Endocrinology Vol. 138, No. 4 1483-1490
Copyright © 1997 by The Endocrine Society
Regulation of Thyrotropin Receptor Gene Expression in 3T3-L1 Adipose Cells is Distinct from Its Regulation in FRTL-5 Thyroid Cells
Hiroki Shimura,
Kazutaka Haraguchi,
Toyoshi Endo and
Toshimasa Onaya
The Third Department of Internal Medicine, Yamanashi Medical
University, Yamanashi 40938, Japan
Address all correspondence and requests for reprints to: Toshimasa Onaya, M.D., Ph.D., Professor and Chairman, The Third Department of Internal Medicine, Yamanashi Medical University, 1110 Tamaho, Yamanashi 40938, Japan. E-mail:
onayat{at}res.yamanashi-med.ac.jp
 |
Abstract
|
|---|
We previously have demonstrated that rat adipose tissue expresses TSH
receptor (TSHR) messenger RNAs (mRNAs) at levels approaching those
detected in the thyroid. Furthermore, we recently reported that TSHR
mRNA is detected in fibroblast-like 3T3-L1 cells after their
hormone-induced differentiation into adipocytes. TSH induces cAMP
formation and lipolysis in differentiated 3T3-L1 cells. We now show
that, in Northern blot analyses, TSH-induced down-regulation of TSHR
mRNA levels, which can be duplicated by forskolin and dibutylyl cAMP,
i.e. which is cAMP-mediated. We also have demonstrated
that a ß-adrenergic stimulant, which stimulates cAMP formation in
adipocytes, induces a down-regulation of TSHR mRNA levels in 3T3-L1
adipocytes. Nuclear run-on assays show that the ability of TSH/cAMP to
decrease TSHR mRNA levels in 3T3-L1 cells reflects transcriptional
regulation. This report also demonstrates that TSHR gene expression in
3T3-L1 adipocytes is regulated in a manner distinct from that observed
in thyroid cells. Thus, in fully differentiated 3T3-L1 adipocytes,
TSH-induced down-regulation of TSHR mRNA levels is evident within
1 h and is near maximum within 4 h after addition of TSH. A
transient increase of TSHR gene expression, which has been demonstrated
in FRTL-5 thyroid cells, was not observed in 3T3-L1 adipocytes. The
down-regulation of TSHR gene expression induced by TSH/cAMP in 3T3-L1
cells is cycloheximide-insensitive, suggesting that continuous protein
synthesis is not required for this process. In contrast, the
down-regulation of TSHR gene expression observed in FRTL-5 cells is
sensitive to cycloheximide. In both FRTL-5 thyroid cells and 3T3-L1
adipocytes, insulin or serum increased TSHR mRNA levels. Although
insulin or serum was required for the TSH-induced down-regulation of
TSHR mRNA levels in FRTL-5 thyroid cells, neither insulin nor serum was
required for TSHR down-regulation in 3T3-L1 adipocytes. These findings
demonstrate that TSH/cAMP regulates TSHR mRNA levels in adipocytes via
a regulatory system distinct from that used in FRTL-5 cells. This
report further demonstrates that adipose cells do not express thyroid
transcription factor-1, which interacts with the TSHR promoter region
in FRTL-5 cells, and that 3T3-L1 nuclear extracts exhibit a different
binding activity to the cAMP-response element-like element in the TSHR
promoter region compared with extracts from FRTL-5 cells.
 |
Introduction
|
|---|
THE TSH receptor (TSHR) mediates the
ability of TSH to affect the growth and function of thyroid cells
(1, 2, 3, 4). Autoantibodies to the TSHR that increase thyroidal cAMP levels
are present in patients with Graves disease and cause
hyperfunctioning of the thyroid gland (5). Patients with Graves
disease exhibiting exophthalmos and pretibial dermopathy often have
high titer of thyroid-stimulating antibodies (6). Expression of TSHR in
extrathyroidal cells may account for the extrathyroidal manifestations
in Graves disease, especially because TSH binding activity in
extrathyroidal tissues has been established (7, 8). The presence of
TSHR messenger RNA (mRNA) in several extrathyroidal cells has been
reported using the RT-PCR technique (9, 10, 11, 12).
TSHRs expressed in adipocytes have been shown to be functional (13, 14)
and are suggested to be involved in the regulation of adipose function.
Recently we reported that rat adipose tissue (15), as well as cultured
rat preadipocytes (16), express similar amounts of TSHR mRNA as that
detected in the thyroid gland. Marcus et al. (17) showed
that human fat tissues also express TSHR and that TSH has significant
effects on lipolysis in physiological concentrations (18). The maximum
lipolytic effect of TSH was the same as that of isoproterenol in human
adipocytes isolated from neonates (18). In addition, we recently showed
that a full-length TSHR cDNA from rat fat cells was almost identical to
that from the thyroid and that its function was indistinguishable from
that in the thyroid (15). This clone differed by only one amino acid
relative to the rat thyroid TSHR cDNA. When this fat TSHR cDNA was
transfected into Chinese hamster ovary cells, TSH induced cAMP
formation in a manner similar to that of Chinese hamster ovary cells
transfected with thyroid TSHR cDNA (15). These observations suggest
that TSHRs are involved in the regulation of adipose function and raise
the question of whether TSH regulates TSHR gene expression in a manner
similar to that observed in thyroid cells.
In rat FRTL-5 thyroid cells, TSH and the subsequent cAMP signal cause a
time-dependent positive and then negative regulation of TSHR gene
expression (19, 20). Insulin or insulin-like growth factor I is
required for the autoregulation of TSHR gene expression by TSH/cAMP
(20). Recently, the 5'-flanking region of the rat TSHR was cloned (21),
and a minimal promoter region, -220 to -39 bp, that exhibits
thyroid-specific expression and TSH/cAMP autoregulation of the TSHR was
identified (21, 22, 23, 24, 25, 26). One regulatory element defined therein, -189 to
-175 bp, binds thyroid transcription factor-1 (TTF-1) (24). The TTF-1
element contributes to thyroid-specific expression and to the cAMP
autoregulation of the TSHR gene (24, 27). TSH/cAMP-increased TTF-1
phosphorylation results in up-regulation of TSHR gene expression (24, 27), whereas a TSH/cAMP-induced decrease in TTF-1 RNA levels is
associated with down-regulation (24, 27). Additionally, single strand
DNA-binding proteins (SSBPs) interact with an element contiguous with
the 5'-end of the TTF-1 element (26). The SSBPs function conjointly
with TTF-1 in the full expression and TSH/cAMP-induced negative
regulation of TSHR in thyroid cells (26).
In contrast to thyroid cells, the control of TSHR gene expression in
adipose cells is not understood. A suitable cell culture model for the
study of adipocytes is 3T3-L1 cells, a fibroblast-like cell line
derived from the Swiss mouse embryo that, upon reaching confluence, can
be differentiated by hormonal induction into adipocytes (28, 29). We
recently reported that a dramatic appearance of TSHR mRNA occurred
after hormonal pulse-induced differentiation of 3T3-L1 cells into
adipocytes by treatment with insulin, isobutylmethylxanthine (IBMX),
and dexamethasone (30). This cultured cell system, therefore, is useful
for studying the regulation of TSHR gene expression in adipocytes.
In the present study, we demonstrate that TSH and its cAMP signal
down-regulate TSHR mRNA levels in differentiated 3T3-L1 cells in a
manner distinct from that observed in thyroid cells. This report
further explores the action of insulin on TSHR mRNA levels and
TSH/cAMP-induced down-regulation in 3T3-L1 cells. These results suggest
that TSHRs in adipose cells are autoregulated by TSH/cAMP, whose action
is mediated by a different set of transcription factors from those used
by thyroid cells. In this report, we also provide data showing
differences between 3T3-L1 and FRTL-5 cells in nuclear proteins
interacting with the TSHR promoter.
 |
Materials and Methods
|
|---|
Cell culture
3T3-L1 cells [American Type Culture Collection (ATCC),
Rockville, MD, No. CCL 92.1] were grown in high glucose DMEM and
supplemented with 10% calf serum. Confluent 3T3-L1 preadipocytes were
induced to differentiate into adipocytes, as previously described (30, 31). Briefly, 1 day after confluence, cells were treated with media
containing 10% FBS, 10 µg/ml insulin, 0.2 µg/ml dexamethasone, and
0.5 mM IBMX for 3 days. After 3 days, this medium was
replaced by media supplemented with 10 µg/ml insulin and 10% FBS,
and two days later, the media was replaced with DMEM supplemented with
10% FBS. Cells were used for studies 9 or 10 days after induction of
differentiation.
FRTL-5 rat thyroid cells (ATCC No. CRL 8305) were grown in Coons
modified Hams F-12 medium supplemented with 5% calf serum and a
mixture of six hormones containing bovine TSH (10 mU/ml), insulin (10
µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml),
glycyl-L-histidyl-L-lysine acetate (10 ng/ml),
and somatostatin (10 ng/ml) (32).
RNA isolation and Northern analysis
Total RNA was isolated from cells by the guanidine
isothiocyanate extraction method (33). For Northern blot analyses, 20
µg of total RNA was electrophoresed on a 1% agarose gel containing
0.66 M formaldehyde and blotted onto a nitrocellulose
filter, as previously described (20, 24). A mouse thyroid TSHR cDNA
(base 181575) (34) was obtained by the RT-PCR technique (35) from a
mouse thyroid cDNA library primed with oligo(dT). The PCR product was
subcloned into pCRII vector (Invitrogen, San Diego, CA) and sequenced
its identity. Rat ß-actin cDNA was kindly donated by Dr. L. D. Kohn
(NIH, Bethesda, MD). The rat TTF-1 probe was a fragment from +1 to +331
bp excised from the TTF-1 expression vector, RcCMV-THA; it was the kind
gift of Dr. R. Di Lauro (Stazione Zoologica A. Dohrn, Naples, Italy)
(36). All probes were radiolabeled using a random primer labeling kit
(Takara Shuzo Co., Kyoto, Japan). Blots were hybridized in 50%
formamide, 2.5x Denhardts solution, 5x SSPE (0.6 M
NaCl, 40 mM sodium phosphate, 4 mM EDTA, pH
7.4), 0.1% SDS, 0.1 mg/ml heat-denatured salmon sperm DNA, and 5%
dextran sulfate. The filters were then washed three times at room
temperature in 2x SSC (0.3 M NaCl, 30 mM
sodium acetate, pH 7.0) containing 0.1% SDS, followed by three washes
three times at 53 C in 0.1x SSC-0.1% SDS. The filters were exposed to
an imaging plate and were analyzed using a BAS2000 image analyzer (Fuji
Film Co., Tokyo, Japan).
In vitro nuclear run-on analysis
Nuclear run-on experiments were performed as described (37, 38).
Briefly, nuclei isolated from 3T3-L1 cells, before or after induction
of differentiation, were incubated at 26 C for 45 min in 100 µl
reaction mixtures containing 16% glycerol, 20 mM HEPES (pH
8.0), 0.04 mM EDTA, 0.5 mM MnCl2,
90 mM NH4Cl, 5 mM
MgCl2, 2 mM dithiothreitol, and 0.4
mM each of ATP, cytidine 5'-triphosphate, and GTP, and 0.2
mCi [
-32P]uridine 5'-triphosphate. The reaction was
stopped by the addition of 100 µl of a stop mixture containing 200
µg/ml ribonuclease (RNase)-free deoxyribonuclease I, 200 µg/ml
proteinase K, 200 µg/ml yeast transfer RNA, 20 mM HEPES
(pH 8.0), and 20 mM CaCl2, followed by further
incubation for 20 min at room temperature. Radiolabeled RNA was
purified and hybridized to 4 µg DNA immobilized on nitrocellulose
filters. Four micrograms each of mouse TSHR cDNA, rat ß-actin cDNA,
and pGEM7Zf(+) (Promega, Madison, WI) plasmid DNA (to control for
nonspecific binding) were immobilized on the nitrocellulose filters.
Hybridization was performed at 45 C for 48 h in 50% formamide,
5x SSPE, 10x Denhardts solution, 0.1% SDS, 0.25 mg/ml
heat-denatured salmon sperm DNA, 50 µg/ml poly(A), and 25 µg/ml
yeast transfer RNA. Filters were then washed three times in 2x
SSC-0.1% SDS for 30 min at room temperature, followed by washes in
0.1x SSC-0.1% SDS at 45 C. Filters were next washed twice in 0.2x
SSC at 37 C for 5 min and incubated in 2x SSC containing 10 µg/ml
RNase A and 350 U/ml RNase T1 at 37 C for 30 min. After incubation, the
filters were washed twice in 0.2x SSC-0.1% SDS at room temperature
and washed again in 0.2x SSC. Filters were exposed to an imaging plate
and analyzed using a BAS2000 image analyzer (Fuji).
Nuclear extracts
Nuclear extracts were prepared exactly as previously described
(21, 22, 23, 24, 25, 26, 27). 3T3-L1 cell extracts were prepared from cells 9 or 10 days
after induction of differentiation. FRTL-5 nuclear extracts were from
cells maintained in medium depleted of TSH for 7 days after they were
grown to near confluency in medium containing TSH.
Electrophoretic mobility shift assays
Electrophoretic mobility shift assays were performed, as
previously described (21, 22, 23, 24, 25, 26, 27), using a double-stranded oligonucleotide
containing the rat TSHR promoter -146/-114 (relative to the
translation start site) sequence
(CCAGCGATGAGGTCACAGCCCCTTGGAGCCCTC; the
underlining indicates the cAMP-response element
(CRE)-like sequence).
 |
Results
|
|---|
TSH down-regulates TSHR mRNA levels in differentiated 3T3-L1
adipocytes
Fibroblast-like 3T3-L1 cells were fully differentiated into
adipocytes in the presence of insulin, dexamethasone, and IBMX. We
previously demonstrated that the steady-state TSHR mRNA level increases
during differentiation of 3T3-L1 cells. Northern blot analysis
demonstrated that TSHR mRNA is not detectable in undifferentiated
3T3-L1 cells and does not appear until the 5th day after the initiation
of differentiation (Fig. 1A
, lane 2, and Ref.30). TSHR
mRNA becomes evident by day 7 and reaches a maximum sustained level at
day 11 (30). It is important to note that the mRNA remains at maximum
levels for 5 days after the inducing hormones are removed from the
cells (Fig. 1A
, lanes 1 and 3). Despite this stable expression,
treatment of differentiated cells with TSH (10 mU/ml) for 24 h
caused a decrease in TSHR mRNA levels (Fig. 1
). Down-regulation of TSHR
mRNA levels could be duplicated by forskolin (10 µM) or
dibutyryl cAMP (1 mM) treatment, both of which increased
cAMP levels (Fig. 1
).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 1. Effects of TSH, forskolin (FSK), dibutylyl cAMP
(DBC), and isoproterenol on expression of TSHR and ß-actin mRNA
expression in 3T3-L1 cells. Equal amounts of total RNA (20 µg per
lane) are subjected to sequential Northern analyses using mouse TSHR
and ß-actin cDNA probes (A). Confluent 3T3-L1 cells (preadipo, lane
2), grown in DMEM with 10% calf serum, are induced to differentiate
into adipocytes using two different protocols. Cells are either treated
with insulin (I) and 10% FBS (F) (IF) for 7 days, preceded by 3 days
of treatment with insulin, dexamethasone (D), IBMX (X), and FBS (IDXF)
(lane 1). Alternatively, cells (adipo) are treated with FBS for 5 days
followed by treatments with IDXF (3 days) and IF (2 days), as described
in the Materials and Methods (lane 3), and then exposed
to TSH (10 mU/ml) (lane 4), forskolin (10 µM) (lane 5),
or DBC (1 mM) (lane 6) for 24 h. The periods of
incubation with hormones are indicated in parentheses
(days). B, To investigate the effect of isoproterenol on TSHR mRNA
levels in differentiated 3T3-L1 cells, RNA is prepared from cells
exposed to the indicated concentrations of isoproterenol for 4 h,
and equal amounts (20 µg/lane) are subjected to sequential Northern
blot analyses using the TSHR and ß-actin probes. Quantitation is
performed using a BAS2000 image analyzer (Fuji). The TSHR/ß-actin
ratio is calculated and compared with the control (lane 3, adipo).
Values are expressed as a percent of the control and are means ±
SEM of three separate experiments with different batches of
cells.
|
|
Recent reports (39, 40) have indicated that differentiation of cultured
preadipocytes to adipocytes is accompanied by the induction of
ß1- and ß3-adrenergic receptor gene
expression, which are involved in the production of cAMP and lipolysis
after stimulation with ß-adrenergic agonists. To elucidate whether
cAMP signal generated by ß-adrenergic receptors also causes the
down-regulation of TSHR gene expression, the effect of isoproterenol on
TSHR mRNA levels was investigated in differentiated 3T3-L1 cells.
Treatment of 3T3-L1 adipocytes with 10-9 to
10-5 M isoproterenol for 4 h resulted in
a decrease in TSHR mRNA levels, with a maximum 60% inhibition (Fig. 1B
). This result indicates that catecholamines, which are major
regulators of lipid metabolism in adipocytes, also down-regulate TSHR
mRNA levels, likely via a cAMP-mediated pathway, in adipocytes.
Transcriptional rate (nuclear run-on) assays revealed that both the
differentiation-induced increase and the TSH/cAMP-induced
down-regulation of TSHR mRNA levels occurs at the level of gene
transcription. Nuclei were isolated from undifferentiated 3T3-L1 cells
or 10 days after the initiation of differentiation in the presence or
absence of TSH or forskolin for 4 h. TSHR transcripts were barely
detectable in nuclei isolated from undifferentiated cells, whereas
transcripts were abundant in nuclei isolated from fully differentiated
cells (Fig. 2A
). Treatment of differentiated cells with
TSH or forskolin for 4 h caused a decrease in TSHR transcripts. No
change was detected in levels of ß-actin transcripts (Fig. 2A
).
Although [32P] uridine 5'-triphosphate (UTP)-labeled
nuclear RNA isolated from differentiated cells hybridized slightly to
the control plasmid, the differentiation-induced increase and TSH, as
well as forskolin-induced down-regulation of TSHR mRNA transcription,
were still statistically significant when the intensities generated by
nonspecific hybridization were subtracted (Fig. 2B
). These results
demonstrate that TSH down-regulates the transcription rate of the TSHR
gene via its cAMP signal in differentiated 3T3-L1 adipocytes.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 2. Transcriptional nuclear run-on analysis of the
TSHR gene in undifferentiated and differentiated 3T3-L1 cells. Nuclei
are isolated from 3T3-L1 cells before (preadipo) and after induction of
differentiation (adipo) with the same hormonal treatment as in Fig. 1A , lane 3. Nuclei are then isolated from differentiated 3T3-L1 cells
exposed to TSH (10 mU/ml) or forskolin (FSK) (10 µM) for
4 h. [32P]UTP-labeled RNA transcripts isolated from
nuclei are used in hybridization reactions with either mouse TSHR cDNA,
control ß-actin cDNA, or control empty vector pGEM7Z plasmid DNA as
indicated. All filters are hybridized and washed, as described in
Materials and Methods. Quantitation is performed using a
BAS2000 image analyzer (Fuji). The TSHR/ß-actin ratio is calculated
after subtraction of values generated by nonspecific hybridization to
control empty plasmid DNA. The ratio from differentiated 3T3-L1 cells
(adipo) not exposed to TSH or forskolin is set at 100% (B). Data are
mean ± SEM of three separate experiments with
different batches of cells.
|
|
Figure 3
depicts the dose-response effect of TSH
incubated for 24 h on TSHR mRNA levels in differentiated 3T3-L1
cells. The TSH-dependent down-regulation of TSHR mRNA levels in 3T3-L1
adipocytes was compared with that in FRTL-5 thyroid cells; the
concentrations of TSH required to cause the same percentage of decrease
in TSHR mRNA levels in 3T3-L1 adipocytes were higher than those
required in FRTL-5 cells. However, there are no significant differences
at all points other than at 10 µU/ml. It is important to note that a
physiological concentration of TSH (10 µU/ml) caused a small, but
significant (P < 0.05), decrease in TSHR mRNA
levels.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3. Effect of different concentrations of TSH on
expression of TSHR mRNA in 3T3-L1 adipocytes and FRTL-5 thyroid cells.
3T3-L1 cells are induced to differentiate into adipocytes, as described
in the Materials and Methods. FRTL-5 cells are
maintained for 7 days without any TSH in the medium. RNA is prepared
from cells exposed to the indicated concentrations of TSH for 24
h, and equal amounts (20 µg/lane) are subjected to sequential
Northern blot analysis using the TSHR and ß-actin probes. The
TSHR/ß-actin ratios are expressed as a percent of control and are
means ± SEM of three separate experiments with
different batches of cells.
|
|
TSHR gene expression in 3T3-L1 adipocytes is regulated in a manner
distinct from that in thyroid cells
In FRTL-5 cells, the TSH-induced decrease in TSHR gene expression
was preceded by a short 2-h period of increased mRNA levels. The
decrease, however, was measurable after 4 h and at maximum 8
h after the addition of TSH (Fig. 4
and Ref.20). In
contrast, the TSH-induced down-regulation of TSHR mRNA levels in
differentiated 3T3-L1 was evident at 1 h and at maximum within
4 h after addition of TSH (Fig. 4
). There was no transient
increase of TSHR gene expression in 3T3-L1 cells. These results show
that the expression of the TSHR gene in 3T3-L1 adipocytes is regulated
in a manner distinct from that in FRTL-5 thyroid cells.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. Kinetics of TSH effects on TSHR mRNA levels in
3T3-L1 adipocytes and FRTL-5 thyroid cells. 3T3-L1 cells are induced to
differentiate into adipocytes, as described in the Materials and
Methods. FRTL-5 cells are maintained for 7 days with no TSH in
the medium. RNA is prepared from the cells exposed to TSH for the
indicated times, and equal amounts (20 µg/lane) are subjected to
sequential Northern analysis using the TSHR and ß-actin probes. The
TSHR/ß-actin ratios are expressed as a percent of control and are
means ± SEM of three separate experiments with
different batches of cells. The inset shows a typical
experiment using differentiated 3T3-L1 cells.
|
|
When given to 3T3-L1 adipocytes simultaneously with TSH, cycloheximide
had only a small inhibitory effect on the ability of TSH to
down-regulate TSHR gene expression (Fig. 5A
). The effect
of the cycloheximide on the down-regulation of TSHR mRNA in adipocytes
was emphasized by the data indicating that cycloheximide had no effect
on the down-regulation of TSHR mRNA levels induced by forskolin in
3T3-L1 adipocytes. This result suggests that TSH/cAMP-induced
down-regulation of TSHR mRNA levels, at least in part, does not require
continuous protein synthesis. In contrast, Saji et al. (20)
and our data (Fig. 5B
) show that cycloheximide abolishes the ability of
TSH/cAMP to induce the down-regulation of TSHR mRNA in FRTL-5 cells.
These data also indicate that TSH/cAMP regulates TSHR mRNA levels in
adipocytes via a regulatory mechanism distinct from that used in FRTL-5
cells.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5. Effect of cycloheximide (CHx) on the TSH- and
forskolin (FSK)-induced down-regulation of TSHR mRNA levels. 3T3-L1
cells are induced to differentiate into adipocytes, as described in
Materials and Methods. FRTL-5 cells are maintained 7
days with no TSH in the medium. Cells are exposed to TSH (10 mU/ml) or
forskolin (10 µM) is exposed in the presence or absence
of cycloheximide (10 µM) for 4 h (3T3-L1) or 24
h (FRTL-5). Northern analyses are performed and quantitated as
described. The data are presented as TSHR mRNA levels per µg of total
RNA applied to the gels; ethidium bromide staining confirmed that equal
amounts of RNA were applied to each lane, because TSH induces a marked
decrease in ß-actin mRNA levels when FRTL-5 cells were incubated with
cycloheximide (21). Data are means ± SEM of three
separate experiments with different batches of cells.
|
|
In FRTL-5 thyroid cells, insulin and 5% serum increased TSHR mRNA
levels (Fig. 6B
and Ref.20). This phenomenon was
observed also in differentiated 3T3-L1 cells; treatment with insulin or
10% FBS for 48 h increased TSHR mRNA levels in fully
differentiated 3T3-L1 cells (Fig. 6A
). Insulin and serum also were
required for TSH-induced down-regulation of TSHR mRNA levels in FRTL-5
thyroid cells (Fig. 6B
and Ref.20). Thus, TSH cannot down-regulate
TSHR mRNA levels in FRTL-5 cells maintained in basal medium with
neither TSH, insulin, nor serum (Fig. 6B
and Ref.20). In contrast, TSH
down-regulates its receptor mRNA in 3T3-L1 adipocytes, even when they
are maintained in medium without serum or insulin (Fig. 6A
), despite
the fact that insulin and serum up-regulate TSHR mRNA levels in these
cells. This again emphasizes the difference in TSHR mRNA regulation
between 3T3-L1 adipocytes and FRTL-5 thyroid cells.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 6. Effects of insulin and serum on the TSH- or
forskolin (FSK)-induced down-regulation of TSHR mRNA levels. A) Eight
days after induction of differentiation, media is replaced with either
medium without insulin or FBS, medium with insulin only, or medium with
FBS only. Cells are maintained in this media for 2 days and are exposed
to TSH (10 mU/ml) for 24 h. B) FRTL-5 cells are maintained for 6
days in medium containing 0.2% calf serum without TSH and insulin
(basal) or in media containing insulin or 5% calf serum and then
exposed to TSH for 24 h. RNA is isolated, and Northern blot
analyses are performed as described. The ratio of TSHR to ß-actin
mRNA levels is calculated with the ratio of TSHR mRNA to ß-actin mRNA
in cells maintained in medium alone set at 100%. Data are means
± SEM of three separate experiments with different batches
of cells.
|
|
Differences in transcription factors interacting with the TSHR
promoter region in 3T3-L1 adipocytes and FRTL-5 thyroid cells
TTF-1 interacts with the TSHR promoter region and plays important
roles in the expression and the hormonal regulation of TSHR gene in
FRTL-5 thyroid cells (24, 27). To determine whether TTF-1 also
interacts with the TSHR promoter region in adipose cells, we performed
Northern analyses using a TTF-1 cDNA (36) as a probe. As previously
reported (24), expression of TTF-1 mRNA is observed in FRTL-5 thyroid
cells. In contrast, no TTF-1 transcripts were detected in 3T3-L1 cells
before and after the induction of differentiation, as well as in rat
adipose tissue. This result indicates that TTF-1 is not involved in the
regulations of the TSHR gene in adipose cells.
A CRE-like element, TGAGGTCA, exists in the minimal promoter region of
the TSHR gene and contributes to its constitutive expression in thyroid
cells (22). It also has been revealed that the enhancer activity of
TTF-1 on the TSHR promoter totally depended on the CRE-like site (24).
Furthermore, a recent report (41) showed that the CRE-like site also
was involved in TSH-induced regulation of TSHR gene via the induction
of the inducible cAMP early repressor (ICER) in FRTL-5 cells. To
investigate nuclear proteins interacting with the CRE-like sequence in
adipose cells, we performed electrophoretic mobility shift assays.
Nuclear extract from differentiated 3T3-L1 cells exhibited protein/DNA
complexes (A and C complexes) similar to those formed with FRTL-5
nuclear extract. However, a protein/DNA complex (B complex), which was
not detectable in the FRTL-5 lane, was formed in the 3T3-L1 lane.
Although the functional role of this nuclear protein is unclear at this
time, we hypothesize that the CRE-like element in adipocytes may
exhibit activities different from those in FRTL-5 cells.
 |
Discussion
|
|---|
In the present report, the down-regulation of TSHR gene expression
induced by TSH in 3T3-L1 adipocytes was investigated. We have shown
previously that treatment of fibroblast-like 3T3-L1 cells with insulin,
after exposure to insulin, dexamethasone, and IBMX, induced expression
of TSHR mRNA. TSHR mRNA expression was observed concurrently with
morphologic differentiation, as assessed by the formation of lipid
droplets in the cells (30). We now show that expression of the TSHR
gene is irreversibly induced during hormonal differentiation in 3T3-L1
cells. The nature of this irreversible switch is underscored by the
fact that expression of the TSHR gene, as well as the adipocytic
phenotype, does not depend on continued hormonal stimulation. TSH
causes an increase in cAMP levels in differentiated 3T3-L1 adipocytes
within 30 min (30). Despite the stable expression of the TSHR gene
after a hormonal pulse that included the cAMP-generating agent, IBMX,
exposure of the differentiated 3T3-L1 cells to TSH results in a
decrease in TSHR mRNA levels. Because the TSH-induced down-regulation
also can be mimicked by a cAMP analog and forskolin, this TSH action is
presumed to be cAMP mediated. We demonstrate that the increase in TSHR
mRNA during 3T3-L1 cell differentiation and the TSH/cAMP-mediated
decrease in TSHR mRNA levels occur at the level of transcription.
In FRTL-5 thyroid cells, the hormonal regulation of TSHR gene
expression has been well characterized (20). As previously reported
(20), short exposures to TSH (2 h) increases TSHR mRNA levels; however,
TSHR mRNA levels decline thereafter. Saji et al. (20) also
have demonstrated that the TSH-induced up-regulation, as well as the
down-regulation, is transcriptional. In contrast, in 3T3-L1 adipocytes,
TSH treatment resulted in a decrease in TSHR mRNA levels without any
transient increase at early time points (Fig. 4
). This difference may
be caused by the lack of TTF-1 expression in 3T3-L1 adipocytes (Fig. 7A
). The minimal promoter region of the TSHR gene has a
TTF-1-binding element that plays an important role in TSHR gene
expression in thyroid cells (24) and is, at least in part, involved in
the TSH/cAMP-induced autoregulation of TSHR gene expression (24, 26, 27). TSH causes a time-dependent increase, and then decrease, in the
amount of TTF-1/DNA complex formed in gel mobility shift assays using
nuclear extracts from FRTL-5 thyroid cells (24, 27). It has been
hypothesized that the early increases in TSHR gene expression are
associated with increased TTF-1 binding to the TSHR promoter mediated
by the activation of protein kinase A (PKA) (24, 27). However, the
hypothesis that TTF-1 is involved in TSH/cAMP regulation is still a
matter of controversy. Christophe-Hobertus et al. (42)
reported that TTF-1 is not involved in the regulation of thyroglobulin
gene expression by TSH/cAMP. Kambe et al. (43) recently
showed that TSH increased DNA-binding activity of TTF-1 in whole cell
extracts prepared without dithiothreitol.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7. Differences in transcription factors interacting
with the TSHR promoter region in 3T3-L1 adipocytes and FRTL-5 thyroid
cells. (A) Total RNAs are prepared from rat liver, rat epididymal fat
pad, 3T3-L1 cells before (preadipo) and after (adipo) the induction of
differentiation, and FRTL-5 cells maintained in the medium without TSH
for 7 days. Equal amounts of total RNA (20 µg per lane) are subjected
to sequential Northern analyses using rat TTF-1 and ß-actin cDNA
probes. (B) One µg of nuclear extracts from FRTL-5 cells maintained
in the absence of TSH and differentiated 3T3-L1 cells are used in
electrophoretic mobility shift assays. Synthetic oligonucleotide,
identical to the promoter region of rat TSHR gene spanning -146 to
-114 bp, is used as a probe.
|
|
In Fig. 4
, if the transient increase in TSHR mRNA levels in FRTL-5
cells were subtracted, the 3T3-L1 curve would overlap with the FRTL-5
curve. This may suggest a shared mechanism of down-regulation of TSHR
gene expression in both cell types. It has been reported that TTF-1 is
not the only factor involved in down-regulation of TSHR gene expression
in FRTL-5 cells (23, 24, 26, 27, 44). Ubiquitously expressed SSBPs,
which interact with elements contiguous with the TTF-1 elements, also
are involved in the down-regulation of TSHR gene expression (26). It is
possible that these proteins play an important role in the
down-regulation of TSHR gene expression in adipose cells.
Cycloheximide inhibited the ability of TSH and forskolin to
down-regulate TSHR gene expression in FRTL-5 cells (Fig. 5
and Ref.20). The TSH-induced decrease in TTF-1/TSHR complex formation, which
coincides with TSH-induced down-regulation of TTF-1 and TSHR mRNA
levels in FRTL-5 cells, is a cycloheximide-sensitive process (24).
Although 3T3-L1 adipocytes do not express TTF-1, TSH and a
cAMP-mediated signal down-regulate TSHR gene expression in 3T3-L1
adipocytes. Thus, it was of interest that the TSH/cAMP-induced
down-regulation in 3T3-L1 adipocytes is not affected by cycloheximide
(Fig. 5
). This result suggests that, in 3T3-L1 cells, the
TSH/cAMP-induced down-regulation of TSHR mRNA levels does not require
continuous protein synthesis, or that the TSH-activated inhibitory
factor in 3T3-L1 cells may have a longer half-life than the same factor
in FRTL-5 cells. TSHR suppressor element-binding protein-1, which is
ubiquitously expressed, has been cloned (44). This protein suppresses
TSHR promoter activity, and its DNA-binding activity is enhanced by
PKA-induced phosphorylation (44). Although it is not yet clarified, the
TSH/cAMP-induced down-regulation of TSHR gene expression in 3T3-L1
adipocytes may be the result of interactions with TSHR suppressor
element-binding protein-1, as well as nuclear factors expressed only in
fat cells.
The present report shows further that insulin and serum are positive
regulators of TSHR mRNA levels in 3T3-L1 adipocytes. In FRTL-5 cells,
it has been revealed that insulin, insulin-like growth factor I, and
serum up-regulated the transcription of TSHR gene (20). The difference,
however, is that insulin/serum is required for TSH/cAMP to
down-regulate TSHR gene expression in FRTL-5 cells (Fig. 6B
and Ref.20) but not in 3T3-L1 adipocytes (Fig. 6A
). The region immediately
upstream of the TTF-1 site in TSHR gene was identified as a
insulin-response element (IRE) (25). This IRE seems to function in a
thyroid-specific manner, because mutation of the TTF-1 site results in
the loss of IRE function in FRTL-5 cells (25). These findings lead us
to a hypothesis that insulin-regulating factors distinct from those in
FRTL-5 may be involved in the transcriptional regulation of TSHR gene
by insulin/serum in 3T3-L1 adipocytes.
Catecholamines play a major role in lipid metabolism via ß-adrenergic
receptors. It has been reported that increased levels of cAMP in
adipose cells induce an increase in ß3-adrenergic
receptors (40) and a loss of ß1- and
ß2-adrenergic receptors (39). The present study confirms
that the cAMP signal generated by a ß-adrenergic agonist induces a
down-regulation of TSHR mRNA levels. This result suggests that TSHR and
ß-adrenergic receptors are functionally interrelated in adipose
cells. In contrast, this was not found in thyroid cells, because we
have shown previously that cultured thyroid cells (FRTL) do not express
ß-adrenergic receptors (45). In FRTL-5 cells, a ß-adrenergic
agonist also failed to induce cAMP formation (46)
Transcriptional regulations mediated by cAMP signal in adipose cells
have been reported in several genes. cAMP mediates the up-regulation of
the ß3-adrenergic receptor (40), GLUT1 (47), adipose
fatty acid-binding protein (48), and uncoupling protein genes (49), as
well as the down-regulation of ß1- and
ß2-adrenergic receptor (39), GLUT4 (47), and S14 genes
(50). However, most of the regulatory mechanisms in these genes remain
unclear. This report shows that TSH and the cAMP-induced pathway
down-regulate TSHR gene expression in differentiated 3T3-L1 cells in a
manner distinct from that observed in thyroid cells. Although some of
the transcription factors interacting with the TSHR promoter may be
common in adipose and thyroid cells, it is reasonable to predict that a
set of transcription factors distinct from those used in thyroid cells
will mediate the hormonal regulation of TSHR gene expression, as well
as its differentiation-dependent expression, in adipocytes. In this
report, we confirmed no expression of TTF-1 in adipose cells. The
present report also identified that the CRE-like sequence in the
minimal TSHR promoter region and nuclear extract from 3T3-L1 adipocytes
formed a protein/DNA complex that was not detectable with the FRTL-5
nuclear extract. These results reinforce our hypothesis that adipose
cells have different regulatory mechanisms for the TSHR gene expression
from those in FRTL-5 cells. Characterization of the TSHR promoter in
adipose cells is under current investigation.
Received August 23, 1996.
 |
References
|
|---|
-
Kohn LD, Saji M, Akamizu T, Ikuyama S, Isozaki O,
Kohn AD, Santisteban P, Chan JYC, Bellur S, Rotella CM, Alvarez FV,
Aloj SM 1990 Receptors of the thyroid gland: the thyrotropin
receptor is only the first violinist of a symphony orchestra. In:
Ekholm R, Kohn LD, Wollman S (eds) Control of the Thyroid: Regulation
of its Normal Growth and Function. Plenum Press, New York, pp
151210
-
Dumont JE, Lefort A, Libert F, Parmentier M, Raspe E,
Reuse F, Maenhaut C, Roger P, Corvilain B, Laurent E, Mockel J, Lamy F,
Van Sande J, Vassart G 1990 Transducing systems in the control of
human thyroid cell function, proliferation, and differentiation. In:
Ekholm R, Kohn LD, Wollman S (eds) Control of the Thyroid: Regulation
of its Normal Growth and Function. Plenum Press, New York, pp
357372
-
Vassart G, Dumont JE 1992 The thyrotropin receptor
and regulation of thyrocyte function and growth. Endocr Rev 13:596611[Abstract/Free Full Text]
-
Kohn LD, Saji M, Kosugi M, Ban T, Giuliani C, Hidaka A,
Shimura H, Shimura Y, Okajima F 1993 The synthesis and secretion
of thyroid hormones: regulation by multiple hormones and signals which
can be subverted by autoantibodies to the thyrotropin receptor. In:
Troncone L, Shapiro B, Satta MA, Monaco F (eds) Thyroid Diseases: Basic
Science, Pathology, Clinical and Laboratory Diagnosis. CRC Press, Boca
Raton, pp 59118
-
Onaya T, Kotani M, Yamada T, Ochi Y 1973 New
in vitro tests to detect the thyroid stimulator in sera from
hyperthyroid patients by measuring colloid droplet formation and cyclic
AMP in human thyroid slices. J Clin Endocrinol Metab 36:859866[Abstract/Free Full Text]
-
Morris III JC, Hay ID, Nelson RE, Jiang NS 1988 Clinical utility of thyrotropin-receptor antibody assays: comparison of
radioreceptor and bioassay methods. Mayo Clin Proc 63:707717[Medline]
-
Mullin BR, Lee G, Ledley FD, Winland RJ, Kohn LD 1976 Thyrotropin interactions with human fat cell membrane preparations
and the finding of soluble thyrotropin binding component. Biochem
Biophys Res Commun 69:5562[CrossRef][Medline]
-
Davies TF, Teng CS, McLachlan SM, Smith BR, Hall A 1978 Thyrotropin receptors in adipose tissue, retro-orbital tissue and
lymphocytes. Mol Cell Endocrinol 9:303310[CrossRef][Medline]
-
Endo T, Ohno M, Kotani S, Gunji K, Onaya T 1993 Thyrotropin receptor in non-thyroid tissues. Biochem Biophys Res Commun 190:774779[CrossRef][Medline]
-
Francis T, Burch HB, Cai WY, Lukes Y, Peele M, Carr FE,
Wartofsky L, Burman KD 1991 Lymphocytes express thyrotropin
receptor-specific mRNA as detected by the PCR technique. Thyroid 1:223228[Medline]
-
Feliciello A, Porcellini A, Ciullo I, Bonavolonta G,
Avvedimento EV, Fenzi G 1993 Expression of thyrotropin-receptor
mRNA in healthy and Graves disease retro-orbital tissue. Lancet 342:337338[CrossRef][Medline]
-
Heufelder AE, Dutton CM, Sarkar G, Donovan KA, Bahn
RS 1993 Detection of TSH receptor RNA in cultured fibroblasts from
patients with Graves ophthalmopathy and pretibial dermopathy. Thyroid 3:297300[Medline]
-
Birnbaumer L, Rodbell M 1969 Adenyl cyclase in fat
cells. II. Hormone receptors. J Biol Chem 244:34773482[Abstract/Free Full Text]
-
Farmer SW, Ramachandran J, Papkoff H 1972 Lipolytic
activity of gonadotropins and their subunits. Endocrinology 91:543548[Abstract/Free Full Text]
-
Endo T, Ohta K, Haraguchi K, Onaya T 1995 Cloning
and functional expression of a thyrotropin receptor cDNA from rat fat
cells. J Biol Chem 270:1083310837[Abstract/Free Full Text]
-
Haraguchi K, Shimura H, Lin L, Endo T, Onaya T 1996 Differentiation of rat preadipocytes is accompanied by expression of
thyrotropin receptors. Endocrinology 137:32003205[Abstract]
-
Janson A, Karlsson FA, Micha-Johansson G, Bolme P,
Bronnegard M, Marcus C 1995 Effects of stimulatory and
inhibitory thyrotropin receptor antibodies on lipolysis in infant
adipocytes. J Clin Endocrinol Metab 80:17121716[Abstract/Free Full Text]
-
Marcus C, Ehren H, Bolme P, Arner P 1988 Regulation
of lipolysis during the neonatal period. Importance of thyrotropin.
J Clin Invest 82:17931797
-
Akamizu T, Ikuyama S, Saji M, Kosugi S, Kozak C, Mc
Bride OW, Kohn LD 1990 Cloning, chromosomal assignment, and
regulation of the rat thyrotropin receptor: expression of the gene is
regulated by thyrotropin, agents that increase cAMP levels, and thyroid
autoantibodies. Proc Natl Acad Sci USA 87:86778681
-
Saji M, Akamizu T, Sanchez M, Obici S, Avvedimento E,
Gottesman ME, Kohn LD 1992 Regulation of thyrotropin receptor gene
expression in rat FRTL-5 thyroid cells. Endocrinology 130:520533[Abstract/Free Full Text]
-
Ikuyama S, Niller HH, Shimura H, Akamizu T, Kohn LD 1992 Characterization of the 5'-flanking region of the rat thyrotropin
receptor gene. Mol Endocrinol 6:793804[Abstract/Free Full Text]
-
Ikuyama S, Shimura H, Hoeffler JP, Kohn LD 1992 Role of the cyclic adenosine 3', 5'-monophosphate response element in
efficient expression of the rat thyrotropin receptor promoter. Mol
Endocrinol 6:17011715[Abstract/Free Full Text]
-
Shimura H, Ikuyama S, Shimura Y, Kohn LD 1993 The
cAMP response element in the rat thyrotropin receptor promoter:
regulation by each decanucleotide of a flanking tandem repeat uses
different, additive, and novel mechanisms. J Biol Chem 268:2412524137[Abstract/Free Full Text]
-
Shimura H, Okajima F, Ikuyama S, Shimura Y, Kimura S,
Saji M, Kohn LD 1994 Thyroid-specific expression and cyclic
adenosine 3', 5'-monophosphate autoregulation of the thyrotropin
receptor gene involves thyroid transcription factor-1. Mol Endocrinol 8:10491069[Abstract/Free Full Text]
-
Shimura Y, Shimura H, Ohmori M, Ikuyama S, Kohn LD 1994 Identification of a novel insulin-responsive element in the rat
thyrotropin receptor promoter. J Biol Chem 269:3190831914[Abstract/Free Full Text]
-
Shimura H, Shimura Y, Ohmori M, Ikuyama S, Kohn LD 1995 Single strand DNA-binding proteins and thyroid transcription
factor-1 conjointly regulate thyrotropin receptor gene expression. Mol
Endocrinol 9:527539[Abstract/Free Full Text]
-
Ohmori M, Shimura H, Shimura Y, Kohn LD 1995 Characterization of an up-stream thyroid transcription factor-1-binding
site in the thyrotropin receptor promoter. Endocrinology 136:269282[Abstract]
-
Green H, Kehinde O 1974 Sublines of mouse 3T3 cells
that accumulate lipid. Cell 1:113116
-
Green H, Kehinde O 1975 An established preadipose
cell line and its differentiation in culture II. Factors affecting the
adipose conversion. Cell 5:1927[CrossRef][Medline]
-
Haraguchi K, Shimura H, Lin L, Saito T, Endo T, Onaya
T 1996 Functional expression of thyrotropin receptor in
differentiated 3T3L1 cells: a possible model cell line of
extrathyroidal expression of thyrotropin receptor. Biochem Biophys Res
Commun 223:193198[CrossRef][Medline]
-
McGehee RE, Ron D, Brasier AR, Habener JF 1993 Differentiation-specific element: a cis-acting developmental
switch required for the sustained transcriptional expression of the
angiotensinogen gene during hormonal-induced differentiation of 3T3L1
fibroblasts to adipocytes. Mol Endocrinol 7:551560[Abstract/Free Full Text]
-
Ambesi-Impiombato FS 1986 Fast-growing thyroid
cell. US Patent 4,608,341
-
Sambrook J, Fritsch EF, Maniatis T 1989 Extraction,
purification, and analysis of messenger RNA from eukaryotic cells. In:
Nolan C (ed) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, vol 1:7.17.87
-
Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM,
Taylor NA, Puett D, Jin S 1994 Identification of a point mutation
in the thyrotropin receptor of the hyt/hyt hypothyroid
mouse. Mol Endocrinol 8:129138[Abstract/Free Full Text]
-
Davis LG, Kuehl WM, Battey JF 1994 PCR
amplification from cDNA templates. In: Greenfield S (ed) Basic Methods
in Molecular Biology, 2nd ed. Appleton & Lange, Norwalk, pp
135139
-
Guazzi S, Price M, De Felice M, Damante G, Mattei M-G,
Di Lauro R 1990 Thyroid neclear factor 1 (TTF-1) contains a
homeodomain and displays a novel DNA binding specificity. EMBO J 9:36313639[Medline]
-
Endo T, Shimura H, Saito T, Ikeda M, Ohmori M, Onaya
T 1991 Thyrotropin stimulates glucose-regulated protein (GRP78)
gene expression in rat functional thyroid epithelial cells, FRTL. Mol
Endocrinol 5:905910[Abstract/Free Full Text]
-
Yokomori N, Iwasa Y, Aida K, Inoue M, Tawata M, Onaya
T 1991 Transcriptional regulation of ferritin messenger
ribonucleic acid levels by insulin in cultured rat glioma cells.
Endocrinology 128:14741480[Abstract/Free Full Text]
-
Guest SJ, Hadcockn JR, Watkins DC, Malbon CC 1990 ß1- and ß2-adrenergic receptor expression
in differentiating 3T3L1 cells. J Biol Chem 265:53705375[Abstract/Free Full Text]
-
Thomas RF, Holt BD, Schwinn DA, Liggett SB 1992 Long-term agonist exposure induces upregulation of
ß3-adrenergic receptor expression via multiple cAMP
response elements. Proc Natl Acad Sci USA 89:44904494[Abstract/Free Full Text]
-
Lalli E, Sassone-Corsi P 1995 Thyroid-stimulating
hormone (TSH)-directed induction of the CREM gene in the thyroid gland
participates in the long-term desensitization of the TSH receptor. Proc
Natl Acad Sci USA 92:96339637[Abstract/Free Full Text]
-
Christophe-Hobertus C, Donda A, Javaux F, Vassart G,
Christophe D 1992 Identification of a transcriptional enhancer
upstream from the bovine thyroglobulin gene. Mol Cell Endocrinol 88:3137[CrossRef][Medline]
-
Kambe F, Nomura Y, Okamoto T, Seo H 1996 Redox
regulation of thyroid-transcription factors, Pax-8 and TTF-1, is
involved in their increased DNA-binding activities by thyrotropin in
rat thyroid FRTL-5 cells. Mol Endocrinol 10:801812[Abstract/Free Full Text]
-
Ohmori M, Shimura H, Shimura Y, Kohn LD 1996 A
Y-box protein is a suppressor factor that decreases thyrotropin
receptor gene expression. Mol Endocrinol 10:7689[Abstract/Free Full Text]
-
Endo T, Shimura H, Saito T, Onaya T 1990 Cloning of
malignantly transformed rat thyroid (FRTL) cells with thyrotropin
receptors and their growth inhibition by 3',5'-cyclic adenosine
monophosphate. Endocrinology 126:14921497[Abstract/Free Full Text]
-
Kosugi S, Mori T, Iwamori M, Nagai Y, Imura H 1989 Alpha 2- and beta-adrenergic receptors and adenosine A1 receptor of
FRTL-5 rat thyroid cells in relation to fucosyl GM1 ganglioside.
Endocrinology. 124:27072710
-
Kaestner KH, Flores-Riveros JR, McLenithan JC, Janicot
M, Lane MD 1991 Transcriptional repression of the mouse
insulin-responsive glucose transporter (GLUT4) gene by cAMP. Proc Natl
Acad Sci USA 88:19331937[Abstract/Free Full Text]
-
Cook JS, Lucas JJ, Sibley E, Bolanowski MA, Christy RJ,
Kelly TJ, Lane MD 1988 Expression of the differentiation-induced
gene for fatty acid-binding protein is activated by glucocorticoid and
cAMP. Proc Natl Acad Sci USA 85:29492953[Abstract/Free Full Text]
-
Rohlfs EM, Daniel KW, Premont RT, Kozak LP, Collins
S 1995 Regulation of the uncoupling protein gene (Ucp)
by ß1, ß2, and ß3-adrenergic
receptor subtypes in immortalized brown adipose cell lines. J Biol
Chem 270:1072310732[Abstract/Free Full Text]
-
Perez-Castillo A, Hernandez A, Pipaon C, Santos A,
Obregon M-J 1993 Multiple regulation of S14 gene
expression during brown fat differentiation. Endocrinology 133:545552[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
G.S. Thangjam, P. Agarwal, I. Khan, U.P. Verma, A.K. Balapure, S.G. Rao, and P. Kondaiah
Transglutaminase-2 Regulation by Arecoline in Gingival Fibroblasts
Journal of Dental Research,
February 1, 2009;
88(2):
170 - 175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Shimura, H. Suzuki, A. Miyazaki, F. Furuya, K. Ohta, K. Haraguchi, T. Endo, and T. Onaya
Transcriptional Activation of the Thyroglobulin Promoter Directing Suicide Gene Expression by Thyroid Transcription Factor-1 in Thyroid Cancer Cells
Cancer Res.,
May 1, 2001;
61(9):
3640 - 3646.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. De la Vieja, O. Dohan, O. Levy, and N. Carrasco
Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology
Physiol Rev,
July 1, 2000;
80(3):
1083 - 1105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Miyazaki, H. Shimura, T. Endo, K. Haraguchi, and T. Onaya
Tumor Necrosis Factor-{alpha} and Interferon-{gamma} Suppress Both Gene Expression and Deoxyribonucleic Acid-Binding of TTF-2 in FRTL-5 Cells
Endocrinology,
September 1, 1999;
140(9):
4214 - 4220.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Shimura, A. Miyazaki, K. Haraguchi, T. Endo, and T. Onaya
Analysis of Differentiation-Induced Expression Mechanisms of Thyrotropin Receptor Gene in Adipocytes
Mol. Endocrinol.,
October 1, 1998;
12(10):
1473 - 1486.
[Abstract]
[Full Text]
|
 |
|