| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Orthopedics, Mayo Clinic, Rochester, Minnesota 55905
Address all correspondence and requests for reprints to: Russell Turner, Ph.D., 369 Medical Science Building, Mayo Clinic, Rochester, Minnesota 55905.
| Abstract |
|---|
|
|
|---|
2(1) subunit of type 1 collagen, osteocalcin,
transforming growth factor-ß, and insulin-like growth factor I in the
contralateral proximal tibial metaphysis and for the collagen subunit
in periosteum pooled from tibiae and femora and decreased cancellous
bone area. Compared to ovariectomized weight-bearing rats, the flight
group experienced decreases in periosteal bone formation, collagen
subunit mRNA levels, and cancellous bone area. The flight rats had a
small decrease in the cancellous mineral apposition rate, but no change
in the calculated bone formation rate. Also, spaceflight had no effect
on cancellous osteoblast and osteoclast perimeters or on mRNA levels
for bone matrix proteins and signaling peptides. On the other hand,
spaceflight resulted in an increase in bone resorption, as ascertained
from the diminished retention of a preflight fluorochrome label. This
latter finding suggests that osteoclast activity was increased. In a
follow-up ground-based experiment, unilateral sciatic neurotomy of
ovariectomized rats resulted in cancellous bone loss in the unloaded
limb in excess of that induced by gonadal hormone deficiency. This
additional bone loss was arrested by estrogen replacement. We conclude
from these studies that estrogen alters the expression of signaling
peptides believed to mediate skeletal adaptation to changes in
mechanical usage and likewise modifies the skeletal response to
mechanical unloading. | Introduction |
|---|
|
|
|---|
Spaceflight was reported to depress the formation of cancellous bone in long bones (1), and net bone loss was demonstrated in some, but not all, studies (1, 8). Interestingly, no increase in bone resorption was detected (11, 12). Thus, spaceflight results in decreases in bone formation at selected cancellous as well as cortical bone sites, with no apparent change in bone resorption in either bone compartment.
During orbital spaceflight the spacecraft is in free-fall. The resulting near-weightless condition undoubtedly results in decreased mechanical usage of the musculoskeletal system. It is not surprising that spaceflight and functional disuse induced by immobilization, tenotomy, or nerve resection result in similar inhibitions of cortical and cancellous bone formation (1, 4, 7, 9, 13, 14, 15). The skeletal effects of spaceflight on bone volume are also similar to changes resulting from skeletal disuse (13, 14, 15). Spaceflight and disuse may differ, however, regarding their respective effects on bone resorption. Most indexes of bone resorption were unchanged after spaceflight. This finding contrasts to cast immobilization (16) and tenotomy (17), where increased eroded perimeter and osteoclast number were reported.
Estrogen is in part responsible for the normal sexual dimorphism of the female skeleton and is essential for maintaining the balance between osteoblastic and osteoclastic activity during bone remodeling in adults (18). When estrogen is deficient, as in ovariectomized (OVX) rats, there are increases in periosteal bone formation (19). Additionally, an increased frequency of activation of cancellous bone remodeling units occurs (20, 21). Bone resorption becomes greatly increased at endocortical and cancellous bone sites, and bone formation, although frequently increased, is often insufficient to maintain bone volume (20). Thus, the cellular changes that mediate gonadal hormone deficiency-mediated bone loss contrast markedly with those associated with disuse osteopenia.
Ovarian hormones may influence the skeletal response to mechanical usage. Trabeculae are preferentially lost in OVX rats from cancellous bone at sites experiencing low strain energies (22), and disuse results in accelerated bone loss (23). The skeletal actions of estrogen may be mediated by a cascade mechanism by which estrogen acts to regulate immediate response genes, the protein products of which act as transcription factors for skeletal signaling peptide (growth factor) genes (18). In turn, these signaling peptides regulate the expression of large numbers of genes, resulting in changes in bone cell number and activity. Mechanical loading may induce a similar cascade response. One way in which sex steroids may modify the skeletal adaptation to mechanical usage would be to alter the levels of expression of the signaling peptides that mediate skeletal adaptation to changes in mechanical usage.
The purpose of this study was to establish whether the reduction in prevailing strain energies during orbital spaceflight results in cancellous bone loss over and above that resulting from ovariectomy (OVX). Additionally, we were interested in determining whether the increased rates of radial bone growth, cancellous bone turnover, and expression of skeletal signaling peptides associated with OVX continue to occur in the unweighted skeleton. Finally, after having established that spaceflight alters the skeletal response to OVX, we performed a ground-based experiment to determine whether the observed changes in an unweighted limb could be prevented by estrogen replacement.
| Materials and Methods |
|---|
|
|
|---|
Physiology systems exp 4 (PSE 4)
Female rats (Fisher 344, Taconic Farms, Germantown, NY) weighed
140 g and were 10 weeks old when OVX via a standard posterior/dorsal
surgical approach and were 12 weeks old on launch day. Twelve OVX rats
were randomly selected for spaceflight (Flight) and were housed in
animal enclosure modules (AEM). Twenty-four OVX rats were used as
ground controls (12 rats/group). The first group of ground animals was
housed in 2 AEMs, with 6 rats in each of them. The AEM rats were fed
Teklad L356 food bars (Teklad Inc., Madison, WI). The rats housed in
the vivarium (VIV) were fed a standard rat lab chow. The second group
was housed in ground VIVs with two rats in each VIV cage. Six
additional rats were used to obtain baseline measurements, and they
were killed on the day of launch.
All of the OVX rats received one calcein label 24 h before launch day (20 mg/kg, ip) to label mineralizing bone matrix. The flight rats were flown on the space shuttle Columbia (STS-62) for 14 days and killed by decapitation 46 h after recovery. The OVX ground controls were also killed on the day of recovery. The tibiae and femorae were quickly excised. The right tibia was fixed for histomorphometry after isolation of periosteal cells. Periosteal cells for RNA analyses were isolated as described from the right tibiae and right femorae pooled from two rats (24). Trabeculae were isolated from the metaphysis of the proximal left tibia of individual rats as previously described (25). The isolated periosteal cells and cancellous bone were stored at -84 C until isolation of RNA. Additionally, groups of OVX rats (810 rats/group) were killed 8, 10, and 14 weeks postsurgery to extend the time course for evaluating OVX-induced cancellous bone loss to well beyond the 2-week flight interval.
Eighteen sham-operated Fisher 344 rats were used as ovary-intact ground controls. Eight ovary-intact baseline rats were killed at 10 weeks of age, and 10 ovary-intact rats were housed in VIV cages and killed 14 days later. The tissues were treated as described for the OVX rats.
Unilateral sciatic neurotomy (USN)
In a follow-up ground-based experiment, 40 10-week-old Fisher
344 rats were OVX. One group of rats was killed 2 weeks after OVX to
serve as baseline controls. At that time, the remaining rats underwent
USN (15). Half of the animals were implanted sc with controlled release
pellets designed to release a total of 0.1 mg 17ß-estradiol at a
continuous rate over a 3-week interval (Innovative Research of America,
Toledo, OH). The remaining animals received pellets containing the
carrier only. One group of 8 estrogen-treated and 1 group of 8 control
rats were killed 2 weeks after USN, and the remaining estrogen-treated
and control rats were killed 6 weeks after USN. The tibiae were excised
from the unloaded and weight-bearing limbs and were processed for bone
histomorphometry as described for the spaceflight experiment.
Bone histomorphometry
Histomorphometric measurements were performed with the
SMI-Microcomp- P.M. semiautomatic image analysis system (Southern Micro
Instruments, Atlanta, GA), which consists of a computer (Compaq 285,
Compaq Computer Corp., Houston, TX) coupled to a photomicroscope and
image analysis system. In this system, a high resolution color video
camera records the image of the specimen through the microscope
(Olympus BH-2, New Hyde Park, NY) and displays the image on a video
monitor that registers the movement of a digitizing pen on a graphics
tablet. As the pen moves along the graphics tablet, a tracing appears
superimposed on the image of the specimen displayed on the video
screen. The region of interest is traced, and the line lengths and area
bound by the lines are calculated (26).
Cortical bone measurements
Ground transverse sections were used for histomorphometric
analysis of cortical bone. Cross-sections 150 µm thick were cut at a
site just proximal to the tibia-fibula synostosis with a low speed saw
(Isomet, Buehler, Lake Bluff, IL) equipped with a diamond wafer blade.
The sections were ground to a thickness of 1520 µm on a roughened
glass plate and mounted in glycerin before microscopic examination
under visible and UV illumination. The UV light was used to excite the
fluorochrome label. The following measurements were performed: 1)
cross-sectional area, defined as the area of bone and marrow cavity
delineated by the periosteal perimeter of the specimen; 2) medullary
area, defined as the area delineated by the endocortical perimeter of
the specimen; 3) cortical bone area, calculated as the difference
between the cross-sectional area and the medullary area; 4) periosteal
perimeter, defined as the total perimeter enclosing the cross-section
(this includes fluorochrome labeled and unlabeled perimeters); 5)
endocortical perimeter, defined as the total perimeter enclosing the
medullary cavity (including fluorochrome-labeled and unlabeled
perimeters); 6) periosteal bone formation rate, calculated as the area
between the calcein label and periosteal perimeter and divided by the
postlabeling period of 15 days; 7) periosteal mineral apposition rate,
calculated as the periosteal bone formation rate divided by the label
perimeter; 8) periosteal label perimeter, defined as the periosteal
perimeter labeled with calcein; 9) endocortical bone formation rate,
calculated as the area between the calcein label perimeter and
endocortical perimeter and divided by the postlabeling period of 15
days; 10) endocortical mineral apposition rate, defined as the area
calculated as the endocortical bone formation rate divided by the label
perimeter; and 11) endocortical label perimeter, defined as the
endocortical perimeter labeled with calcein (26). The entire cortical
bone specimen was measured. As a result, the cortical data are
expressed in absolute numbers and not normalized to perimeter or area
referents.
Cancellous bone measurements made on stained sections
The metaphysis was dehydrated in a series of increasing
concentrations of ethanol, embedded without demineralization in a
mixture of methylmethacrylate-2-hydroxyethyl-methacrylate (12.5:1) to
retain the fluorochrome labels, and sectioned at a thickness of 5 µm
(model 2065 Microtome, Reichert-Jung, Heidelberg Germany). The sections
were stained with toluidine blue. A standard sampling site was
established in the secondary spongiosa of the metaphysis, 1 mm distal
to the calcein label that was deposited at the metaphyseal growth
plate, its center perpendicular to the long axis of each bone and
extending 2.0 mm distal to the starting point. This modified method
adjusts for longitudinal growth, such that only the portion of the
secondary spongiosa present throughout the experiment is sampled. The
sampling site is situated in the secondary spongiosa and extends
bilaterally in each section, but excludes the cortical edges (26). A
total metaphyseal area of 2.88 mm2 was sampled for each
section.
Bone volume measurements
Cancellous bone area was determined as the area of total
cancellous bone per mm2 metaphyseal tissue within the
sampling site and expressed as a percentage (tissue referent).
Cancellous bone perimeter was expressed as the perimeter of cancellous
bone per mm2 metaphyseal sampling area (tissue referent),
as previously described (26). Calculations relating to cancellous bone
perimeter and area (27) were the following: 1) trabecular thickness,
calculated as the cancellous bone perimeter (millimeter) divided by the
cancellous bone area (square millimeters per mm2), then
dividing that number by 2 and multiplying by 1000 (millimeters); 2)
trabecular number, defined as the cancellous bone area (square
millimeters per mm2) divided by the trabecular thickness in
microns; and 3) trabecular separation, calculated as the trabecular
thickness (millimeters) divided by the cancellous bone area (square
millimeters per mm2).
Bone cell measurements
The cancellous bone perimeters lined by osteoblasts and
osteoclasts were measured and expressed as percents (perimeter
referent) (26). Briefly, undemineralized 5-µm thick sections were
stained with toluidine blue. Osteoclast perimeter was determined as the
cancellous perimeter lined by multinucleated cells. These cells usually
had other characteristics of osteoclasts, including a foamy cytoplasm
and location in a pronounced lacuna. Osteoblasts were identified as a
palisade of large basophilic cuboidal cells directly lining a bone
perimeter.
Bone formation measurements and calculations
The bone formation rate (tissue area referent) was calculated as
the osteoblast perimeter (microns) multiplied by the mineral apposition
rate (microns per day) and divided by the tissue area (square
millimeters per mm2); the bone formation rate (perimeter
referent) was calculated as the osteoblast perimeter (microns)
multiplied by the mineral apposition rate (microns per day) and divided
by the total bone perimeter (microns per mm2). The mineral
apposition rate was the mean distance between the calcein label and the
bone perimeter lined by osteoblasts divided by the postlabel time
interval (15 days). The calcein label perimeter (tissue area referent)
was measured as the length of label (millimeters) per mm2
cancellous tissue area.
Dynamic measurement related to bone resorption
Calcein label perimeter was measured in a growth-adjusted
metaphyseal sampling site, and subsequent resorption was calculated as
previously described (28). Briefly, the cancellous perimeter labeled
with calcein was measured in the baseline OVX and ovary-intact groups.
Similarly, the calcein-labeled perimeter was measured in the postflight
groups, and label resorbed was calculated as (1 - postflight
label/preflight label) x 100 and expressed as a percentage (tissue
referent).
Statistical analysis
We performed a one-way ANOVA on the postflight groups with
Fishers protected least significant difference post-hoc
multiple comparison tests to establish significance. The OVX VIV group
was compared to the OVX ground AEM group to establish the effects of
caging. The OVX AEM group was compared to the OVX Flight group to
establish the effects of near weightlessness. Lastly, the intact was
compared to the VIV OVX group to establish the effects of OVX.
Additionally, the OVX groups were compared to the OVX baseline group,
and ovary-intact groups were compared to the ovary-intact baseline by
unpaired t tests to establish the effects of age. We also
performed a two-factor ANOVA in the USN experiment to establish the
respective effects of weight bearing and estrogen replacement in OVX
rats.
Isolation of RNA
The frozen periosteal cells for Northern analysis were lysed
with guanidine isothiocyanate (29). The frozen cancellous bone was
individually homogenized in guanidine isothiocyanate using a Spex
freezer mill (Edison, NJ). Total cellular RNA was extracted and
isolated using a modified organic solvent method, and the yields were
determined spectrophotometrically at 260 nM.
Northern analysis
Ten micrograms of each sample were denatured by incubation at 52
C in a solution of 1 M glyoxal and 50% dimethylsulfoxide
in 0.1 M NaH2PO4 solution, then
separated electrophoretically in a 1% agarose gel. The amounts of RNA
loaded and transferred were assessed by methylene blue staining of the
gels and hybridization of the filters with a 32P-labeled
complementary DNA (cDNA) for 18S ribosomal RNA.
The RNA was transferred overnight via capillary action in 20
x sodium saline citrate (SSC) buffer to an Amersham Hybond nylon
membrane (Arlington Heights, IL) and cross-linked with a Stratagene UV
Stratalinker 1800 (Stratagene, San Diego, CA) before hybridization. The
filters were prehybridized for 6 h at 45 C in a buffer containing
50% deionized formamide, 10% dextran sulfate, 5 x SSC (1
x SSC = 0.15 M NaCl and 0.015 M sodium
citrate, pH 7.0), 600 µg/ml heat-denatured single strand salmon sperm
DNA, and 2 x Denhardts solution (Denhardts solution: 1%
(wt/vol) Ficoll 400, 1% (wt/vol) polyvinylpyrrolione, 1% (wt/vol)
BSA). Hybridization was carried out for 1824 h in a buffer containing
the above ingredients in addition to a minimum of 106
cpm/ml 32P-labeled cDNA for transforming growth factor-ß
(TGFß), osteocalcin (OC), and prepro-
2(1) subunit of type 1
collagen (collagen).
cDNA probes were labeled by random sequence hexanucleotide primer extension using the Megaprime DNA labeling kit from Amersham. The filters were washed for 30 min at 45 C in 2 x SSC and for 1560 min in 0.1 x SSC at 45 C. The messenger RNA (mRNA) bands on the Northern blots were quantitated by densitometric scanning using a Molecular Dynamics Phosphor Imager (Sunnyvale, CA).
The cDNA probes were 1) rat TGFß, cloned in pBluescript II KS+ vector (this fragment is excisable with HindIII and XbaI and was provided by Dr. M. J. Sporn at the NCI, NIH); 2) rat OC (a gift from Dr. S. Rossi-Langen, Genetics Institute, Cambridge, MA) (30); and 3) rat collagen (obtained from Dr. C. Genovese, University of Connecticut, Farmington, CT) (31).
Ribonuclease (RNase) protection assay for insulin-like growth
factor I (IGF-I) mRNA
The RNase protection procedure was performed using the RPA II
kit (Ambion, Austin, TX) as recommended by the manufacturer. Briefly, a
226-bp fragment of rat IGF-I cDNA was synthesized by reverse
transcriptase-PCR from rat liver RNA using oligonucleotide primers with
the following sequences: CAGAATTCGCCGGACCAGAGACCCTTTG and
CAGGATCCCCCGGATGGAACGAGCTGAC. These primers contain EcoRI
and BamHI sites and 20-bp sequences from exons 3 and 4 of
the rat IGF-I gene, respectively. The resultant cDNA fragment was
cloned into the EcoRI and BamHI sites of the SK
Bluescript vector (Stratagene). A 293-nucleotide antisense RNA probe
was synthesized and labeled with [32P]UTP by in
vitro transcription using 100 ng IGF/SK vector (linearized with
EcoRI) and T3 polymerase. Similarly, a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antisense probe was
synthesized using the provided template (Ambion). The antisense RNA
probes were purified by deoxyribonuclease digestion of the template
followed by G-50 gel filtration. The purified antisense RNA probes
(6 x 104 cpm) were hybridized for 18 h at 43 C
in 20 µl hybridization buffer [80% deionized formamide, 100
mM sodium citrate (pH 6.4), 300 mM sodium
acetate (pH 6.4), and 1 mM EDTA] containing bone RNA (10
µg for IGF-I and 5 µg for GAPDH). The hybridized RNA was digested
with 0.5 U RNase A and 20 U RNase T1 for 30 min at 37 C, then ethanol
precipitated and resuspended in 8 µl gel loading buffer (95%
formamide, 0.025% xylene cyanol, 0.025% bromophenol blue, 0.5
mM EDTA, and 0.025% SDS). The RNase-digested samples were
then fractionated by urea-polyacrylamide [50% urea (wt/vol), 7%
acrylamide (wt/vol), and 1% Tris-borate EDTA: 45 mM
Tris-borate, 1 mM EDTA] gel electrophoresis. The
polyacrylamide gel was vacuum dried and placed on a phosphoimager
screen for 18 h. Quantitation of protected IGF-I RNA fragments was
performed by phosphoimager analyses and normalized to GAPDH RNA
levels.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Spaceflight reduced cancellous bone area in OVX rats compared to OVX ground controls; the cancellous bone area of the flight rats was decreased 50% and 54% compared to those in the AEM and VIV groups, respectively. In marked contrast to the increased resorption of a preflight calcein label in the flight animals, spaceflight had minimal effects on measurements related to bone formation. These observations suggest that the observed spaceflight-induced cancellous bone loss was primarily due to an increase in bone resorption over and above that caused by OVX.
The effects of OVX on weight-bearing rats were consistent with published results (18, 20, 26, 28, 32, 33, 34, 35, 36). The expected increase in radial bone growth due to an increase in the periosteal mineral apposition rate was noted. Also observed were severe cancellous osteopenia (20, 26, 28, 32, 33, 34) and elevated indexes of cancellous bone turnover (20, 28, 33). The measurements related to bone turnover were uniformly increased and consisted of osteoblast and osteoclast perimeters, mRNA levels for bone matrix proteins, mineral apposition rate, and resorption of the preflight fluorochrome label.
OVX resulted in increases in mRNA levels for the putative skeletal signaling peptides TGFß and IGF-I. We are not aware of previous studies evaluating the effects of short term estrogen deficiency on message levels for TGFß in skeletal tissues. Long term ovarian hormone deficiency induced by OVX resulted in decreased TGFß message levels in the tibial metaphysis (36, 37). Additionally, the concentration of TGFß in rat bone is decreased by OVX, and reduction is prevented by 17ß-estradiol (38). These results suggest that the acute changes in TGFß message levels that follow OVX do not reflect the deposition of the peptide into bone matrix. The increase in IGF-I message was anticipated; OVX was reported to increase and estrogen to decrease message levels in long bone periosteum (24) and tibia metaphysis (39). Thus, OVX results in increases in mRNA levels for skeletal signaling peptides that have been reported to be positively regulated by weight bearing (22, 25, 40, 41, 42). This finding is consistent with the hypothesis that OVX leads to alterations in the baseline level of expression of skeletal signaling peptides, which, in turn, leads to changes in the skeletal response to skeletal unloading. It must be emphasized, however, that the observed association is not proof for a cause and effect relationship.
The OVX-induced increase in radial bone growth was reversed by spaceflight. The histological evidence for reduced bone formation in flight animals is supported by the observed decrease in periosteal mRNA levels for collagen. Although not statistically significant, there were also tendencies for decreases in mRNA levels for TGFß and OC. These results in OVX female rats are similar to the inhibitory effects of spaceflight on periosteal bone formation and mRNA levels for bone matrix proteins and TGFß in male rats (4, 7, 43, 44).
Interestingly, the cancellous bone that was lost during the spaceflight represents bone that was unlikely to have been lost in weight-bearing OVX animals because the OVX-induced cancellous osteopenia was fully established in Fisher 344 rats before the spaceflight. There was rapid bone loss in the first 2 weeks after OVX due to a net increase in bone resorption, but afterward, bone volume quickly stabilized, and further bone loss was insignificant. This finding suggests that although bone turnover was higher, there was a rapid reestablishment of a balance between bone formation and bone resorption. In this regard, Fisher 344 rats may differ from Sprague-Dawley rats; the latter strain of rats continues to lose cancellous bone for a longer duration and achieves a lower final bone volume than the former (20, 32).
The administration of a single preflight fluorochrome label precluded using conventional methods to calculate the cancellous bone formation rate. Instead, the bone formation rate was estimated as the product of osteoblast perimeter and the mineral apposition rate. This modified method is justified based on the demonstrated equivalency of osteoblast number and label perimeter in young rats (45). In this study, the dynamic histomorphometry is supported by similar changes in mRNA levels for bone matrix proteins.
The decrease in cancellous bone formation reported in male flight rats
in earlier studies was due to combined reductions in the mineral
apposition rate (-26%) and osteoblast perimeter (-51%) (1, 4). A
small (
10%) reduction in the mineral apposition rate was apparent
in the OVX Flight rats. Spaceflight had no additional effect on
osteoblast number and mRNA levels for collagen and OC in gonadectomized
females, even though these measurements were greatly increased by
OVX.
Studies that evaluated calcium uptake and clearance, bone histomorphometry, and resorption of a preflight fluorochrome label failed to detect changes in bone resorption in male rats during spaceflight (1, 4, 12, 46). The present study in OVX rats clearly demonstrates increased cancellous bone resorption with net bone loss. The failure to detect a parallel change in osteoclast number in this study suggests that spaceflight resulted in an increase in osteoclast activity. Alternatively, osteoclast number may have been transiently increased, as was reported for male rats after tenotomy (21). A transient increase in osteoclast number is consistent with the observed fall in trabecular number.
There is precedent for independent actions of estrogen and weight bearing on bone mass. OVX combined with immobilization resulted in a further decrease in bone mineral density compared to either OVX or immobilization alone (23). On the other hand, Tuukkanen et al. (47) reported that treadmill exercise reduced cancellous bone loss in OVX rats compared to that in sedentary controls. Similarly, the ash weights of femur and tibia and femur strength were increased in OVX endurance-exercised rats compared to those in sedentary controls (47). The results in disuse models are consistent with our spaceflight findings regarding changes in bone mass. Unfortunately, the cellular mechanisms were not investigated in these earlier studies, so comparisons of the respective roles of changes in bone formation and bone resorption are not possible. Recently, unilateral limb casting of OVX rats was reported to result in decreased cancellous bone volume in the unloaded limb due to increased bone resorption and decreased bone formation (16). In the present studies, we show that USN results in further cancellous bone loss in the unloaded limb of OVX rats with established osteopenia, a result consistent with the spaceflight results.
Ovary-intact rats were not flown in space due to weight limitations of the AEMs. We were unable, therefore, to establish the skeletal effects of near weightlessness on female rats with normal gonadal function. We show, however, in the USN study that administration of estrogen prevents the additional bone loss in the underloaded limb of OVX rats.
We intentionally altered systemic levels of gonadal hormones by ovariectomizing rats. Some of the skeletal changes reported in male rats flown in space may be due to spaceflight-induced alterations in the levels of systemic factors, including hormones. Evidence for such changes were obtained after the 12.5-day Cosmos 1887 and 14-day Cosmos 2044 studies when statistically significant and repeatable decrements in GH and PRL release were detected (48). Reduced secretion of GH from pituitary cells (49, 50) as well as reduced testicular function (51) were found after other spaceflights. Alternatively, many studies have shown direct effects of mechanical loading on bone. In mechanically loaded turkey ulna, the area of the ulna as well as the periosteal mineral apposition rate increased over those in nonloaded controls (52). Direct loading of rat hindlimbs partially prevented OVX-induced cancellous bone loss by decreasing bone resorption (16). Cell culture models showed that the osteogenic potential of marrow from unloaded bone, as ascertained by observing reduced nodule formation (53), was diminished compared with that from loaded ones. Thus, the mechanism for spaceflight-induced bone loss may involve both systemic and mechanical factors.
Hindlimb unloading of male rats was reported to induce skeletal resistance to IGF-I and to increase IGF-I mRNA levels in unloaded bones (40, 54). In the present investigation, spaceflight had no effect on IGF-I mRNA levels in long bone metaphysis of OVX rats. Additionally, hindlimb unloading (54) and spaceflight (11) had no effect on GH-induced bone growth.
Changes in systemic factors should influence nonweight-bearing as well as weight-bearing bones. In this regard, spaceflight was reported to not affect bone formation in some nonweight-bearing bones (48), but histological and biochemical abnormalities were reported for the skull (55, 56, 57). Additionally, a decrease in mRNA levels for bone matrix proteins occurred in rat calvariae (43). Simmons et al. (56) reported slight decreases in calcium and magnesium concentrations in calvariae, which may reflect decreased bone formation. The observation that both nonweight-bearing and weight-bearing bones are influenced by spaceflight could be interpreted as indirect evidence that changes in systemic factors mediate some of the effects of mechanical usage. Alternatively, the calvariae are load bearing because of the muscles required to oppose gravity and maintain an upright position of the head. According to this alternative interpretation, by reducing mechanical strain through a reduction in load bearing, spaceflight may cause a decrease in bone formation in nonweight-bearing bones. The juxtaposition of these results does not permit characterization of the role of systemic factors in mediating the skeletal effects of spaceflight. The present study demonstrates, however, that a reduction in gonadal hormones during spaceflight would have skeletal effects that differ qualitatively as well as quantitatively from those observed in weight-bearing animals.
In summary, short term spaceflight results in additional bone loss in OVX rats with established cancellous osteopenia. Spaceflight prevented an OVX-induced increase in radial growth, but did not moderate the elevated cancellous bone turnover in OVX rats. The additional cancellous bone loss was attributed to an additional increase in bone resorption over and above that caused by OVX. This mechanism for cancellous bone loss in OVX females during spaceflight differs from that in male rats with intact gonadal function and indicates that the effects of weight bearing on bone cell populations may depend upon systemic factors, such as gonadal hormones, that influence the expression of skeletal signaling peptides believed to mediate the skeletal effects of weight bearing.
|
|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
Received October 2, 1996.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Zayzafoon, W. E. Gathings, and J. M. McDonald Modeled Microgravity Inhibits Osteogenic Differentiation of Human Mesenchymal Stem Cells and Increases Adipogenesis Endocrinology, May 1, 2004; 145(5): 2421 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Hefferan, G. L. Evans, S. Lotinun, M. Zhang, E. Morey-Holton, and R. T. Turner Effect of gender on bone turnover in adult rats during simulated weightlessness J Appl Physiol, November 1, 2003; 95(5): 1775 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Allen and S. A. Bloomfield Hindlimb unloading has a greater effect on cortical compared with cancellous bone in mature female rats J Appl Physiol, February 1, 2003; 94(2): 642 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Turner Physiology of a Microgravity Environment: Invited Review: What do we know about the effects of spaceflight on bone? J Appl Physiol, August 1, 2000; 89(2): 840 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Morey-Holton, B. P. Halloran, L. P. Garetto, and S. B. Doty Animal housing influences the response of bone to spaceflight in juvenile rats J Appl Physiol, April 1, 2000; 88(4): 1303 - 1309. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Turner, L. S. Kidder, M. Zhang, S. A. Harris, K. C. Westerlind, A. Maran, and T. J. Wronski Estrogen has rapid tissue-specific effects on rat bone J Appl Physiol, June 1, 1999; 86(6): 1950 - 1958. [Abstract] [Full Text] [PDF] |
||||
![]() |
R T Turner Mechanical signaling in the development of postmenopausal osteoporosis Lupus, June 1, 1999; 8(5): 388 - 392. [Abstract] [PDF] |
||||
![]() |
G. CARMELIET and R. BOUILLON The effect of microgravity on morphology and gene expression of osteoblasts in vitro FASEB J, May 1, 1999; 13(9001): 129 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Turner, G. L. Evans, M. Zhang, A. Maran, and J. D. Sibonga Is Resveratrol an Estrogen Agonist in Growing Rats? Endocrinology, January 1, 1999; 140(1): 50 - 54. [Abstract] [Full Text] |
||||
![]() |
R. T. Turner, G. L. Evans, J. M. Cavolina, B. Halloran, and E. Morey-Holton Programmed Administration of Parathyroid Hormone Increases Bone Formation and Reduces Bone Loss in Hindlimb-Unloaded Ovariectomized Rats Endocrinology, October 1, 1998; 139(10): 4086 - 4091. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Wronski, M. Li, Y. Shen, S. C. Miller, B. M. Bowman, P. Kostenuik, and B. P. Halloran Lack of effect of spaceflight on bone mass and bone formation in group-housed rats J Appl Physiol, July 1, 1998; 85(1): 279 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Evans, E. Morey-Holton, and R. T. Turner Spaceflight has compartment- and gene-specific effects on mRNA levels for bone matrix proteins in rat femur J Appl Physiol, June 1, 1998; 84(6): 2132 - 2137. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |