259[CrossRef][Medline]
  23. Bell GI, Gerhard DS, Fong NM, Sanchez-Pescador R, Rall LB 1985 Isolation of the human insulin-like growth factor genes: insulin-like growth factor II and insulin genes are contiguous. Proc Natl Acad Sci USA 82:6450–6454[Abstract/Free Full Text]
  24. Soares MB, Turken A, Ishii D, Mills L, Episkopou V, Cotter S, Zeitlin S, Efstratiadis A 1986 Rat insulin-like growth factor II gene. A single gene with two promoters expressing a multitranscript family. J Mol Biol 192:737–752[CrossRef][Medline]
  25. Rotwein P, Hall LJ 1990 Evolution of insulin-like growth factor II: characterization of the mouse IGF-II gene and identification of two pseudo-exons. DNA Cell Biol 9:725–735[Medline]
  26. Bell GI, Seino S 1990 The organization and structure of insulin genes. In: Okamoto H (ed) Molecular Biology of the Islets of Langerhans. Cambridge University Press, New York, pp 9–25
  27. Takeichi M 1990 Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem 59:237–252[CrossRef][Medline]
  28. Takeichi M 1991 Cadherin cell adhesion receptors as a morphogenic regulator. Science 251:1451–1455[Abstract/Free Full Text]
  29. Rouiller DG, Cirulli V, Halban PA 1991 Uvomorulin mediates calcium-dependent aggregation of islet cells, whereas calcium-independent cell adhesion molecules distinguish between islet cell types. Dev Biol 148:233–242[CrossRef][Medline]
  30. Dahl U, Sjödin A, Semb H 1996 Cadherin regulate aggregation of pancreatic ß-cells in vivo. Development 122:2895–2902[Abstract]
  31. Hutton JC, Christofori G, Chi WY, Edman U, Guest PC, Hanahan D, Kelly RB 1993 Molecular cloning of mouse pancreatic islet R-cadherin: differential expression in endocrine and exocrine tissue. Mol Endocrinol 7:1151–1160[Abstract/Free Full Text]
  32. Palmer JP, Asplin CM, Clemons P, Lyen K, Tatpati O, Raghu PK, Paquette TL 1983 Insulin antibodies in insulin-dependent diabetics before insulin treatment. Science 222:1337–1339[Abstract/Free Full Text]
  33. Baekkeskov S, Aanstoot H-J, Christgau S, Reetz A, Solimena M, Cascalho M, Folli F, Richter-Olesen H, DeCamilli P 1990 Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase. Nature 347:151–156[CrossRef][Medline]
  34. Rabin DU, Pleasic SM, Shapiro JA, Yoo-Warren H, Oles J, Hicks JM, Goldstein DE, Rae PMM 1994 Islet cell antigen 512 is a diabetes-specific islet autoantigen related to protein tyrosine phosphatases. J Immunol 152:3183–3188[Abstract]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont
Selenium, the Thyroid, and the Endocrine System
Endocr. Rev., December 1, 2005; 26(7): 944 - 984.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. Chu and M.-J. Tsai
Neuronatin, a Downstream Target of BETA2/NeuroD1 in the Pancreas, Is Involved in Glucose-Mediated Insulin Secretion
Diabetes, April 1, 2005; 54(4): 1064 - 1073.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
G. D. Sgarlato, C. L. Eastman, and H. H. Sussman
Panel of Genes Transcriptionally Up-regulated in Squamous Cell Carcinoma of the Cervix Identified by Representational Difference Analysis, Confirmed by Macroarray, and Validated by Real-Time Quantitative Reverse Transcription-PCR
Clin. Chem., January 1, 2005; 51(1): 27 - 34.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
A. M Johnston, G. Naselli, H. Niwa, T. Brodnicki, L. C Harrison, and L. J. Gonez
Harp (harmonin-interacting, ankyrin repeat-containing protein), a novel protein that interacts with harmonin in epithelial tissues
Genes Cells, October 1, 2004; 9(10): 967 - 982.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Miura, T. Ohta, C. I. Miura, and K. Yamauchi
Complementary Deoxyribonucleic Acid Cloning of Spermatogonial Stem Cell Renewal Factor
Endocrinology, December 1, 2003; 144(12): 5504 - 5510.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Wang, G. Webb, Y. Cao, and D. F. Steiner
Contrasting patterns of expression of transcription factors in pancreatic {alpha} and {beta} cells
PNAS, October 28, 2003; 100(22): 12660 - 12665.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. J. Kuerbitz, J. Pahys, A. Wilson, N. Compitello, and T. A. Gray
Hypermethylation of the imprinted NNAT locus occurs frequently in pediatric acute leukemia
Carcinogenesis, April 1, 2002; 23(4): 559 - 564.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. M. Perera, H. Martin, T. Seeherunvong, L. Kos, I. A. Hughes, J. R. Hawkins, and G. D. Berkovitz
Tescalcin, a Novel Gene Encoding a Putative EF-Hand Ca2+-Binding Protein, Col9a3, and Renin Are Expressed in the Mouse Testis during the Early Stages of Gonadal Differentiation
Endocrinology, January 1, 2001; 142(1): 455 - 463.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
E.K. Moses, K.A. Freed, J.R. Higgins, and S.P. Brennecke
Alternative forms of a novel aspartyl protease gene are differentially expressed in human gestational tissues
Mol. Hum. Reprod., October 1, 1999; 5(10): 983 - 989.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M J. Melia, N. Bofill, M. Hubank, and A. Meseguer
Identification of Androgen-Regulated Genes in Mouse Kidney by Representational Difference Analysis and Random Arbitrarily Primed Polymerase Chain Reaction
Endocrinology, February 1, 1998; 139(2): 688 - 695.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niwa, H.
Right arrow Articles by Cram, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niwa, H.
Right arrow Articles by Cram, D. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals