help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patibandla, S. A.
Right arrow Articles by Prabhakar, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patibandla, S. A.
Right arrow Articles by Prabhakar, B. S.
Endocrinology Vol. 138, No. 4 1559-1566
Copyright © 1997 by The Endocrine Society

ARTICLES

Differential Reactivities of Recombinant Glycosylated Ectodomains of Mouse and Human Thyrotropin Receptors with Patient Autoantibodies1

Sai A. Patibandla, Gattadahalli S. Seetharamaiah, John S. Dallas, N. Rao Thotakura, Robert L. Peake and Bellur S. Prabhakar

Departments of Microbiology and Immunology (S.A.P., G.S.S., B.S.P.), Pediatrics (J.S.D.), and Internal Medicine (R.L.P.), The University of Texas Medical Branch, Galveston, Texas 77555; and Molecular and Cellular Endocrinology Branch (T.N.R.), National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Bellur S. Prabhakar, Department of Microbiology and Immunology, The University of Texas Medical Branch, Galveston, Texas 77555-1019.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We expressed the extracellular domain of the mouse TSH receptor (mET-gp) using the baculovirus expression system. The recombinant protein was identified as mET-gp by immunoblotting and N-terminal amino acid sequencing. Carbohydrate analysis of the recombinant protein showed that the protein is glycosylated. Experimental antibodies raised against the extracellular domain of the human TSHr (ETSHr) were assayed for reactivity against mET-gp and glycosylated human ETSHr (ETSHr-gp) in an ELISA and found to be comparable. Similarly, both mET-gp and ETSHr-gp proteins neutralized the TSH binding inhibitory immunoglobulin (TBII) activity of rabbit anti-ETSHr antibodies in a RRA. However, when these proteins were compared for their ability to neutralize TBII and blocking activities (TSBAb) of IgG from patients with thyroid autoimmune disorders, only ETSHr-gp was able to neutralize these activities. In contrast, mET-gp partially neutralized, whereas ETSHr-gp completely neutralized the stimulatory (TSAb) activities of IgG from patients. Analyses of reactivities of these two proteins against a panel of anti-peptide and monoclonal antibodies and their protein sequences showed differences in some specific epitopes. These data showed that in spite of significant homology between the two proteins, they exhibit specific epitope differences that are sufficient to cause divergence in their ability to react with patient autoantibodies to TSHr. This suggests that the two proteins might differ in their three-dimensional structure.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
GRAVES’ DISEASE (GD) is a common endocrine disorder characterized by hyperthyroidism, goiter, and exopthalmos (1). The hyperthyroidism of GD is produced by autoantibodies that bind to the TSH receptor (TSHr) and stimulate the overproduction of thyroid hormones. To understand the pathogenesis of GD hyperthyroidism, several laboratories have attempted to develop a mouse model to study autoimmunity to the TSHr (2, 3, 4, 5, 6, 7, 8). These studies showed that immunization of mice with human TSH receptor (hTSHr) produced relatively high levels of antibodies to TSHr with TSH binding inhibitory immunoglobulin (TBII) activities. However, despite high levels of antibodies to TSHr, the thyroid function in these mice was not severely perturbed. This has led to the speculation that differences in the amino acid sequences of human (9) and mouse (10, 11) TSHr may be responsible for the apparent lack of correlation between the antibody titers and perturbation in thyroid function. An earlier study in which thyroid stimulating antibodies (TSAb) from GD patients were tested on canine, bovine, and cavian thyroid glands in vitro and on the mouse thyroid in vivo showed that many Ig samples were incapable of stimulating nonhuman thyroids (12). Other reports have also shown that TSHr antibodies showed phylogenetic specificity related to their interaction with the receptor on human, guinea pig, and bovine thyroid tissue (13, 14, 15). Together, these data strongly suggest that there might be differences in the species specificity of autoantibodies.

In this paper, we describe the expression and characterization of the glycosylated extracellular domain of the mouse TSHr (mET-gp) using a baculovirus expression system. We compared the reactivities of mET-gp and ETSHr-gp with IgG from patients with autoimmune thyroid disorders, sera from rabbits immunized with TSHr or TSHr peptides, and TSHr-specific monoclonal antibodies (mAbs). Our results show that although these two proteins are antigenically similar, they do differ in specific epitopes that interact with autoantibodies in patients’ sera.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Expression of glycosylated ectodomain of mouse TSH receptor (mET-gp)
A complementary DNA (cDNA) encoding the full-length mouse TSHr (mTSHr) was used as template in a PCR to obtain a cDNA encoding the ectodomain of mTSHr (amino acids 22–417) without the mouse signal peptide. The primers used were 5' CGCGGATCCATGAAAAAGTGTGCGTCTCCACCC 3' (sense) and 5' CGCGGATCCATGAAAAAGTGTGCGTCTCCA 3' (antisense). The PCR amplification resulted in a 1.2-kb cDNA fragment representing nucleic acid residues 118-1307 flanked by BamH1 sites. PCR was performed in 100 µl buffer containing 50 mM Tris-HCl (pH 8.3), 2 mM MgCl2, and 1 mM each of deoxynucleotide triphosphates and 0.5 U Taq polymerase (Gene Amp PCR kit, Perkin-Elmer/Cetus, Norwalk, CT). The amplification product was gel purified and subcloned into BamH1 site of a baculovirus transfer vector pAcGP67B (Pharmingen, San Diego, CA). This vector contains the gp67 signal sequence in tandem with a multiple cloning site. The gp67 signal sequence contains one of the most efficient baculovirus-encoded signal sequences for protein secretion, which is efficiently removed during the maturation of the protein.

For the expression of the recombinant mET-gp protein, Sf9 cells were cotransfected with 0.5 µg linearized Baculogold viral DNA (Pharmingen) and 2 µg murine ETSHr/pACGP67B DNA, according to the manufacturer’s protocol. After 5 days, transfection supernatant was harvested and amplified to produce a high-titered virus stock solution. For the production of recombinant mET-gp protein, flasks seeded with Sf9 cells were infected with a stock virus solution. The cells were harvested after 3 days and lysed in a lysis buffer (30 mM Tris, pH 7.4, 150 mM NaCl, 10 mM magnesium acetate, 1% NP40, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 0.5 mM phenylmethylsulfonylfluoride). The insoluble pellet was solubilized in 50 mM Tris, pH 7.4, containing 0.5% SDS. For large-scale protein production, Sf9 cells grown in suspension cultures were infected. The 63-kDa mET-gp protein was purified on SDS-PAGE as described earlier (16). Briefly, the crude extracts obtained from recombinant virus infected Sf9 cells were treated with lysis buffer, nuclease buffer, and finally with high-salt buffer. The proteins were then subjected to SDS-PAGE. Pieces of gel corresponding to 63 kDa were excised, and protein was eluted from the gels using bicarbonate buffer (50 mM ammonium bicarbonate, 0.1% SDS). The SDS was removed with cold 80% acetone, and the protein was resuspended in 0.05 M Tris, pH 7.5, containing 0.1% SDS. This 63-kDa gel pure protein was used in all subsequent ELISAs.

Production of recombinant ETSHr-gp protein
Expression and production of glycosylated ETSHr-gp protein has been described earlier (17). Briefly, cDNA encoding the ectodomain of the hTSHr lacking the signal sequence representing nucleic acid residues 64–1248 was obtained by digesting ETSHr-pAcYM1 with BamH1 (18). This 1.2-kb fragment was subcloned into the BamH1 site of the baculovirus transfer vector pAcGP67B. Sf9 cells were cotransfected with 0.5 µg linearized Baculogold viral DNA (Pharmingen) and 2 µg ETSHr/pAcGP67B DNA according to the manufacturer’s protocol. Recombinant ETSHr-gp was produced by infecting Sf9 cells with the recombinant virus, as described above. The 63-kDa ETSHR-gp was purified on SDS-PAGE, as described for mET-gp, and used in all ELISAs.

Western blot analysis
Proteins were subjected to 10% SDS-PAGE and stained with 0.05% Coomassie brilliant blue R250. For immunoblotting, the proteins were electrophoretically transferred to nitrocellulose membranes. Blots were incubated for 1 h with blocking buffer (5% nonfat dry milk in 200 mM NaCl with 0.1% Tween-20). Blots were then incubated for 1 h each with the following reagents in succession with washing between each step: 1:100 diluted ETSHr-specific mAbs 49, 1:2000 diluted peroxidase labeled goat antimouse IgG (Pierce, Rockford, IL). The reactive bands on the blots were visualized by using 4-chloro-1-naphthol as the substrate.

Amino acid sequence analysis
The proteins were separated on a 10% gel and electrophoretically transferred onto polyvinylidene difluoride membrane (19) and stained with amido black. The 63-kDa band corresponding to mET-gp was excised from the membrane, and amino acid sequence analysis was performed using an Applied Biosystems 475A protein/peptide microsequencer (Foster City, CA) with an on-line model 120A phenylthiohydantoin amino acid analyzer and a model 900A data processor (20).

Carbohydrate compositional analysis
The protein bands on the polyvinylidene difluoride membrane representing mET-gp were cut into small pieces and subjected to hydrolysis in the presence of 2.75 M trifluoroacetic acid (sequanal grade from Pierce) in a final volume of 200 µl in a 1.7-ml polypropylene tube with a screw cap at 100 C for 4 h. The hydrolysate was dried in a speedVac (Savant Instruments, Farmingdale, NY) and resuspended in 50 µl deionized water. Carbohydrate composition analysis was performed on an aliquot using high pH anion exchange chromatography on a Dionex BioLC system using an AS6 Ionpak column (Dionex, Sunnyvale, CA). The monosaccharides were eluted isocratically by 12 mM NaOH and monitored by pulsed amperometric detector with no postcolumn addition of base.

Reactivity of {propto}-ETSHr and {propto}-peptide rabbit antibodies to mET-gp and ETSHr-gp proteins
The reactivity of antibodies raised against the nonglycosylated human ETSHr protein ({propto}-ETSHr-0, 1, 2), glycosylated human ETSHr ({propto}-ETSHr-gp1 and {propto}-ETSHr-gp2), and synthetic peptides ({propto}-p325, {propto}-p352, {propto}-p357, {propto}-p367, {propto}-p377; Table 1Go) was tested against the glycosylated mET-gp and ETSHr-gp proteins in an ELISA as described previously (21). The five synthetic peptides used in this study were derived from the carboxyl-terminal end of the human ETSHr, spanning amino acids 325–397 (Table 1Go). The production of rabbit antibodies to these peptides was previously described (22).


View this table:
[in this window]
[in a new window]
  		Table 1. Human and mTSHr peptide sequences

 
The sequence corresponding to amino acids 350–416 of hTSHr was expressed using a pGEX-3x vector system (Promega, Madison, WI) as a recombinant glutathione S-transferase fusion protein (GF-2). GF-2 was purified using glutathione S-transferase purification module (Pharmacia), according to the manufacturer’s protocol. The GF-2 protein was used to immunize rabbits for an 8- to 12-week period for the production of antibodies as described previously (22). {propto}-GF-2 antibodies were found to block TSH binding in a RRA and had TBII activity of 36%. The reactivity of {propto}-GF-2 was tested against the glycosylated mET-gp and ETSHr-gp proteins in an ELISA

Reactivity of mAbs to mET-gp and ETSHr-gp proteins
Generation of mouse mAbs 28 and 49 to ETSHr was described previously (23). mAb 28 has been shown to bind to peptides spanning amino acids 22–46 of the hTSHr, and mAb 49 binds to a conformational epitope. The reactivities of mAbs 28 and 49 were tested against mET-gp and ETSHr-gp proteins in an ELISA. The binding was detected using peroxidase conjugated goat antimouse antibody (Caltag Laboratories, San Francisco, CA).

Neutralization of TBII activity of TSHr autoantibodies
Insect cells (3 x 106) expressing either mET-gp or ETSHr-gp were incubated for 1 h at room temperature (RT) with rabbit antisera (50 µl) raised against human ETSHr protein, IgG from these rabbit sera, or IgG from hypothyroid or hyperthyroid patients. The sera and IgG fractions were then tested for their TSH-binding inhibition activity, using a commercially available RRA kit (Kronus, Dana Point, CA). When IgG extracts were assayed, 50 µl test IgG along with 50 µl normal serum was added to provide adequate protein concentration and thus ensure proper precipitation of receptor-radioligand. Results are expressed as % TBII.

Human sera
Sera were collected from patients with either GD or primary myxedema (patients 51–63 and 81–82, respectively). Patients were diagnosed using appropriate standard clinical and laboratory criteria. All samples used in this study were found to contain TBII activity. Of these samples, we selected three with TSAb activity (patients 61–63) and two with potent TSBAb activity (patients 81 and 82) for use in our bioassay studies. Sera were also obtained from healthy normal volunteers with no family history of thyroid autoimmunity. The IgG fractions from sera were purified on a protein G Sepharose (GIBCO BRL, Grand Island, NY) column.

Neutralization of biological activity of autoantibodies
IgG fractions (50 µg) from hypothyroid or hyperthyroid patients or normals were preincubated with insect cells (3 x 106) expressing either mET-gp or ETSHr-gp for 1 h at RT. Chinese hamster ovary (CHO) cells permanently transfected with a full-length hTSHr cDNA, kindly provided by Drs. Leonard D. Kohn and Kazuo Tahara (24, 25), were seeded in 96-well plates and grown to confluency.

To test for reversal of stimulatory effect, IgG fractions mixed with the recombinant protein were added individually to duplicate wells in hypotonic HBSS containing 0.5 mM 3-isobutyl-1-methylxanthine and incubated at 37 C in 5% CO2 for 2 h. Supernatants were collected from individual wells and assayed for cAMP using a commercially available kit (Dupont, Boston, MA) (26). The data are expressed as picomoles cAMP per milliliter and represent the mean of values obtained from two experiments carried out in duplicate.

To test for reversal of inhibitory effects, antibodies mixed with the recombinant protein were added individually to duplicate wells in hypotonic HBSS. After incubation at 37 C for 30 min, HBSS containing 0.5 mM 3-isobutyl-1-methylxanthine along with hTSH (5 x 10-10 M) (NIDDK-hTSH-1–7; AFP-8644P; National Hormone and Pituitary Program, NIDDK, Baltimore, MD) was added to the wells and incubated for 2 h at 37 C. Supernatants were collected from individual wells and assayed for cAMP. The data are expressed as percentage of inhibition of cAMP stimulation by hTSH and represent the mean of values obtained from two experiments carried out in duplicate.

Statistical analysis
Statistical analyses were done using a paired Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of mET-gp in insect cells
Sf9 insect cells infected with recombinant baculovirus containing the cDNA for mET-gp were analyzed by SDS-PAGE and Western blot analysis. Figure 1AGo shows Coomassie blue staining of recombinant mET-gp protein. Two major protein bands at approximately 63 and 50 kDa were present in recombinant virus-infected cell extracts (lane 3) but not in uninfected cell extracts (lane 2). The 63- and 50-kDa protein bands presumably represent the glycosylated and the nonglycosylated forms of mET-gp. The bands were identified as mET-gp by Western blot analysis (Fig. 1BGo).



View larger version (32K):
[in this window]
[in a new window]
  		Figure 1. Expression of extracellular domain of mET-gp in insect cells. Proteins from recombinant or wild-type infected cells were separated on a 10% SDS-PAGE gel and stained with Coomassie blue (A) or subjected to Western blot analysis (B). A and B, Lane 1, molecular weight marker proteins; lanes 2 and 3, proteins obtained after lysis buffer extraction of uninfected and recombinant virus infected insect cells, respectively; lane 4, gel pure mET-gp.

 
Amino acid sequence analysis
The identity of the 63-kDa protein was further confirmed by N-terminal amino acid sequencing. The sequence obtained was Ala-Asp-Leu-Gly-Ser-Met-Lys-Lys-X-Ala-Ser. The italicized amino acids were identical to the amino acid sequence of the N-terminus of the mouse TSHr protein predicted from the DNA sequence (10, 11). The first six amino acids corresponded to the sequence from the transfer vector pAcGP67B. This sequence analysis confirmed the identity of the recombinant protein as mET-gp.

Carbohydrate analysis
The cDNA sequence of mouse ETSHr indicated the presence of potential glycosylation sites. Carbohydrate analysis of the 63-kDa mET-gp protein confirmed that the protein was glycosylated and showed the presence of N-acetyl glucosamine and mannose. The relative concentrations of these sugars were 0.475 and 1.47 nmol, respectively. However, the 50-kDa protein did not contain any sugars. The predicted molecular mass of the nonglycosylated protein (amino acids 22–416) is approximately 50 kDa. Based on the molecular mass of the protein and its reactivity with TSHr-specific antibodies, we conclude that it represented the nonglycosylated form of the mET-gp.

Reactivity of anti-ETSHr antibodies
The reactivities of anti-ETSHr antibodies ({propto}-ETSHr-0, {propto}-ETSHr-1, and {propto}-ETSHr 2) were tested against mET-gp protein and ETSHr-gp protein in an ELISA. The relative antibody titers of {propto}-ETSHr-0 (1:16,000) (Fig. 2Go) and {propto}-ETSHr-2 (1:16,000) (not shown) were similar against both ETSHr-gp and mET-gp proteins. The antibody titer of {propto}-ETSHr-1 was 4-fold higher against ETSHr-gp (1:256,000) when compared with the titer against mET-gp protein (1:64,000). The reactivity of {propto}-ETSHr-gp-1 (1:512,000) and -2 (1:128,000) were comparable against ETSHr-gp and mET-gp proteins (Fig. 2Go).



View larger version (27K):
[in this window]
[in a new window]
  		Figure 2. Binding of {propto}-ETSHr antibodies to mET-gp and ETSHr-gp. IgG titers of antisera from rabbits immunized with either ETSHr ({propto}-ETSHr-0 and {propto}-ETSHr-1) or glycosylated ETSHr ({propto}-ETSHr-gp-1, {propto}-ETSHr-gp-2) were determined against mET-gp (solid line) and ETSHr-gp (dotted line) proteins using an ELISA.

 
Neutralization of TBII activity of experimental TSHr antibodies
Previously, we showed that ETSHr-gp neutralized the TBII activity of experimentally induced antibodies to ETSHr (17). Therefore, we tested the ability of mET-gp protein to inhibit the TBII activity of {propto}-TSHr antibodies ({propto}-ETSHr-1 and {propto}-ETSHr-2) and an {propto}-peptide antibody ({propto}-p367) in a RRA. {propto}-ETSHr-1, {propto}-ETSHr-2 and {propto}-p367 (TBII activities of 45, 53, and 40%, respectively) were preincubated with equivalent amounts of either wild-type baculovirus-infected cells, mET-gp, or ETSHr-gp and then tested for their TBII activity. As shown in Table 2Go, preincubation with either mET-gp or ETSHr-gp completely neutralized the TBII activities of {propto}-TSHr and {propto}-p367 sera. Preincubation with wild-type baculovirus-infected cells did not affect the TBII activity of these sera. Similar experiments were carried out using IgG extracted from experimental sera, and the results obtained were similar to those obtained using unfractionated sera (not shown).


View this table:
[in this window]
[in a new window]
  		Table 2. Neutralization of experimental ETSHr antibodies

 
Effect of mET-gp on TBII activity of hTSHr autoantibodies
IgG samples from patients with TBII activities ranging from 32–67% were incubated with either mET-gp or ETSHr-gp and then tested for their TBII activity. Preincubation of IgG fractions with mET-gp protein did not affect the TBII activity of any of the 12 samples tested. Whereas ETSHr-gp protein significantly reversed the TBII activity in samples from both hyperthyroid and hypothyroid patients (Table 3Go), mET-gp did not have any effect even when a 10-fold excess relative to ETSHr-gp was used.


View this table:
[in this window]
[in a new window]
  		Table 3. Neutralization of autoantibodies by mET-gp and ETSHr-gp

 
Effect of mET-gp on bioactivities of hTSHr autoantibodies
To see whether these proteins would exhibit differential properties in reversing the biological properties of IgGs, we tested them in bioassays. Figure 3Go shows the effects of preincubating the IgG fractions from two patients with mET-gp and ETSHr-gp on their ability to inhibit TSH-mediated stimulation of cAMP (TSBAb). Samples 81 and 82 showed TSBAb activities of 91.5% and 88.2%, respectively. Preincubation with mET-gp protein did not show any significant effect on the TSBAb activities of either IgGs (P > 0.05). In contrast, preincubation with ETSHr-gp protein reduced the TSBAb activities of 81 and 82 to 17% (P < 0.005) and 10.8% (P < 0.005), respectively.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 3. Neutralization of TSBAb activity in patients’ immunoglobulins. IgG preparations from patients (81–82) and a normal (n1) were incubated at RT for 1 h with insect cells expressing either no protein (black bars), mET-gp (hatched bars), or ETSHr-gp (gray bars) and then tested for their ability to block TSH (5 x 10-10 M)-mediated production of cAMP by CHO cells permanently transfected with a full-length hTSHr cDNA. Results are expressed as percent inhibition of cAMP production when stimulated with 5 x 10-10 M TSH.

 
When the proteins were further tested for their ability to inhibit the stimulatory activity of antibodies (TSAb) from three patients (patients 61, 62, and 63 with 67%, 30%, and 36% TBII, respectively), mET-gp significantly decreased the stimulation of cAMP production by patient 61 (from 163.7 ± 9.8 to 92.5 ± 6.8 pmol/ml, P < 0.05), patient 62 (from 139 ± 19 to 80 ± 37 pmol/ml, P < 0.05), and patient 63 (from 44.6 ± 6.4 to 13 ± 6.8 pmol/ml, P < 0.005) (Fig. 4Go). Preincubation of these sera with ETSHr-gp protein completely neutralized the TSAb activity of patient 61 (from 163.7 ± 9.8 to12.7 ± 0.9 pmol/ml, P < 0.005), patient 62 (from 139 ± 19 to 12 ± 8 pmol/ml, P < 0.005), and patient 63 (from 44.6 ± 6.4 to 8 ± 1 pmol/ml, P < 0.05).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 4. Neutralization of TSAb activity in patients’ immunoglobulins. IgG preparations from patients (61–63) and a normal (n1) subject were incubated at RT for 1 h with insect cells expressing either no protein (black bars), mET-gp (hatched bars), or ETSHr-gp (gray bars) and then tested for their ability to increase cAMP production by CHO cells permanently transfected with a full-length hTSHr cDNA.

 
Reactivity of antipeptide and mAb
Next, we tested the antibody titers of antipeptide antibodies against mET-gp and ETSHr-gp proteins. The relative antibody titers of {propto}-p352(1:8000) and {propto}-p367 (1:8000) were similar against both proteins (Fig. 5Go). The antibody titer of {propto}-p357 was 1-fold higher against ETSHr-gp (1:128,000) when compared with that against mET-gp (1:64,000). The antibody titers of {propto}-p325 and {propto}-p377 were 1600 and 400, respectively, against the ETSHr-gp. These antibodies, however, did not show any reactivity to mET-gp protein. The titers of anti-GF2 protein antibodies against ETSHr-gp (1:256,000) were comparable with that against the mET-gp protein (1:128,000) (Fig. 5Go).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 5. Binding of {propto}-peptide antibodies to mET-gp and ETSHr-gp. IgG titers of antisera from rabbits immunized with either glutathione 5 transferase fusion protein representing amino acids 350–416 of hTSHr (GF-2) or TSHr-derived peptides (i.e. p325, p352, p357, p367, p377) were determined against mET-gp (solid line) and ETSHr-gp (dotted line) proteins using an ELISA.

 
Next, we tested the reactivity of mouse mAbs with known binding specificities against ETSHr-gp and mET-gp. mAb 28 showed strong reactivity to ETSHr-gp but weak or no reactivity to mET-gp. Although mAb 49 showed reactivity to both ETSHr-gp (1:512) and mET-gp (1:128), the reactivity to mET-gp was consistently lower at all dilutions tested (Fig. 6Go).



View larger version (12K):
[in this window]
[in a new window]
  		Figure 6. Binding of mouse mAbs to mET-gp and ETSHr-gp. IgG titers of mAbs 28 and 49 were determined against mET-gp (solid line) and ETSHr-gp (dotted line) using an ELISA.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In the present study we expressed high levels of glycosylated mET-gp protein using a baculovirus expression system. The identity of the protein was confirmed by Western blotting and N-terminal sequence analysis. The N-terminal sequence analysis showed that the gp67 signal peptide was efficiently cleaved by the insect cells, and the carbohydrate analysis showed that the protein was glycosylated. Together, these results showed that the mET-gp was posttranslationally modified.

We used the mET-gp protein to analyze the reactivity of experimental and hTSHr antibodies. Both mET-gp and ETSHr-gp showed comparable ELISA reactivities with experimental antibodies raised against unglycosylated ETSHr ({propto}-ETSHr-0, {propto}-ETSHr-1, {propto}-ETSHr-2) and glycosylated ETSHr-gp ({propto}-ETSHr-gp-1 and {propto}-ETSHr-gp-2) with the exception of {propto}-ETSHr-1, in which the titer against ETSHr-gp was somewhat higher (Fig. 2Go). These data showed that the overall antigenicity of the two proteins was similar. Because both of these proteins showed comparable binding to many of our experimental sera, we wanted to see whether they could neutralize functional properties of these sera. Therefore, we initially tested these proteins for their ability to neutralize the TBII activity in experimental antibodies. Both mET-gp and ETSHr-gp completely reversed the TBII activity in both anti-TSHr antibodies and an antipeptide antibody (Table 2Go), which indicated that they are structurally similar.

We reported earlier that ETSHr-gp can neutralize the TSHr autoantibodies present in the sera of hyperthyroid as well as hypothyroid patients (17). Therefore, we tested for the ability of mET-gp to neutralize the TBII activity in hypothyroid and hyperthyroid patients’ sera. To our surprise, mET-gp did not neutralize any of the autoantibodies in the RRA. In contrast, as expected, ETSHr-gp neutralized TBII activity of autoantibodies from all patients tested (Table 3Go). Next, we carried out bioassays to measure the ability of mET-gp and ETSHr-gp proteins to reverse the TSBAb activity in patients’ sera. As shown in Fig. 3Go, ETSHr-gp neutralized this activity. These results are consistent with results obtained in the TBII assay. However, mET-gp, although less effective than the ETSHr-gp, significantly neutralized the TSAb activities (Fig. 4Go). These results, although somewhat unexpected, were not totally surprising. Zakarija et al. (12) showed that human autoantibodies to TSHr have differential effects on thyroids from different species (12). They tested 33 IgG samples from GD patients, which stimulated human thyroid slices in vitro, to stimulate cAMP production by thyroids from dogs, guinea pigs, calves, and mice. Their study showed that only 39% (13/33) of IgG preparations from GD patients stimulated mouse thyroid in vivo, and 14/27, 8/23, and 12/16 could stimulate dog, guinea pig, and calf thyroid in vitro, respectively. Eleven samples did not stimulate any of the thyroids from nonhuman species. These apparent differences in stimulatory autoantibody reactivity could be due to differences in the amino acid sequence of the protein.

To test whether smaller differences in antigen specificity can be detected, we compared the binding of antibodies raised against either synthetic peptides derived from a highly immunogenic region of the TSHr (amino acids 352–397) or a fusion protein (amino acids 350–416) to mET-gp and ETSHr-gp. The ELISA reactivities with both proteins were comparable, except in the case of {propto}-p325 and {propto}-p377. These two peptide antibodies reacted with the ETSHr-gp, although at a lower level (titers of 1600 and 400, respectively) relative to the binding seen with the other antibodies. In contrast, {propto}-p325 and {propto}-p377 did not show any binding to mET-gp (Fig. 5Go). To determine whether sequence differences in these peptides could explain the reactivities of peptide antibodies against the two proteins, we compared their predicted sequences (Table 1Go). This analysis showed that antibodies that exhibited similar binding against both proteins were raised against peptides (i.e. p352, p357, and 367) that had only one to two amino acid differences between the two species. Moreover, these differences represented only conservative substitutions (i.e. valine for isoleucine and glutamic acid for aspartic acid). In contrast, peptides p325 and p377 had six and three amino acids differences, respectively. All six substitutions in p325 were nonconservative, whereas p377 had two substitutions that were conservative, and one that was nonconservative (asparagine to serine). These nonconservative amino acid substitutions might have either changed the epitope or resulted in their loss on the mET-gp.

When reactivities with mAbs were compared (Fig. 6Go), significant differences were observed. mAb 28, which binds to a region on ETSHr represented by amino acids 22–46 (23), showed strong reactivity to ETSHr-gp but bound weakly to mET-gp. Comparison of mouse and hTSHr amino acid sequences in this region showed six amino acids differences (Table 1Go), with three nonconservative substitutions of methionine to lysine, glycine to glutamic acid, and glutamine to histidine at positions 21, 22, and 45, respectively. Although the epitope of mAb 49 is not known, the higher reactivity of mAb 49 to ETSHr-gp compared with mET-gp suggests that there is a significant difference between the two proteins in the unknown epitope recognized by this antibody. Together, the data obtained from experimental sera indicated that although mET-gp is structurally very similar to ETSHr-gp, it does exhibit differences in the expression of specific epitopes.

The mouse and hTSHr are structurally very similar and show a greater than 87% homology in their amino acids sequences. However, specific amino acids substitutions could be directly responsible for the differences noted in the reactivity of certain antibodies with narrow binding specificity. Moreover, although both proteins were expressed in insect cells using identical protocols, the carbohydrate composition was different. The ETSHr-gp contains N-acetylglucosamine, mannose, and galactose (17), whereas mET-gp contained only N-acetylglucosamine and mannose. Furthermore, human ETSHr has six (at amino acids 77, 99, 113, 177, 198, and 302) and mouse ETSHr has five (at amino acids 77, 99, 177, 198, and 302) potential glycosylation sites. Additional studies using mTSHr and hTSHr chimeras might resolve structural differences responsible for their differential reactivity with patient sera and thus lead to further delineation of autoantibody epitopes. Our observations, along with earlier studies on species specificity (12, 13, 14, 15) of autoantibodies, might be relevant to understanding our inability to induce a severe form of GD in experimental animals by immunization with human ETSHr.


   Acknowledgments
 
We thank Dr. J. Larry Jameson for providing us the cDNA encoding the full-length mouse TSHr, and Drs. Leonard D. Kohn and Kazuo Tahara for providing the cDNA encoding the full-length hTSHr and transfected CHO cells.


   Footnotes
 
1 This study was supported in part by the James W. McLaughlin Fellowship Fund (to S.A.P.) and NIH Grants DK-47417 and DK-44972 (to B.S.P.). Back

Received December 23, 1996.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Volpe R (ed) 1985 Autoimmune thyroid disease. In: Autoimmunity and Endocrine Disease. Marcel Dekker, New York, pp 109–285
  2. Patibandla SA, Wagle NM, Seetharamaiah GS, Fan JL, Dallas JS, Prabhakar BS 1996 Experimental autoimmunity to thyrotropin receptor. Exp Clin Endocrinol Diab 104[Suppl 3]:28–32
  3. Wagle NM, Dallas JS, Seetharamaiah GS, Fan JL, Desai RK, Memar O, Rajaraman S, Prabhakar BS 1994 Induction of hyperthyroxinemia in Balb/c but not in several other strains of mice. Autoimmunity 18:103–112[Medline]
  4. Costagliola S, Many MC, Stalmans-Falys M, Tonacchera M, Vassart G, Ludgate M 1994 Recombinant thyrotropin receptor and the induction of autoimmune thyroid disease in Balb/c mice: a new animal model. Endocrinology 135:2150–2159[Abstract]
  5. Marion S, Braun JM, Ropars A, Kohn LD, Charreire J 1994 Induction of autoimmunity by immunization of mice with human thyrotropin receptor. Cell Immunol 158:329–341[CrossRef][Medline]
  6. Soliman M, Kaplan E, Straus F, Fisfalen ME, Hidaka Y, Guimaraes V, DeGroot JL 1995 Graves’ disease in severe combined immunodeficient mice. J Clin Endocrinol Metab 80:2848–2855[Abstract/Free Full Text]
  7. Carayanniotis G, Huang GC, Nicholson LB, Scott T, Allain P, McGregor AM, Banga JP 1995 Unaltered thyroid function in mice responding to a highly immunogenic thyrotropin receptor: implications for the establishment of a mouse model for Graves’ disease. Clin Exp Immunol 99:294–302[Medline]
  8. Vlase H, Nakashima M, Graves PN, Tomer Y, Morris JC, Davies TF 1995 Defining the major antibody epitopes on the human thyrotropin receptor in immunized mice: evidence for intramolecular epitope spreading. Endocrinology 136:4415–4423[Abstract]
  9. Nagayama Y, Kaufman KD, Seto P, Rapoport B 1989 Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem Biophys Res Commun 165:1184–1190[CrossRef][Medline]
  10. Gu WX, Du GG, Kopp P, Rentoumis A, Albanese C, Kohn LD, Madison LD, Jameson JL 1995 The thyrotropin (TSH) receptor transmembrane domain mutation (Pro556-Leu) in the hypothyroid hyt/hyt mouse results in plasma membrane targeting but defective TSH binding. Endocrinology 136:1–8
  11. Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM, Taylor NA, Puett D, Jin S 1994 Identification of a point mutation in the thyrotropin receptor of the hyt/hyt hypothyroid mouse. Mol Endocrinol 8:129–138[Abstract]
  12. Zakarija M, McKenzie JM 1978 Zoological specificity of human thyroid-stimulating antibody. J Clin Endocrinol Metab 47:249–254[Abstract]
  13. Adams DD 1980 Thyroid-stimulating autoantibodies. Vitam Horm 38:119–203[Medline]
  14. Smith BR, Hall R 1974 Thyroid-stimulating immunoglobulins in Graves’ disease. Lancet 2:427–431[CrossRef][Medline]
  15. Hall R, Smith BR, Mukhtar ED 1975 Thyroid stimulators in health and disease. Clin Endocrinol (Oxf) 4:213–230[Medline]
  16. Seetharamaiah GS, Kurosky A, Desai RK, Dallas JS, Prabhakar BS 1994 A recombinant extracellular domain of the thyrotropin (TSH) receptor binds TSH in the absence of membranes. Endocrinology 134:549–554[Abstract]
  17. Seetharamaiah GS, Dallas JS, Patibandla SA, Thotakura NR, Prabhakar BS 1997 Requirement of glycosylation of the human thyrotropin receptor ectodomain for its reactivity with autoantibodies in patients’ sera. J Immunol, in press
  18. Seetharamaiah GS, Desai RK, Dallas JS, Tahara K, Kohn LD, Prabhakar BS 1993 Induction of TSH binding inhibitory immunoglobulins with the extracellular domain of the human thyrotropin receptor produced using the baculovirus expression system. Autoimmunity 14:315–320[Medline]
  19. Matsusdaira P 1987 Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J Biol Chem 262:10035–10038[Abstract/Free Full Text]
  20. Smith JS, Miller BT, Kurosky A 1991 Biotinylated peptides/protein: II. Identification of biotinylated lysyl phenylthiohydantoins. Anal Biochem 197:254–257[Medline]
  21. Wagle NM, Patibandla SA, Dallas JS, Morris JC, Prabhakar BS 1995 Thyrotropin receptor specific antibodies in Balb/cJ mice with experimental hyperthyroxinemia show a restricted binding specificity and belong to the immunoglobulin G1 subclass. Endocrinology 136:3461–3469[Abstract]
  22. Dallas JS, Desai RK, Cunningham SJ, Morris JC, Seetharamaiah GS, Wagle NM, Goldblum RM, Prabhakar BS 1994 Thyrotropin (TSH) interacts with multiple discrete regions of the TSH receptor: polyclonal rabbit antibodies to one or more of these regions can inhibit TSH binding and function. Endocrinology 134:1437–1445[Abstract]
  23. Seetharamaiah GS, Wagle NM, Morris JC, Prabhakar BS 1995 Generation and characterization of monoclonal antibodies to the human thyrotropin receptor: antibodies can bind to discrete conformational or linear epitopes and block TSH binding. Endocrinology 136:2817–2824[Abstract]
  24. Kim WB, Cho BY, Park HY, et al 1996 Epitopes for thyroid-stimulating antibodies in Graves’ sera: a possible link of heterogeneity to differences in response to antithyroid drug treatment. J Clin Endocrinol Metab 81:1758–1767[Abstract]
  25. Tahara K, Ban T, Minegishi T, Kohn LD 1991 Immunoglobulins from Graves’ disease patients interact with different sites on TSH receptor/LH-CG receptor chimeras than either TSH or immunoglobulins from idiopathic myxedema patients. Biochem Biophys Res Commun 179:70–77[CrossRef][Medline]
  26. Dallas JS, Cunningham SJ, Patibandla SA, Seetharamaiah GS, Morris JC, Tahara K, Kohn LD, Prabhakar BS 1996 Thyrotropin (TSH) receptor antibodies (TSHrAb) can inhibit TSH-mediated cyclic adenosine 3',5'-monophosphate production in thyroid cells by either blocking TSH binding or affecting a step subsequent to TSH binding. Endocrinology 137:3329–3339[Abstract]



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
S. M. McLachlan, Y. Nagayama, and B. Rapoport
Insight into Graves' Hyperthyroidism from Animal Models
Endocr. Rev., October 1, 2005; 26(6): 800 - 832.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Xing, H. Usadel, Y. Cohen, Y. Tokumaru, Z. Guo, W. B. Westra, B. C. Tong, G. Tallini, R. Udelsman, J. A. Califano, et al.
Methylation of the Thyroid-stimulating Hormone Receptor Gene in Epithelial Thyroid Tumors: A Marker of Malignancy and a Cause of Gene Silencing
Cancer Res., May 1, 2003; 63(9): 2316 - 2321.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
J. G. Cundiff, S. Kaithamana, G. S. Seetharamaiah, J. R. Baker Jr., and B. S. Prabhakar
Studies Using Recombinant Fragments of Human TSH Receptor Reveal Apparent Diversity in the Binding Specificities of Antibodies That Block TSH Binding to Its Receptor or Stimulate Thyroid Hormone Production
J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4254 - 4260.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Kaithamana, J. Fan, Y. Osuga, S.-G. Liang, and B. S. Prabhakar
Induction of Experimental Autoimmune Graves' Disease in BALB/c Mice
J. Immunol., November 1, 1999; 163(9): 5157 - 5164.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. Graves, A. Pritsker, and T. F. Davies
Post-Translational Processing of the Natural Human Thyrotropin Receptor: Demonstration of More than Two Cleavage Sites
J. Clin. Endocrinol. Metab., June 1, 1999; 84(6): 2177 - 2181.
[Abstract] [Full Text]

Home page
 Endocr. Rev.Home page
B. Rapoport, G. D. Chazenbalk, J. C. Jaume, and S. M. McLachlan
The Thyrotropin (TSH)-Releasing Hormone Receptor: Interaction with TSH and Autoantibodies
Endocr. Rev., December 1, 1998; 19(6): 673 - 716.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
Y. Osuga, S.-G. Liang, J. S. Dallas, C. Wang, and A. J. W. Hsueh
Soluble Ecto-Domain Mutant of Thyrotropin (TSH) Receptor Incapable of Binding TSH Neutralizes the Action of Thyroid-Stimulating Antibodies from Graves' Patients
Endocrinology, February 1, 1998; 139(2): 671 - 676.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. A. Patibandla, J. S. Dallas, G. S. Seetharamaiah, K. Tahara, L. D. Kohn, and B. S. Prabhakar
Flow Cytometric Analyses of Antibody Binding to Chinese Hamster Ovary Cells Expressing Human Thyrotropin Receptor
J. Clin. Endocrinol. Metab., June 1, 1997; 82(6): 1885 - 1893.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patibandla, S. A.
Right arrow Articles by Prabhakar, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patibandla, S. A.
Right arrow Articles by Prabhakar, B. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals