help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimura, H.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimura, H.
Right arrow Articles by Onaya, T.
Endocrinology Vol. 138, No. 4 1483-1490
Copyright © 1997 by The Endocrine Society


ARTICLES

Regulation of Thyrotropin Receptor Gene Expression in 3T3-L1 Adipose Cells is Distinct from Its Regulation in FRTL-5 Thyroid Cells

Hiroki Shimura, Kazutaka Haraguchi, Toyoshi Endo and Toshimasa Onaya

The Third Department of Internal Medicine, Yamanashi Medical University, Yamanashi 409–38, Japan

Address all correspondence and requests for reprints to: Toshimasa Onaya, M.D., Ph.D., Professor and Chairman, The Third Department of Internal Medicine, Yamanashi Medical University, 1110 Tamaho, Yamanashi 409–38, Japan. E-mail: onayat{at}res.yamanashi-med.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously have demonstrated that rat adipose tissue expresses TSH receptor (TSHR) messenger RNAs (mRNAs) at levels approaching those detected in the thyroid. Furthermore, we recently reported that TSHR mRNA is detected in fibroblast-like 3T3-L1 cells after their hormone-induced differentiation into adipocytes. TSH induces cAMP formation and lipolysis in differentiated 3T3-L1 cells. We now show that, in Northern blot analyses, TSH-induced down-regulation of TSHR mRNA levels, which can be duplicated by forskolin and dibutylyl cAMP, i.e. which is cAMP-mediated. We also have demonstrated that a ß-adrenergic stimulant, which stimulates cAMP formation in adipocytes, induces a down-regulation of TSHR mRNA levels in 3T3-L1 adipocytes. Nuclear run-on assays show that the ability of TSH/cAMP to decrease TSHR mRNA levels in 3T3-L1 cells reflects transcriptional regulation. This report also demonstrates that TSHR gene expression in 3T3-L1 adipocytes is regulated in a manner distinct from that observed in thyroid cells. Thus, in fully differentiated 3T3-L1 adipocytes, TSH-induced down-regulation of TSHR mRNA levels is evident within 1 h and is near maximum within 4 h after addition of TSH. A transient increase of TSHR gene expression, which has been demonstrated in FRTL-5 thyroid cells, was not observed in 3T3-L1 adipocytes. The down-regulation of TSHR gene expression induced by TSH/cAMP in 3T3-L1 cells is cycloheximide-insensitive, suggesting that continuous protein synthesis is not required for this process. In contrast, the down-regulation of TSHR gene expression observed in FRTL-5 cells is sensitive to cycloheximide. In both FRTL-5 thyroid cells and 3T3-L1 adipocytes, insulin or serum increased TSHR mRNA levels. Although insulin or serum was required for the TSH-induced down-regulation of TSHR mRNA levels in FRTL-5 thyroid cells, neither insulin nor serum was required for TSHR down-regulation in 3T3-L1 adipocytes. These findings demonstrate that TSH/cAMP regulates TSHR mRNA levels in adipocytes via a regulatory system distinct from that used in FRTL-5 cells. This report further demonstrates that adipose cells do not express thyroid transcription factor-1, which interacts with the TSHR promoter region in FRTL-5 cells, and that 3T3-L1 nuclear extracts exhibit a different binding activity to the cAMP-response element-like element in the TSHR promoter region compared with extracts from FRTL-5 cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE TSH receptor (TSHR) mediates the ability of TSH to affect the growth and function of thyroid cells (1, 2, 3, 4). Autoantibodies to the TSHR that increase thyroidal cAMP levels are present in patients with Graves’ disease and cause hyperfunctioning of the thyroid gland (5). Patients with Graves’ disease exhibiting exophthalmos and pretibial dermopathy often have high titer of thyroid-stimulating antibodies (6). Expression of TSHR in extrathyroidal cells may account for the extrathyroidal manifestations in Graves’ disease, especially because TSH binding activity in extrathyroidal tissues has been established (7, 8). The presence of TSHR messenger RNA (mRNA) in several extrathyroidal cells has been reported using the RT-PCR technique (9, 10, 11, 12).

TSHRs expressed in adipocytes have been shown to be functional (13, 14) and are suggested to be involved in the regulation of adipose function. Recently we reported that rat adipose tissue (15), as well as cultured rat preadipocytes (16), express similar amounts of TSHR mRNA as that detected in the thyroid gland. Marcus et al. (17) showed that human fat tissues also express TSHR and that TSH has significant effects on lipolysis in physiological concentrations (18). The maximum lipolytic effect of TSH was the same as that of isoproterenol in human adipocytes isolated from neonates (18). In addition, we recently showed that a full-length TSHR cDNA from rat fat cells was almost identical to that from the thyroid and that its function was indistinguishable from that in the thyroid (15). This clone differed by only one amino acid relative to the rat thyroid TSHR cDNA. When this fat TSHR cDNA was transfected into Chinese hamster ovary cells, TSH induced cAMP formation in a manner similar to that of Chinese hamster ovary cells transfected with thyroid TSHR cDNA (15). These observations suggest that TSHRs are involved in the regulation of adipose function and raise the question of whether TSH regulates TSHR gene expression in a manner similar to that observed in thyroid cells.

In rat FRTL-5 thyroid cells, TSH and the subsequent cAMP signal cause a time-dependent positive and then negative regulation of TSHR gene expression (19, 20). Insulin or insulin-like growth factor I is required for the autoregulation of TSHR gene expression by TSH/cAMP (20). Recently, the 5'-flanking region of the rat TSHR was cloned (21), and a minimal promoter region, -220 to -39 bp, that exhibits thyroid-specific expression and TSH/cAMP autoregulation of the TSHR was identified (21, 22, 23, 24, 25, 26). One regulatory element defined therein, -189 to -175 bp, binds thyroid transcription factor-1 (TTF-1) (24). The TTF-1 element contributes to thyroid-specific expression and to the cAMP autoregulation of the TSHR gene (24, 27). TSH/cAMP-increased TTF-1 phosphorylation results in up-regulation of TSHR gene expression (24, 27), whereas a TSH/cAMP-induced decrease in TTF-1 RNA levels is associated with down-regulation (24, 27). Additionally, single strand DNA-binding proteins (SSBPs) interact with an element contiguous with the 5'-end of the TTF-1 element (26). The SSBPs function conjointly with TTF-1 in the full expression and TSH/cAMP-induced negative regulation of TSHR in thyroid cells (26).

In contrast to thyroid cells, the control of TSHR gene expression in adipose cells is not understood. A suitable cell culture model for the study of adipocytes is 3T3-L1 cells, a fibroblast-like cell line derived from the Swiss mouse embryo that, upon reaching confluence, can be differentiated by hormonal induction into adipocytes (28, 29). We recently reported that a dramatic appearance of TSHR mRNA occurred after hormonal pulse-induced differentiation of 3T3-L1 cells into adipocytes by treatment with insulin, isobutylmethylxanthine (IBMX), and dexamethasone (30). This cultured cell system, therefore, is useful for studying the regulation of TSHR gene expression in adipocytes.

In the present study, we demonstrate that TSH and its cAMP signal down-regulate TSHR mRNA levels in differentiated 3T3-L1 cells in a manner distinct from that observed in thyroid cells. This report further explores the action of insulin on TSHR mRNA levels and TSH/cAMP-induced down-regulation in 3T3-L1 cells. These results suggest that TSHRs in adipose cells are autoregulated by TSH/cAMP, whose action is mediated by a different set of transcription factors from those used by thyroid cells. In this report, we also provide data showing differences between 3T3-L1 and FRTL-5 cells in nuclear proteins interacting with the TSHR promoter.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
3T3-L1 cells [American Type Culture Collection (ATCC), Rockville, MD, No. CCL 92.1] were grown in high glucose DMEM and supplemented with 10% calf serum. Confluent 3T3-L1 preadipocytes were induced to differentiate into adipocytes, as previously described (30, 31). Briefly, 1 day after confluence, cells were treated with media containing 10% FBS, 10 µg/ml insulin, 0.2 µg/ml dexamethasone, and 0.5 mM IBMX for 3 days. After 3 days, this medium was replaced by media supplemented with 10 µg/ml insulin and 10% FBS, and two days later, the media was replaced with DMEM supplemented with 10% FBS. Cells were used for studies 9 or 10 days after induction of differentiation.

FRTL-5 rat thyroid cells (ATCC No. CRL 8305) were grown in Coon’s modified Ham’s F-12 medium supplemented with 5% calf serum and a mixture of six hormones containing bovine TSH (10 mU/ml), insulin (10 µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml) (32).

RNA isolation and Northern analysis
Total RNA was isolated from cells by the guanidine isothiocyanate extraction method (33). For Northern blot analyses, 20 µg of total RNA was electrophoresed on a 1% agarose gel containing 0.66 M formaldehyde and blotted onto a nitrocellulose filter, as previously described (20, 24). A mouse thyroid TSHR cDNA (base 18–1575) (34) was obtained by the RT-PCR technique (35) from a mouse thyroid cDNA library primed with oligo(dT). The PCR product was subcloned into pCRII vector (Invitrogen, San Diego, CA) and sequenced its identity. Rat ß-actin cDNA was kindly donated by Dr. L. D. Kohn (NIH, Bethesda, MD). The rat TTF-1 probe was a fragment from +1 to +331 bp excised from the TTF-1 expression vector, RcCMV-THA; it was the kind gift of Dr. R. Di Lauro (Stazione Zoologica A. Dohrn, Naples, Italy) (36). All probes were radiolabeled using a random primer labeling kit (Takara Shuzo Co., Kyoto, Japan). Blots were hybridized in 50% formamide, 2.5x Denhardt’s solution, 5x SSPE (0.6 M NaCl, 40 mM sodium phosphate, 4 mM EDTA, pH 7.4), 0.1% SDS, 0.1 mg/ml heat-denatured salmon sperm DNA, and 5% dextran sulfate. The filters were then washed three times at room temperature in 2x SSC (0.3 M NaCl, 30 mM sodium acetate, pH 7.0) containing 0.1% SDS, followed by three washes three times at 53 C in 0.1x SSC-0.1% SDS. The filters were exposed to an imaging plate and were analyzed using a BAS2000 image analyzer (Fuji Film Co., Tokyo, Japan).

In vitro nuclear run-on analysis
Nuclear run-on experiments were performed as described (37, 38). Briefly, nuclei isolated from 3T3-L1 cells, before or after induction of differentiation, were incubated at 26 C for 45 min in 100 µl reaction mixtures containing 16% glycerol, 20 mM HEPES (pH 8.0), 0.04 mM EDTA, 0.5 mM MnCl2, 90 mM NH4Cl, 5 mM MgCl2, 2 mM dithiothreitol, and 0.4 mM each of ATP, cytidine 5'-triphosphate, and GTP, and 0.2 mCi [{alpha}-32P]uridine 5'-triphosphate. The reaction was stopped by the addition of 100 µl of a stop mixture containing 200 µg/ml ribonuclease (RNase)-free deoxyribonuclease I, 200 µg/ml proteinase K, 200 µg/ml yeast transfer RNA, 20 mM HEPES (pH 8.0), and 20 mM CaCl2, followed by further incubation for 20 min at room temperature. Radiolabeled RNA was purified and hybridized to 4 µg DNA immobilized on nitrocellulose filters. Four micrograms each of mouse TSHR cDNA, rat ß-actin cDNA, and pGEM7Zf(+) (Promega, Madison, WI) plasmid DNA (to control for nonspecific binding) were immobilized on the nitrocellulose filters. Hybridization was performed at 45 C for 48 h in 50% formamide, 5x SSPE, 10x Denhardt’s solution, 0.1% SDS, 0.25 mg/ml heat-denatured salmon sperm DNA, 50 µg/ml poly(A), and 25 µg/ml yeast transfer RNA. Filters were then washed three times in 2x SSC-0.1% SDS for 30 min at room temperature, followed by washes in 0.1x SSC-0.1% SDS at 45 C. Filters were next washed twice in 0.2x SSC at 37 C for 5 min and incubated in 2x SSC containing 10 µg/ml RNase A and 350 U/ml RNase T1 at 37 C for 30 min. After incubation, the filters were washed twice in 0.2x SSC-0.1% SDS at room temperature and washed again in 0.2x SSC. Filters were exposed to an imaging plate and analyzed using a BAS2000 image analyzer (Fuji).

Nuclear extracts
Nuclear extracts were prepared exactly as previously described (21, 22, 23, 24, 25, 26, 27). 3T3-L1 cell extracts were prepared from cells 9 or 10 days after induction of differentiation. FRTL-5 nuclear extracts were from cells maintained in medium depleted of TSH for 7 days after they were grown to near confluency in medium containing TSH.

Electrophoretic mobility shift assays
Electrophoretic mobility shift assays were performed, as previously described (21, 22, 23, 24, 25, 26, 27), using a double-stranded oligonucleotide containing the rat TSHR promoter -146/-114 (relative to the translation start site) sequence (CCAGCGATGAGGTCACAGCCCCTTGGAGCCCTC; the underlining indicates the cAMP-response element (CRE)-like sequence).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TSH down-regulates TSHR mRNA levels in differentiated 3T3-L1 adipocytes
Fibroblast-like 3T3-L1 cells were fully differentiated into adipocytes in the presence of insulin, dexamethasone, and IBMX. We previously demonstrated that the steady-state TSHR mRNA level increases during differentiation of 3T3-L1 cells. Northern blot analysis demonstrated that TSHR mRNA is not detectable in undifferentiated 3T3-L1 cells and does not appear until the 5th day after the initiation of differentiation (Fig. 1AGo, lane 2, and Ref.30). TSHR mRNA becomes evident by day 7 and reaches a maximum sustained level at day 11 (30). It is important to note that the mRNA remains at maximum levels for 5 days after the inducing hormones are removed from the cells (Fig. 1AGo, lanes 1 and 3). Despite this stable expression, treatment of differentiated cells with TSH (10 mU/ml) for 24 h caused a decrease in TSHR mRNA levels (Fig. 1Go). Down-regulation of TSHR mRNA levels could be duplicated by forskolin (10 µM) or dibutyryl cAMP (1 mM) treatment, both of which increased cAMP levels (Fig. 1Go).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Effects of TSH, forskolin (FSK), dibutylyl cAMP (DBC), and isoproterenol on expression of TSHR and ß-actin mRNA expression in 3T3-L1 cells. Equal amounts of total RNA (20 µg per lane) are subjected to sequential Northern analyses using mouse TSHR and ß-actin cDNA probes (A). Confluent 3T3-L1 cells (preadipo, lane 2), grown in DMEM with 10% calf serum, are induced to differentiate into adipocytes using two different protocols. Cells are either treated with insulin (I) and 10% FBS (F) (IF) for 7 days, preceded by 3 days of treatment with insulin, dexamethasone (D), IBMX (X), and FBS (IDXF) (lane 1). Alternatively, cells (adipo) are treated with FBS for 5 days followed by treatments with IDXF (3 days) and IF (2 days), as described in the Materials and Methods (lane 3), and then exposed to TSH (10 mU/ml) (lane 4), forskolin (10 µM) (lane 5), or DBC (1 mM) (lane 6) for 24 h. The periods of incubation with hormones are indicated in parentheses (days). B, To investigate the effect of isoproterenol on TSHR mRNA levels in differentiated 3T3-L1 cells, RNA is prepared from cells exposed to the indicated concentrations of isoproterenol for 4 h, and equal amounts (20 µg/lane) are subjected to sequential Northern blot analyses using the TSHR and ß-actin probes. Quantitation is performed using a BAS2000 image analyzer (Fuji). The TSHR/ß-actin ratio is calculated and compared with the control (lane 3, adipo). Values are expressed as a percent of the control and are means ± SEM of three separate experiments with different batches of cells.

 
Recent reports (39, 40) have indicated that differentiation of cultured preadipocytes to adipocytes is accompanied by the induction of ß1- and ß3-adrenergic receptor gene expression, which are involved in the production of cAMP and lipolysis after stimulation with ß-adrenergic agonists. To elucidate whether cAMP signal generated by ß-adrenergic receptors also causes the down-regulation of TSHR gene expression, the effect of isoproterenol on TSHR mRNA levels was investigated in differentiated 3T3-L1 cells. Treatment of 3T3-L1 adipocytes with 10-9 to 10-5 M isoproterenol for 4 h resulted in a decrease in TSHR mRNA levels, with a maximum 60% inhibition (Fig. 1BGo). This result indicates that catecholamines, which are major regulators of lipid metabolism in adipocytes, also down-regulate TSHR mRNA levels, likely via a cAMP-mediated pathway, in adipocytes.

Transcriptional rate (nuclear run-on) assays revealed that both the differentiation-induced increase and the TSH/cAMP-induced down-regulation of TSHR mRNA levels occurs at the level of gene transcription. Nuclei were isolated from undifferentiated 3T3-L1 cells or 10 days after the initiation of differentiation in the presence or absence of TSH or forskolin for 4 h. TSHR transcripts were barely detectable in nuclei isolated from undifferentiated cells, whereas transcripts were abundant in nuclei isolated from fully differentiated cells (Fig. 2AGo). Treatment of differentiated cells with TSH or forskolin for 4 h caused a decrease in TSHR transcripts. No change was detected in levels of ß-actin transcripts (Fig. 2AGo). Although [32P] uridine 5'-triphosphate (UTP)-labeled nuclear RNA isolated from differentiated cells hybridized slightly to the control plasmid, the differentiation-induced increase and TSH, as well as forskolin-induced down-regulation of TSHR mRNA transcription, were still statistically significant when the intensities generated by nonspecific hybridization were subtracted (Fig. 2BGo). These results demonstrate that TSH down-regulates the transcription rate of the TSHR gene via its cAMP signal in differentiated 3T3-L1 adipocytes.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 2. Transcriptional nuclear run-on analysis of the TSHR gene in undifferentiated and differentiated 3T3-L1 cells. Nuclei are isolated from 3T3-L1 cells before (preadipo) and after induction of differentiation (adipo) with the same hormonal treatment as in Fig. 1AGo, lane 3. Nuclei are then isolated from differentiated 3T3-L1 cells exposed to TSH (10 mU/ml) or forskolin (FSK) (10 µM) for 4 h. [32P]UTP-labeled RNA transcripts isolated from nuclei are used in hybridization reactions with either mouse TSHR cDNA, control ß-actin cDNA, or control empty vector pGEM7Z plasmid DNA as indicated. All filters are hybridized and washed, as described in Materials and Methods. Quantitation is performed using a BAS2000 image analyzer (Fuji). The TSHR/ß-actin ratio is calculated after subtraction of values generated by nonspecific hybridization to control empty plasmid DNA. The ratio from differentiated 3T3-L1 cells (adipo) not exposed to TSH or forskolin is set at 100% (B). Data are mean ± SEM of three separate experiments with different batches of cells.

 
Figure 3Go depicts the dose-response effect of TSH incubated for 24 h on TSHR mRNA levels in differentiated 3T3-L1 cells. The TSH-dependent down-regulation of TSHR mRNA levels in 3T3-L1 adipocytes was compared with that in FRTL-5 thyroid cells; the concentrations of TSH required to cause the same percentage of decrease in TSHR mRNA levels in 3T3-L1 adipocytes were higher than those required in FRTL-5 cells. However, there are no significant differences at all points other than at 10 µU/ml. It is important to note that a physiological concentration of TSH (10 µU/ml) caused a small, but significant (P < 0.05), decrease in TSHR mRNA levels.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Effect of different concentrations of TSH on expression of TSHR mRNA in 3T3-L1 adipocytes and FRTL-5 thyroid cells. 3T3-L1 cells are induced to differentiate into adipocytes, as described in the Materials and Methods. FRTL-5 cells are maintained for 7 days without any TSH in the medium. RNA is prepared from cells exposed to the indicated concentrations of TSH for 24 h, and equal amounts (20 µg/lane) are subjected to sequential Northern blot analysis using the TSHR and ß-actin probes. The TSHR/ß-actin ratios are expressed as a percent of control and are means ± SEM of three separate experiments with different batches of cells.

 
TSHR gene expression in 3T3-L1 adipocytes is regulated in a manner distinct from that in thyroid cells
In FRTL-5 cells, the TSH-induced decrease in TSHR gene expression was preceded by a short 2-h period of increased mRNA levels. The decrease, however, was measurable after 4 h and at maximum 8 h after the addition of TSH (Fig. 4Go and Ref.20). In contrast, the TSH-induced down-regulation of TSHR mRNA levels in differentiated 3T3-L1 was evident at 1 h and at maximum within 4 h after addition of TSH (Fig. 4Go). There was no transient increase of TSHR gene expression in 3T3-L1 cells. These results show that the expression of the TSHR gene in 3T3-L1 adipocytes is regulated in a manner distinct from that in FRTL-5 thyroid cells.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Kinetics of TSH effects on TSHR mRNA levels in 3T3-L1 adipocytes and FRTL-5 thyroid cells. 3T3-L1 cells are induced to differentiate into adipocytes, as described in the Materials and Methods. FRTL-5 cells are maintained for 7 days with no TSH in the medium. RNA is prepared from the cells exposed to TSH for the indicated times, and equal amounts (20 µg/lane) are subjected to sequential Northern analysis using the TSHR and ß-actin probes. The TSHR/ß-actin ratios are expressed as a percent of control and are means ± SEM of three separate experiments with different batches of cells. The inset shows a typical experiment using differentiated 3T3-L1 cells.

 
When given to 3T3-L1 adipocytes simultaneously with TSH, cycloheximide had only a small inhibitory effect on the ability of TSH to down-regulate TSHR gene expression (Fig. 5AGo). The effect of the cycloheximide on the down-regulation of TSHR mRNA in adipocytes was emphasized by the data indicating that cycloheximide had no effect on the down-regulation of TSHR mRNA levels induced by forskolin in 3T3-L1 adipocytes. This result suggests that TSH/cAMP-induced down-regulation of TSHR mRNA levels, at least in part, does not require continuous protein synthesis. In contrast, Saji et al. (20) and our data (Fig. 5BGo) show that cycloheximide abolishes the ability of TSH/cAMP to induce the down-regulation of TSHR mRNA in FRTL-5 cells. These data also indicate that TSH/cAMP regulates TSHR mRNA levels in adipocytes via a regulatory mechanism distinct from that used in FRTL-5 cells.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 5. Effect of cycloheximide (CHx) on the TSH- and forskolin (FSK)-induced down-regulation of TSHR mRNA levels. 3T3-L1 cells are induced to differentiate into adipocytes, as described in Materials and Methods. FRTL-5 cells are maintained 7 days with no TSH in the medium. Cells are exposed to TSH (10 mU/ml) or forskolin (10 µM) is exposed in the presence or absence of cycloheximide (10 µM) for 4 h (3T3-L1) or 24 h (FRTL-5). Northern analyses are performed and quantitated as described. The data are presented as TSHR mRNA levels per µg of total RNA applied to the gels; ethidium bromide staining confirmed that equal amounts of RNA were applied to each lane, because TSH induces a marked decrease in ß-actin mRNA levels when FRTL-5 cells were incubated with cycloheximide (21). Data are means ± SEM of three separate experiments with different batches of cells.

 
In FRTL-5 thyroid cells, insulin and 5% serum increased TSHR mRNA levels (Fig. 6BGo and Ref.20). This phenomenon was observed also in differentiated 3T3-L1 cells; treatment with insulin or 10% FBS for 48 h increased TSHR mRNA levels in fully differentiated 3T3-L1 cells (Fig. 6AGo). Insulin and serum also were required for TSH-induced down-regulation of TSHR mRNA levels in FRTL-5 thyroid cells (Fig. 6BGo and Ref.20). Thus, TSH cannot down-regulate TSHR mRNA levels in FRTL-5 cells maintained in basal medium with neither TSH, insulin, nor serum (Fig. 6BGo and Ref.20). In contrast, TSH down-regulates its receptor mRNA in 3T3-L1 adipocytes, even when they are maintained in medium without serum or insulin (Fig. 6AGo), despite the fact that insulin and serum up-regulate TSHR mRNA levels in these cells. This again emphasizes the difference in TSHR mRNA regulation between 3T3-L1 adipocytes and FRTL-5 thyroid cells.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Effects of insulin and serum on the TSH- or forskolin (FSK)-induced down-regulation of TSHR mRNA levels. A) Eight days after induction of differentiation, media is replaced with either medium without insulin or FBS, medium with insulin only, or medium with FBS only. Cells are maintained in this media for 2 days and are exposed to TSH (10 mU/ml) for 24 h. B) FRTL-5 cells are maintained for 6 days in medium containing 0.2% calf serum without TSH and insulin (basal) or in media containing insulin or 5% calf serum and then exposed to TSH for 24 h. RNA is isolated, and Northern blot analyses are performed as described. The ratio of TSHR to ß-actin mRNA levels is calculated with the ratio of TSHR mRNA to ß-actin mRNA in cells maintained in medium alone set at 100%. Data are means ± SEM of three separate experiments with different batches of cells.

 
Differences in transcription factors interacting with the TSHR promoter region in 3T3-L1 adipocytes and FRTL-5 thyroid cells
TTF-1 interacts with the TSHR promoter region and plays important roles in the expression and the hormonal regulation of TSHR gene in FRTL-5 thyroid cells (24, 27). To determine whether TTF-1 also interacts with the TSHR promoter region in adipose cells, we performed Northern analyses using a TTF-1 cDNA (36) as a probe. As previously reported (24), expression of TTF-1 mRNA is observed in FRTL-5 thyroid cells. In contrast, no TTF-1 transcripts were detected in 3T3-L1 cells before and after the induction of differentiation, as well as in rat adipose tissue. This result indicates that TTF-1 is not involved in the regulations of the TSHR gene in adipose cells.

A CRE-like element, TGAGGTCA, exists in the minimal promoter region of the TSHR gene and contributes to its constitutive expression in thyroid cells (22). It also has been revealed that the enhancer activity of TTF-1 on the TSHR promoter totally depended on the CRE-like site (24). Furthermore, a recent report (41) showed that the CRE-like site also was involved in TSH-induced regulation of TSHR gene via the induction of the inducible cAMP early repressor (ICER) in FRTL-5 cells. To investigate nuclear proteins interacting with the CRE-like sequence in adipose cells, we performed electrophoretic mobility shift assays. Nuclear extract from differentiated 3T3-L1 cells exhibited protein/DNA complexes (A and C complexes) similar to those formed with FRTL-5 nuclear extract. However, a protein/DNA complex (B complex), which was not detectable in the FRTL-5 lane, was formed in the 3T3-L1 lane. Although the functional role of this nuclear protein is unclear at this time, we hypothesize that the CRE-like element in adipocytes may exhibit activities different from those in FRTL-5 cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present report, the down-regulation of TSHR gene expression induced by TSH in 3T3-L1 adipocytes was investigated. We have shown previously that treatment of fibroblast-like 3T3-L1 cells with insulin, after exposure to insulin, dexamethasone, and IBMX, induced expression of TSHR mRNA. TSHR mRNA expression was observed concurrently with morphologic differentiation, as assessed by the formation of lipid droplets in the cells (30). We now show that expression of the TSHR gene is irreversibly induced during hormonal differentiation in 3T3-L1 cells. The nature of this irreversible switch is underscored by the fact that expression of the TSHR gene, as well as the adipocytic phenotype, does not depend on continued hormonal stimulation. TSH causes an increase in cAMP levels in differentiated 3T3-L1 adipocytes within 30 min (30). Despite the stable expression of the TSHR gene after a hormonal pulse that included the cAMP-generating agent, IBMX, exposure of the differentiated 3T3-L1 cells to TSH results in a decrease in TSHR mRNA levels. Because the TSH-induced down-regulation also can be mimicked by a cAMP analog and forskolin, this TSH action is presumed to be cAMP mediated. We demonstrate that the increase in TSHR mRNA during 3T3-L1 cell differentiation and the TSH/cAMP-mediated decrease in TSHR mRNA levels occur at the level of transcription.

In FRTL-5 thyroid cells, the hormonal regulation of TSHR gene expression has been well characterized (20). As previously reported (20), short exposures to TSH (2 h) increases TSHR mRNA levels; however, TSHR mRNA levels decline thereafter. Saji et al. (20) also have demonstrated that the TSH-induced up-regulation, as well as the down-regulation, is transcriptional. In contrast, in 3T3-L1 adipocytes, TSH treatment resulted in a decrease in TSHR mRNA levels without any transient increase at early time points (Fig. 4Go). This difference may be caused by the lack of TTF-1 expression in 3T3-L1 adipocytes (Fig. 7AGo). The minimal promoter region of the TSHR gene has a TTF-1-binding element that plays an important role in TSHR gene expression in thyroid cells (24) and is, at least in part, involved in the TSH/cAMP-induced autoregulation of TSHR gene expression (24, 26, 27). TSH causes a time-dependent increase, and then decrease, in the amount of TTF-1/DNA complex formed in gel mobility shift assays using nuclear extracts from FRTL-5 thyroid cells (24, 27). It has been hypothesized that the early increases in TSHR gene expression are associated with increased TTF-1 binding to the TSHR promoter mediated by the activation of protein kinase A (PKA) (24, 27). However, the hypothesis that TTF-1 is involved in TSH/cAMP regulation is still a matter of controversy. Christophe-Hobertus et al. (42) reported that TTF-1 is not involved in the regulation of thyroglobulin gene expression by TSH/cAMP. Kambe et al. (43) recently showed that TSH increased DNA-binding activity of TTF-1 in whole cell extracts prepared without dithiothreitol.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 7. Differences in transcription factors interacting with the TSHR promoter region in 3T3-L1 adipocytes and FRTL-5 thyroid cells. (A) Total RNAs are prepared from rat liver, rat epididymal fat pad, 3T3-L1 cells before (preadipo) and after (adipo) the induction of differentiation, and FRTL-5 cells maintained in the medium without TSH for 7 days. Equal amounts of total RNA (20 µg per lane) are subjected to sequential Northern analyses using rat TTF-1 and ß-actin cDNA probes. (B) One µg of nuclear extracts from FRTL-5 cells maintained in the absence of TSH and differentiated 3T3-L1 cells are used in electrophoretic mobility shift assays. Synthetic oligonucleotide, identical to the promoter region of rat TSHR gene spanning -146 to -114 bp, is used as a probe.

 
In Fig. 4Go, if the transient increase in TSHR mRNA levels in FRTL-5 cells were subtracted, the 3T3-L1 curve would overlap with the FRTL-5 curve. This may suggest a shared mechanism of down-regulation of TSHR gene expression in both cell types. It has been reported that TTF-1 is not the only factor involved in down-regulation of TSHR gene expression in FRTL-5 cells (23, 24, 26, 27, 44). Ubiquitously expressed SSBPs, which interact with elements contiguous with the TTF-1 elements, also are involved in the down-regulation of TSHR gene expression (26). It is possible that these proteins play an important role in the down-regulation of TSHR gene expression in adipose cells.

Cycloheximide inhibited the ability of TSH and forskolin to down-regulate TSHR gene expression in FRTL-5 cells (Fig. 5Go and Ref.20). The TSH-induced decrease in TTF-1/TSHR complex formation, which coincides with TSH-induced down-regulation of TTF-1 and TSHR mRNA levels in FRTL-5 cells, is a cycloheximide-sensitive process (24). Although 3T3-L1 adipocytes do not express TTF-1, TSH and a cAMP-mediated signal down-regulate TSHR gene expression in 3T3-L1 adipocytes. Thus, it was of interest that the TSH/cAMP-induced down-regulation in 3T3-L1 adipocytes is not affected by cycloheximide (Fig. 5Go). This result suggests that, in 3T3-L1 cells, the TSH/cAMP-induced down-regulation of TSHR mRNA levels does not require continuous protein synthesis, or that the TSH-activated inhibitory factor in 3T3-L1 cells may have a longer half-life than the same factor in FRTL-5 cells. TSHR suppressor element-binding protein-1, which is ubiquitously expressed, has been cloned (44). This protein suppresses TSHR promoter activity, and its DNA-binding activity is enhanced by PKA-induced phosphorylation (44). Although it is not yet clarified, the TSH/cAMP-induced down-regulation of TSHR gene expression in 3T3-L1 adipocytes may be the result of interactions with TSHR suppressor element-binding protein-1, as well as nuclear factors expressed only in fat cells.

The present report shows further that insulin and serum are positive regulators of TSHR mRNA levels in 3T3-L1 adipocytes. In FRTL-5 cells, it has been revealed that insulin, insulin-like growth factor I, and serum up-regulated the transcription of TSHR gene (20). The difference, however, is that insulin/serum is required for TSH/cAMP to down-regulate TSHR gene expression in FRTL-5 cells (Fig. 6BGo and Ref.20) but not in 3T3-L1 adipocytes (Fig. 6AGo). The region immediately upstream of the TTF-1 site in TSHR gene was identified as a insulin-response element (IRE) (25). This IRE seems to function in a thyroid-specific manner, because mutation of the TTF-1 site results in the loss of IRE function in FRTL-5 cells (25). These findings lead us to a hypothesis that insulin-regulating factors distinct from those in FRTL-5 may be involved in the transcriptional regulation of TSHR gene by insulin/serum in 3T3-L1 adipocytes.

Catecholamines play a major role in lipid metabolism via ß-adrenergic receptors. It has been reported that increased levels of cAMP in adipose cells induce an increase in ß3-adrenergic receptors (40) and a loss of ß1- and ß2-adrenergic receptors (39). The present study confirms that the cAMP signal generated by a ß-adrenergic agonist induces a down-regulation of TSHR mRNA levels. This result suggests that TSHR and ß-adrenergic receptors are functionally interrelated in adipose cells. In contrast, this was not found in thyroid cells, because we have shown previously that cultured thyroid cells (FRTL) do not express ß-adrenergic receptors (45). In FRTL-5 cells, a ß-adrenergic agonist also failed to induce cAMP formation (46)

Transcriptional regulations mediated by cAMP signal in adipose cells have been reported in several genes. cAMP mediates the up-regulation of the ß3-adrenergic receptor (40), GLUT1 (47), adipose fatty acid-binding protein (48), and uncoupling protein genes (49), as well as the down-regulation of ß1- and ß2-adrenergic receptor (39), GLUT4 (47), and S14 genes (50). However, most of the regulatory mechanisms in these genes remain unclear. This report shows that TSH and the cAMP-induced pathway down-regulate TSHR gene expression in differentiated 3T3-L1 cells in a manner distinct from that observed in thyroid cells. Although some of the transcription factors interacting with the TSHR promoter may be common in adipose and thyroid cells, it is reasonable to predict that a set of transcription factors distinct from those used in thyroid cells will mediate the hormonal regulation of TSHR gene expression, as well as its differentiation-dependent expression, in adipocytes. In this report, we confirmed no expression of TTF-1 in adipose cells. The present report also identified that the CRE-like sequence in the minimal TSHR promoter region and nuclear extract from 3T3-L1 adipocytes formed a protein/DNA complex that was not detectable with the FRTL-5 nuclear extract. These results reinforce our hypothesis that adipose cells have different regulatory mechanisms for the TSHR gene expression from those in FRTL-5 cells. Characterization of the TSHR promoter in adipose cells is under current investigation.

Received August 23, 1996.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kohn LD, Saji M, Akamizu T, Ikuyama S, Isozaki O, Kohn AD, Santisteban P, Chan JYC, Bellur S, Rotella CM, Alvarez FV, Aloj SM 1990 Receptors of the thyroid gland: the thyrotropin receptor is only the first violinist of a symphony orchestra. In: Ekholm R, Kohn LD, Wollman S (eds) Control of the Thyroid: Regulation of its Normal Growth and Function. Plenum Press, New York, pp 151–210
  2. Dumont JE, Lefort A, Libert F, Parmentier M, Raspe E, Reuse F, Maenhaut C, Roger P, Corvilain B, Laurent E, Mockel J, Lamy F, Van Sande J, Vassart G 1990 Transducing systems in the control of human thyroid cell function, proliferation, and differentiation. In: Ekholm R, Kohn LD, Wollman S (eds) Control of the Thyroid: Regulation of its Normal Growth and Function. Plenum Press, New York, pp 357–372
  3. Vassart G, Dumont JE 1992 The thyrotropin receptor and regulation of thyrocyte function and growth. Endocr Rev 13:596–611[Abstract/Free Full Text]
  4. Kohn LD, Saji M, Kosugi M, Ban T, Giuliani C, Hidaka A, Shimura H, Shimura Y, Okajima F 1993 The synthesis and secretion of thyroid hormones: regulation by multiple hormones and signals which can be subverted by autoantibodies to the thyrotropin receptor. In: Troncone L, Shapiro B, Satta MA, Monaco F (eds) Thyroid Diseases: Basic Science, Pathology, Clinical and Laboratory Diagnosis. CRC Press, Boca Raton, pp 59–118
  5. Onaya T, Kotani M, Yamada T, Ochi Y 1973 New in vitro tests to detect the thyroid stimulator in sera from hyperthyroid patients by measuring colloid droplet formation and cyclic AMP in human thyroid slices. J Clin Endocrinol Metab 36:859–866[Abstract/Free Full Text]
  6. Morris III JC, Hay ID, Nelson RE, Jiang NS 1988 Clinical utility of thyrotropin-receptor antibody assays: comparison of radioreceptor and bioassay methods. Mayo Clin Proc 63:707–717[Medline]
  7. Mullin BR, Lee G, Ledley FD, Winland RJ, Kohn LD 1976 Thyrotropin interactions with human fat cell membrane preparations and the finding of soluble thyrotropin binding component. Biochem Biophys Res Commun 69:55–62[CrossRef][Medline]
  8. Davies TF, Teng CS, McLachlan SM, Smith BR, Hall A 1978 Thyrotropin receptors in adipose tissue, retro-orbital tissue and lymphocytes. Mol Cell Endocrinol 9:303–310[CrossRef][Medline]
  9. Endo T, Ohno M, Kotani S, Gunji K, Onaya T 1993 Thyrotropin receptor in non-thyroid tissues. Biochem Biophys Res Commun 190:774–779[CrossRef][Medline]
  10. Francis T, Burch HB, Cai WY, Lukes Y, Peele M, Carr FE, Wartofsky L, Burman KD 1991 Lymphocytes express thyrotropin receptor-specific mRNA as detected by the PCR technique. Thyroid 1:223–228[Medline]
  11. Feliciello A, Porcellini A, Ciullo I, Bonavolonta G, Avvedimento EV, Fenzi G 1993 Expression of thyrotropin-receptor mRNA in healthy and Graves’ disease retro-orbital tissue. Lancet 342:337–338[CrossRef][Medline]
  12. Heufelder AE, Dutton CM, Sarkar G, Donovan KA, Bahn RS 1993 Detection of TSH receptor RNA in cultured fibroblasts from patients with Graves’ ophthalmopathy and pretibial dermopathy. Thyroid 3:297–300[Medline]
  13. Birnbaumer L, Rodbell M 1969 Adenyl cyclase in fat cells. II. Hormone receptors. J Biol Chem 244:3477–3482[Abstract/Free Full Text]
  14. Farmer SW, Ramachandran J, Papkoff H 1972 Lipolytic activity of gonadotropins and their subunits. Endocrinology 91:543–548[Abstract/Free Full Text]
  15. Endo T, Ohta K, Haraguchi K, Onaya T 1995 Cloning and functional expression of a thyrotropin receptor cDNA from rat fat cells. J Biol Chem 270:10833–10837[Abstract/Free Full Text]
  16. Haraguchi K, Shimura H, Lin L, Endo T, Onaya T 1996 Differentiation of rat preadipocytes is accompanied by expression of thyrotropin receptors. Endocrinology 137:3200–3205[Abstract]
  17. Janson A, Karlsson FA, Micha-Johansson G, Bolme P, Bronnegard M, Marcus C 1995 Effects of stimulatory and inhibitory thyrotropin receptor antibodies on lipolysis in infant adipocytes. J Clin Endocrinol Metab 80:1712–1716[Abstract/Free Full Text]
  18. Marcus C, Ehren H, Bolme P, Arner P 1988 Regulation of lipolysis during the neonatal period. Importance of thyrotropin. J Clin Invest 82:1793–1797
  19. Akamizu T, Ikuyama S, Saji M, Kosugi S, Kozak C, Mc Bride OW, Kohn LD 1990 Cloning, chromosomal assignment, and regulation of the rat thyrotropin receptor: expression of the gene is regulated by thyrotropin, agents that increase cAMP levels, and thyroid autoantibodies. Proc Natl Acad Sci USA 87:8677–8681
  20. Saji M, Akamizu T, Sanchez M, Obici S, Avvedimento E, Gottesman ME, Kohn LD 1992 Regulation of thyrotropin receptor gene expression in rat FRTL-5 thyroid cells. Endocrinology 130:520–533[Abstract/Free Full Text]
  21. Ikuyama S, Niller HH, Shimura H, Akamizu T, Kohn LD 1992 Characterization of the 5'-flanking region of the rat thyrotropin receptor gene. Mol Endocrinol 6:793–804[Abstract/Free Full Text]
  22. Ikuyama S, Shimura H, Hoeffler JP, Kohn LD 1992 Role of the cyclic adenosine 3', 5'-monophosphate response element in efficient expression of the rat thyrotropin receptor promoter. Mol Endocrinol 6:1701–1715[Abstract/Free Full Text]
  23. Shimura H, Ikuyama S, Shimura Y, Kohn LD 1993 The cAMP response element in the rat thyrotropin receptor promoter: regulation by each decanucleotide of a flanking tandem repeat uses different, additive, and novel mechanisms. J Biol Chem 268:24125–24137[Abstract/Free Full Text]
  24. Shimura H, Okajima F, Ikuyama S, Shimura Y, Kimura S, Saji M, Kohn LD 1994 Thyroid-specific expression and cyclic adenosine 3', 5'-monophosphate autoregulation of the thyrotropin receptor gene involves thyroid transcription factor-1. Mol Endocrinol 8:1049–1069[Abstract/Free Full Text]
  25. Shimura Y, Shimura H, Ohmori M, Ikuyama S, Kohn LD 1994 Identification of a novel insulin-responsive element in the rat thyrotropin receptor promoter. J Biol Chem 269:31908–31914[Abstract/Free Full Text]
  26. Shimura H, Shimura Y, Ohmori M, Ikuyama S, Kohn LD 1995 Single strand DNA-binding proteins and thyroid transcription factor-1 conjointly regulate thyrotropin receptor gene expression. Mol Endocrinol 9:527–539[Abstract/Free Full Text]
  27. Ohmori M, Shimura H, Shimura Y, Kohn LD 1995 Characterization of an up-stream thyroid transcription factor-1-binding site in the thyrotropin receptor promoter. Endocrinology 136:269–282[Abstract]
  28. Green H, Kehinde O 1974 Sublines of mouse 3T3 cells that accumulate lipid. Cell 1:113–116
  29. Green H, Kehinde O 1975 An established preadipose cell line and its differentiation in culture II. Factors affecting the adipose conversion. Cell 5:19–27[CrossRef][Medline]
  30. Haraguchi K, Shimura H, Lin L, Saito T, Endo T, Onaya T 1996 Functional expression of thyrotropin receptor in differentiated 3T3–L1 cells: a possible model cell line of extrathyroidal expression of thyrotropin receptor. Biochem Biophys Res Commun 223:193–198[CrossRef][Medline]
  31. McGehee RE, Ron D, Brasier AR, Habener JF 1993 Differentiation-specific element: a cis-acting developmental switch required for the sustained transcriptional expression of the angiotensinogen gene during hormonal-induced differentiation of 3T3–L1 fibroblasts to adipocytes. Mol Endocrinol 7:551–560[Abstract/Free Full Text]
  32. Ambesi-Impiombato FS 1986 Fast-growing thyroid cell. US Patent 4,608,341
  33. Sambrook J, Fritsch EF, Maniatis T 1989 Extraction, purification, and analysis of messenger RNA from eukaryotic cells. In: Nolan C (ed) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, vol 1:7.17.87
  34. Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM, Taylor NA, Puett D, Jin S 1994 Identification of a point mutation in the thyrotropin receptor of the hyt/hyt hypothyroid mouse. Mol Endocrinol 8:129–138[Abstract/Free Full Text]
  35. Davis LG, Kuehl WM, Battey JF 1994 PCR amplification from cDNA templates. In: Greenfield S (ed) Basic Methods in Molecular Biology, 2nd ed. Appleton & Lange, Norwalk, pp 135–139
  36. Guazzi S, Price M, De Felice M, Damante G, Mattei M-G, Di Lauro R 1990 Thyroid neclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J 9:3631–3639[Medline]
  37. Endo T, Shimura H, Saito T, Ikeda M, Ohmori M, Onaya T 1991 Thyrotropin stimulates glucose-regulated protein (GRP78) gene expression in rat functional thyroid epithelial cells, FRTL. Mol Endocrinol 5:905–910[Abstract/Free Full Text]
  38. Yokomori N, Iwasa Y, Aida K, Inoue M, Tawata M, Onaya T 1991 Transcriptional regulation of ferritin messenger ribonucleic acid levels by insulin in cultured rat glioma cells. Endocrinology 128:1474–1480[Abstract/Free Full Text]
  39. Guest SJ, Hadcockn JR, Watkins DC, Malbon CC 1990 ß1- and ß2-adrenergic receptor expression in differentiating 3T3–L1 cells. J Biol Chem 265:5370–5375[Abstract/Free Full Text]
  40. Thomas RF, Holt BD, Schwinn DA, Liggett SB 1992 Long-term agonist exposure induces upregulation of ß3-adrenergic receptor expression via multiple cAMP response elements. Proc Natl Acad Sci USA 89:4490–4494[Abstract/Free Full Text]
  41. Lalli E, Sassone-Corsi P 1995 Thyroid-stimulating hormone (TSH)-directed induction of the CREM gene in the thyroid gland participates in the long-term desensitization of the TSH receptor. Proc Natl Acad Sci USA 92:9633–9637[Abstract/Free Full Text]
  42. Christophe-Hobertus C, Donda A, Javaux F, Vassart G, Christophe D 1992 Identification of a transcriptional enhancer upstream from the bovine thyroglobulin gene. Mol Cell Endocrinol 88:31–37[CrossRef][Medline]
  43. Kambe F, Nomura Y, Okamoto T, Seo H 1996 Redox regulation of thyroid-transcription factors, Pax-8 and TTF-1, is involved in their increased DNA-binding activities by thyrotropin in rat thyroid FRTL-5 cells. Mol Endocrinol 10:801–812[Abstract/Free Full Text]
  44. Ohmori M, Shimura H, Shimura Y, Kohn LD 1996 A Y-box protein is a suppressor factor that decreases thyrotropin receptor gene expression. Mol Endocrinol 10:76–89[Abstract/Free Full Text]
  45. Endo T, Shimura H, Saito T, Onaya T 1990 Cloning of malignantly transformed rat thyroid (FRTL) cells with thyrotropin receptors and their growth inhibition by 3',5'-cyclic adenosine monophosphate. Endocrinology 126:1492–1497[Abstract/Free Full Text]
  46. Kosugi S, Mori T, Iwamori M, Nagai Y, Imura H 1989 Alpha 2- and beta-adrenergic receptors and adenosine A1 receptor of FRTL-5 rat thyroid cells in relation to fucosyl GM1 ganglioside. Endocrinology. 124:2707–2710
  47. Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot M, Lane MD 1991 Transcriptional repression of the mouse insulin-responsive glucose transporter (GLUT4) gene by cAMP. Proc Natl Acad Sci USA 88:1933–1937[Abstract/Free Full Text]
  48. Cook JS, Lucas JJ, Sibley E, Bolanowski MA, Christy RJ, Kelly TJ, Lane MD 1988 Expression of the differentiation-induced gene for fatty acid-binding protein is activated by glucocorticoid and cAMP. Proc Natl Acad Sci USA 85:2949–2953[Abstract/Free Full Text]
  49. Rohlfs EM, Daniel KW, Premont RT, Kozak LP, Collins S 1995 Regulation of the uncoupling protein gene (Ucp) by ß1, ß2, and ß3-adrenergic receptor subtypes in immortalized brown adipose cell lines. J Biol Chem 270:10723–10732[Abstract/Free Full Text]
  50. Perez-Castillo A, Hernandez A, Pipaon C, Santos A, Obregon M-J 1993 Multiple regulation of S14 gene expression during brown fat differentiation. Endocrinology 133:545–552[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JDRHome page
G.S. Thangjam, P. Agarwal, I. Khan, U.P. Verma, A.K. Balapure, S.G. Rao, and P. Kondaiah
Transglutaminase-2 Regulation by Arecoline in Gingival Fibroblasts
Journal of Dental Research, February 1, 2009; 88(2): 170 - 175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Shimura, H. Suzuki, A. Miyazaki, F. Furuya, K. Ohta, K. Haraguchi, T. Endo, and T. Onaya
Transcriptional Activation of the Thyroglobulin Promoter Directing Suicide Gene Expression by Thyroid Transcription Factor-1 in Thyroid Cancer Cells
Cancer Res., May 1, 2001; 61(9): 3640 - 3646.
[Abstract] [Full Text]


Home page
Physiol. Rev.Home page
A. De la Vieja, O. Dohan, O. Levy, and N. Carrasco
Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology
Physiol Rev, July 1, 2000; 80(3): 1083 - 1105.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Miyazaki, H. Shimura, T. Endo, K. Haraguchi, and T. Onaya
Tumor Necrosis Factor-{alpha} and Interferon-{gamma} Suppress Both Gene Expression and Deoxyribonucleic Acid-Binding of TTF-2 in FRTL-5 Cells
Endocrinology, September 1, 1999; 140(9): 4214 - 4220.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
H. Shimura, A. Miyazaki, K. Haraguchi, T. Endo, and T. Onaya
Analysis of Differentiation-Induced Expression Mechanisms of Thyrotropin Receptor Gene in Adipocytes
Mol. Endocrinol., October 1, 1998; 12(10): 1473 - 1486.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimura, H.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimura, H.
Right arrow Articles by Onaya, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals