Endocrinology Vol. 138, No. 4 1658-1666
Copyright © 1997 by The Endocrine Society
Folding-Dependent Binding of Thyrotropin (TSH) and TSH Receptor Autoantibodies to the Murine TSH Receptor Ectodomain1
H. Vlase,
N. Matsuoka2,
P. N. Graves,
R. P. Magnusson and
T. F. Davies3
Departments of Medicine and Pharmacology (R.P.M.), Mount Sinai
School of Medicine, New York, New York 10029
Address all correspondence and requests for reprints to: Dr. T. F. Davies, Box 1055, Mount Sinai Medical Center, 1 Gustave L. Levy Place, New York, New York 10029.
 |
Abstract
|
|---|
The mouse TSH receptor ectodomain (mTSHR-ecd) was amplified from murine
thyroid complementary DNA and ligated into the pAcGP67B insect cell
vector, and the nucleotide sequence was confirmed. Employing a
baculovirus-insect cell system, the mTSHR-ecd (amino acids 22415) was
expressed as a fusion protein with the gp67 insect cell signal sequence
at the NH2-terminus and a C-terminal six-histidine tag.
Protein expression was assessed by Western blot using a murine
monoclonal antibody (recognizing amino acids 2235) and a rabbit
antipeptide antibody (recognizing amino acids 397415). These
antibodies detected two principal species of mTSHR-ecd, one
glycosylated (66 kDa) and one nonglycosylated (52 kDa), in cell lysates
of infected insect cells. More than 10% of these species were present
in a water-soluble (cytosolic) fraction. This fraction was then used to
purify, under native conditions, 100-µg amounts of mTSHR-ecd using
nickel-nitrilo-triacetic (Ni-NTA) resin chromatography. The purified
cytosolic mTSHR-ecd migrated as a homogeneous 66-kDa band visible on
Coomassie blue-stained gels and was confirmed by Western blotting. We
also purified the mTSHR-ecd from total cell lysates under denaturing
conditions, followed by "in vitro" refolding on the
Ni-NTA column. Under these conditions, milligram amounts of soluble
mTSHR-ecd were obtained. This material consisted primarily of the
66-kDa glycosylated form, but in addition contained four or five lower
molecular mass, partially glycosylated intermediates and the 52-kDa
nonglycosylated form. Deglycosylation with either endoglycosidase F or
H, reduced all mTSHR-ecd glycosylated species to a 52-kDa
nonglycosylated form. Both the cytosolic and refolded mTSHR-ecd
preparations inhibited the binding of [125I]TSH to the
full-length human TSHR expressed in Chinese hamster ovary cells in a
dose-dependent manner, with similar affinities. The affinity of such
interactions was 3 orders of magnitude less than observed with native
porcine TSHR and was further reduced by unfolding the mTSHR-ecd
preparations. The cytosolic and refolded mTSHR-ecd were also recognized
by hTSHR autoantibodies in the serum of patients with hyperthyroid
Graves disease. Such autoantibody binding to mTSHR-ecd was also
markedly reduced by unfolding the antigen.
These results demonstrated the successful production of large
quantities of well characterized, biologically active, mTSHR-ecd
antigen. In addition, the data showed that although the ectodomain of
the mTSHR bound TSH, intact holoreceptor may be required for high
affinity ligand binding. Whether the transmembrane region is required
for direct ligand binding, as seen for other G protein-linked
receptors, or whether it is needed to stabilize the ligand binding to
the ectodomain and maintain a correctly folded state, remains unclear.
 |
Introduction
|
|---|
TSH INFLUENCES thyroid epithelial cell
function via a prototypical G protein-linked receptor with a large
extracellular domain (TSHR-ecd) (1). The TSHR is the major autoantigen
of Graves disease. This is a uniquely human disease associated with
hyperthyroidism secondary to TSHR stimulation by TSHR autoantibodies
(hTSHR-Abs), which act as TSH agonists (2). Since the early discovery
of TSHR-Abs, the mouse has served as a potent bioassay of human
thyroid-stimulating antibody activity (3), indicating that mouse TSHR
(mTSHR) is immunologically similar to that in the human. However, only
a minority of hTSHR-Abs act as TSH agonists at the mTSHR (4), and
binding/activity studies have shown that many hTSHR-Abs bind to the
mTSHR without activating the receptor (5, 6). The structural mechanism
for this dissociation is unknown. Sequencing of the mTSHR has indicated
a number of potentially important differences from the hTSHR sequence
(7), and this may explain the species specificity of hTSHR-Abs.
In addition to serving as a bioassay for hTSHR-Abs, the mouse exhibits
thyroid antigen-induced experimental autoimmune thyroiditis. This model
has become one of the most common tools for understanding the mechanism
of autoimmune dysfunction (8). In the past, both thyroglobulin and
thyroid peroxidase have been shown to initiate experimental autoimmune
thyroiditis, using either human and/or mouse antigens (9, 10, 11).
Recently, attempts to initiate autoimmune thyroid disease with
hTSHR-ecd antigen have been largely unsuccessful. While one group has
claimed success (12), we and others have failed to initiate
thyroiditis, although marked immune responses to the immunizing antigen
have been obtained (13, 14, 15). Such data again suggested that the mouse
TSHR may be immunologically distinct from the human TSHR.
To address these questions it is necessary to characterize the mTSHR
and evaluate its immunological effects. We have succeeded in producing
large quantities of eukaryotic mouse TSHR ectodomain and have
characterized highly purified preparations for binding of TSH ligand
and TSHR-Abs.
 |
Materials and Methods
|
|---|
Characterization of murine TSHR messenger RNA (mRNA)
Total RNA from human thyroid and mouse tissues was extracted
using Tri-Reagent (Molecular Research Center, Cincinnati, OH). Mouse
thyroid total RNA was obtained from two groups of mice: group A (32
normal CBA/J mice) and group B (20 CBA/J mice; treated with 0.05%
methimazole and a low iodine diet for 4 weeks). Polyadenylated
[poly(A)+] RNA was prepared using a poly(A)+
Tract magnetic bead mRNA isolation system (Promega, Madison, WI). For
Northern blot hybridization, 4.5 µg poly(A)+ RNA were
loaded onto 1% agarose gels, electrophoresed, and transferred onto
supported nitrocellulose membranes. mTSHR mRNAs were detected using a
32P-labeled complementary DNA (cDNA) probe (nucleotides
106549) generated by reverse transcription-PCR (RT-PCR) and labeled
by random hexamer priming (16).
Amplification and sequencing of mTSHR-ecd
The mTSHR-ecd (bp 611245) was amplified by RT-PCR using CBA/J
murine thyroid cDNA as the template, Vent DNA polymerase (New England
Biolabs, Beverly, MA), and the following mTSHR-ecd-specific primers:
forward (5'-GATCGGATCCGGCAAAGAGTGTGCGTCTCC) and reverse
(5'-GATCGGTACC
GAATTCTTATCAGTGATGGTGATGGTGATGTCCACCTCCCCTGTA
GCCCATGATATCTTCAC). These primers included the underlined
BamHI and EcoRI restriction sites. The reverse
primer comprised the mTSHR-ecd-specific complementary sequence,
followed by a 9-bp spacer sequence (double underlined)
coding for three glycine residues, an 18-bp sequence (in
boldface) coding for six histidines (6Hi), and a synthetic
stop codon (in italics). The 6Hi at the C-terminus allowed
further purification of the mTSHR-ecd-6Hi using
nickel-nitrilo-triacetic (Ni-NTA) resin chromatography. After
amplification, the murine thyroid DNA was digested with
BamHI and EcoRI, electrophoresed on 1% agarose
gels, purified from excised gel slices using glassmilk (GeneClean kit,
BIO 101, La Jolla, CA), and ligated into
BamHI/EcoRI-digested eukaryotic pAcGP67B
expression vector (PharMingen, San Diego, CA) to generate the
pAcGP67B-mTSHR-ecd plasmid. After restriction analysis, the mTSHR-ecd
was sequenced using the dideoxynucleotide termination method (Sequenase
kit, U.S. Biochemical Corp., Cleveland, OH).
Expression of mTSHR-ecd in Hi-5 insect cells
mTSHR-ecd cDNA was inserted into the BamHI cloning
site of the pAcGP67B vector downstream to the polyhedrin promoter and
gp67 signal peptide (17). Recombinant pAcGP67B/mTSHR-ecd plasmid was
cotransfected with Baculo-Gold DNA into sf9 insect cells as previously
described (18). The resulting recombinant virus was then used to infect
Hi-5 silkworm cells (19). Expression of mTSHR-ecd protein was assessed
by subjecting unpurified total cell lysates, particulate-insoluble
fractions, and cytosolic (water-soluble) fractions obtained after
sonication to SDS-PAGE followed by Coomassie blue staining (20 µg
total protein/lane) and Western blot analysis (510 µg total
protein/lane), as previously described (20, 21). Blots were developed
using either murine monoclonal antibody (mAb A10, supplied by Dr. J. P.
Banga, University of London), recognizing hTSHR residues 2235 (21),
or rabbit antiserum (R 397) generated against an extreme C-terminus
hTSHR peptide (residues 397415) (22), both at a 1:10,000 dilution.
Bound antibodies were detected using enhanced chemiluminescence (ECL
kit, Amersham, Aylesbury, UK).
Purification of the mTSHR-ecd
Using Ni-NTA-resin chromatography (Quiagen, Chatsworth, CA), the
mTSHR-ecd was purified either from total cell lysates of infected
insect cells (under denaturing conditions followed by on-column
refolding) or from cytosolic fractions (under native conditions). For
purification under denaturing conditions followed by refolding, insect
cells harvested 65 h postinfection were solubilized in 6
M guanidine-HCl followed by centrifugation (12,000 rpm for
30 min at 15 C). For analytical purification, 8.5 mg total supernatant
protein were mixed with 200 µl 50% Ni-NTA resin. For larger scale
purification, 2050 mg total protein lysate were mixed with 0.51 ml
50% Ni-NTA resin. After batch binding for 1 h at room
temperature, the slurry was loaded onto low pressure chromatography
columns (Bio-Rad, Richmond, CA) and allowed to settle, and the resin
was sequentially washed with 10 vol 6 M guanidine-HCl (pH
8.0), 10 vol 8 M urea (pH = 8.0), and 40 vol 8
M urea (pH 6.5). The mTSHR-ecd captured by the Ni-NTA resin
was further subjected to refolding in situ, by applying two
consecutive linear gradients of refolding buffers (5075 ml each),
over 1012 h at 4 C: gradient 1 consisted of buffer A [8
M urea, 10 mM Tris-HCl (pH 7.4), 0.5
M NaCl, 20% glycerol, and 0.1% Triton X-100], and buffer
B was similar to buffer A, but contained 1 M urea. Gradient
2, started with buffer B and ended with buffer C [10 mM
Tris-HCl (pH 7.4), 0.15 M NaCl, 0.1 M potassium
acetate, and 0.1% Triton X-100]. The refolded mTSHR-ecd was then
eluted with 10 bed volumes of 350 mM imidazole in refolding
buffer C. Samples from the input, flow-through, sequential washes, and
eluted mTSHR-ecd fractions were precipitated with trichloroacetic acid,
dissolved in SDS-PAGE sample buffer containing 2% ß-mercaptoethanol
(ßME), and fractionated by SDS-PAGE. Purification was evaluated
initially by Coomassie blue staining (510 µg protein/lane) and
immunoblotting with the murine mAb A10 and R 397 antiserum (14 µg
protein/lane). The purified mTSHR-ecd fractions were pooled; dialyzed
extensively against 10 mM Tris (pH 7.4), 0.05 M
NaCl, and 0.1% Triton X; and concentrated with polyethylene glycol
(Mr, 20,000) to 0.250.5 mg/ml.
For purification of soluble mTSHR-ecd under native conditions, insect
cell pellets were resuspended in sonication buffer [50 mM
sodium phosphate (pH 7.4), 0.3 M NaCl, and protease
inhibitor cocktail (PharMingen, San Diego, CA; catalog no. 21426Z)],
and after two freeze-thaw cycles, the pellet was extracted on ice with
three sonication cycles (1 min each) at 15-min intervals. Subsequently,
the lysate was centrifuged at 50,000 x g for 40 min,
and the soluble (cytosolic) fraction was filtered through a 0.2-µm
filter. Filtrate (610 mg) was mixed with 250500 µl Ni-NTA resin
in a binding buffer containing 0.5 M NaCl, 10
mM ßME, 20% glycerol, and 60 mM imidazole,
followed by batch binding for 2 h at 4 C. After casting the
column, the resin was extensively washed with binding buffer without
ßME. Bound cytosolic mTSHR-ecd was then eluted with 300
mM imidazole. Purity assessment and dialysis of pooled
fractions were performed as described above.
Deglycosylation of purified mTSHR-ecd
Both refolded and cytosolic mTSHR-ecd were subjected to
deglycosylation with endoglycosidase F (Endo F) or endoglycosidase H
(Endo H; Boehringer Mannheim, Indianapolis, IN). mTSHR-ecd samples were
reduced by boiling for 3 min in the presence of 0.2% SDS, 1% ßME
for Endo F and 0.05% SDS-2% ßME for Endo H, and aliquots (5 µg
protein) were diluted into 10 vol Endo F buffer [20 mM
potassium phosphate (pH 7.5), 10 mM EDTA, and 1% Nonidet
P-40]) or Endo H buffer [50 mM sodium phosphate (pH 5.5)
and 0.5% Nonidet P-40]. After enzyme addition the samples were
incubated for 16 h at 37 C. Proteins were precipitated with 10%
trichloroacetic acid, rinsed with acetone, and dissolved in SDS-PAGE
sample buffer containing 2% ßME. The samples were subjected to
SDS-PAGE (1 µg/lane) followed by immunoblotting as described
above.
Binding of TSH to purified mTSHR-ecd
The ability of the mTSHR-ecd to bind TSH was tested indirectly
using a competition assay. In the first step, increasing amounts of
affinity-purified mTSHR-ecd protein (competitor) and
[125I]TSH (8,000 cpm; gift from Kronus, San Clemente, CA)
were combined in 300 µl binding buffer (NaCl-free Hanks Balanced
Salt Solution and 280 mM sucrose) for 1 h at 23 C.
Secondly, this mixture was added to JP-09 Chinese hamster ovary (CHO)
cells stably expressing the wild-type human TSHR (23) (gift from Dr. G.
Vassart, Free University of Brussels, Brussels, Belgium), and
incubation was continued for 1.5 h at 37 C, as previously
described (24). To explore the influence of folding of the mTSHR-ecd on
TSH binding, in separate experiments the refolded mTSHR-ecd was
reduced, unfolded by incubation with 10 mM dithiothreitol
followed by alkylation of the sulfhydryl groups of cysteine with 40
mM iodoacetamide, as described previously (25), and
incubated as described above. After incubation, the cells were washed
three times with ice-cold binding buffer dissolved in 0.5 ml 1
N NaOH, and the bound radioactivity was counted.
Solubilized porcine thyroid membranes enriched for TSHR (gift from
Kronus) served as a positive receptor control and was used at total
protein concentrations of 1.2120 µg (estimated to contain 0.066
ng pTSHR). Wild-type baculovirus-infected insect cell lysate, used at
similar protein concentrations as the mTSHR-ecd, served as the negative
control. Competition by unlabeled bovine TSH (bTSH; Thytropar, Armour,
Kankakee, IL), used at 10-6-10-12
M, validated the assay. To confirm binding of ligand to the
recombinant receptor and not binding of receptor to CHO cells, the
refolded mTSHR-ecd was first preincubated with the JP-09 cells, and
[125I]TSH was added after washing the cells. Throughout,
bovine TSH was assumed to have a specific activity of 30 IU/mg.
Binding of hTSHR-Ab to recombinant mTSHR-ecd
Enzyme-linked immunosorbent assays were performed as previously
described (15). Briefly, 96-well microtitration plates (Immulon 2,
Dynatech Laboratories, Chantilly, VA) were coated with 100 µl/well
purified refolded mTSHR-ecd (1 µg/ml) or partially purified insect
cell-expressed human TSHR-ecd (18), refolded by gradual dilution of
denaturing agents and dialysis as described previously (26), and used
at 10 µg/ml. Negative controls were wild-type baculovirus-infected
insect cell lysate and BSA (used at 110 µg/ml). Samples were
diluted in carbonate bicarbonate buffer (pH 9.6). After coating
overnight at 4 C, wells were washed, blocked, and incubated with an
internationally validated hTSHR-Ab-containing serum [MRC long acting
thyroid stimulator activity (LATS) Research Standard B, National
Institute for Biological Standards and Control, London, UK]
reconstituted to yield an activity of 7.5 mU/ml, corresponding to a
1:50 serum dilution. Sera from 14 additional patients with hyperthyroid
Graves disease, containing high levels of hTSHR-Ab as defined by
porcine RRA (27), and 6 normal sera (all at 1:50 dilutions) were also
tested individually for binding to the purified refolded mTSHR-ecd and
control antigens. In a separate experiment, the hTSHR-Ab positive LATS
standard serum was also reacted in 2-fold serial dilutions, against
refolded and unfolded mTSHR-ecd. Three well characterized murine
monoclonal antibodies to the hTSHR-ecd (mAb A10, recognizing amino
acids 2235; mAb A9 recognizing amino acids 147229; and mAb A7,
recognizing amino acids 402415) (21) were used as positive controls
at a 1:50,000 dilution. Detection was accomplished using alkaline
phosphatase-labeled antihuman IgG (A-5403, Sigma Chemical Co., St.
Louis, MO) and antimouse IgG (A-0532, Sigma Life Sciences), and
absorption was measured after 1 h at 405 nm.
 |
Results
|
|---|
Characterization of murine thyroidal mRNA
As shown in Fig. 1A
, the mTSHR-ecd cDNA probe
hybridized to four mTSHR mRNAs with estimated lengths of 4.3, 3.5, 2.9,
and 1 kilobases (kb; lane 2) present in the thyroid mRNA of euthyroid
CBA/J mice (group A). In this experiment, the 2.9-kb transcript was the
most abundant. The mouse cDNA probe also hybridized to three hTSHR
mRNAs in a human thyroid sample (lane 1); these migrated at 4.3, 1.7,
and 1.3 kb and were previously characterized by our laboratory (28). In
this sample, the 4.3-kb transcript was the most abundant. A second
Northern blot of murine thyroid mRNA, extracted from CBA/J mice treated
with methimazole and a low iodine diet to induce TSH stimulation (group
B), demonstrated a similar set of four mTSHR transcripts, also with the
2.9-kb transcript the most abundant (Fig. 1B
, lane 1). No mTSHR-ecd
transcripts were detected in mRNAs extracted from mouse brain, muscle,
or liver (Fig. 1B
, lanes 24).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 1. Northern blot of the murine TSHR. A, Northern blot
after 1% agarose electrophoresis of 4.5 µg poly(A)+ RNA.
Lane 1, Human control thyroid mRNA showing three transcripts, 4.3, 1.7,
and 1.3 kb. Lane 2, Murine thyroid mRNA (from CBA/J mice; group A)
showing four transcripts, 4.3, 3.5, 2.9, and 1 kb. B, A Northern blot
analysis similar to that in A after 1% agarose electrophoresis of 4.5
µg poly(A)+ RNA. Lane 1, Murine thyroid mRNA from a
separate experiment (CBA/J mice; group B) showed the same mRNA
transcripts, 4.3, 3.5, 2.9, and 1 kb. Lanes 24, No transcripts were
detected in mouse brain, muscle or liver mRNAs.
|
|
Amplification and sequencing of mTSHR-ecd
The RT-PCR product of CBA/J mTSHR-ecd cDNA yielded a unique,
appropriately sized, 1200-bp band in 1% agarose gels, detected by
ethidium bromide staining. After purification, the DNA was ligated into
the pAcGP67 B vector, and the product was used to transform
Escherichia coli. Plasmid insert from three clones were
sequenced. The translated sequence differed by only six amino acids
from the published mTSHR sequence (7). The differences (Table 1
) had a high substitution probability among proteins of
common ancestry, as evaluated using a matrix of relative substitution
frequencies (29). This frequency of substitution could have been due to
simple polymorphisms and/or mouse strain (BALB/c vs. CBA/J)
differences. Compared to the sequence of the hTSHR-ecd, 62 amino acid
differences were noted (Table 1
).
Insect cell expression of mTSHR-ecd protein
As detected with mAb A10 (Fig. 2A
) and R 397 (Fig. 2B
), infection of Hi-5 insect cells with recombinant baculoviruses
containing mTSHR-ecd cDNA induced high level expression of two major
mTSHR-ecd proteins with apparent molecular masses of 66 kDa
(glycosylated) and 52 kDa (corresponding to the predicted molecular
size of unglycosylated mTSHR-ecd). Both species were detected in the
total cell lysate (Fig. 2
, A and B, lane 1), the particulate-insoluble
fraction (Fig. 2
, A and B, lane 2), and the cytosolic (water-soluble)
fraction (Fig. 2
, A and B, lane 3). As evaluated by Coomassie blue
staining, these proteins were enriched in the insoluble fraction (not
shown). Very small amounts were detectable by Western blot in the
culture medium despite the presence of the baculovirus gp67 signal
peptide on the nascent mTSHR-ecd proteins (not shown). Nevertheless,
significant amounts (>10%) of the mTSHR-ecd species were present in
the cytosolic fraction. This enabled us to purify natively folded
mTSHR-ecd present in this fraction and compare it with mTSHR-ecd
purified from total cell lysates, followed by in vitro
refolding. Neither of the detected species was present in similar cell
fractions obtained from wild-type baculovirus-infected insect cells
(not shown).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2. Recognition of the mTSHR-ecd by induced hTSHR-Ab.
A, Western blot after reducing SDS-PAGE of 10 µg protein/lane,
showing recognition of two main mTSHR-ecd species (66 kDa glycosylated
and 52 kDa nonglycosylated) in the total cell lysate (lane 1),
insoluble fraction (lane 2), and cytosolic fraction (lane 3) of
infected insect cells, using the N-terminal mAb A10 (1:10,000
dilution). B, Shows a Western blot and fractions similar to those in A.
Total cell lysate (lane 1), insoluble fraction (lane 2), and cytosolic
fraction (lane 3), developed with the C-terminal R 397 antibody
(1:10,000 dilution).
|
|
Purification of eukaryotic mTSHR-ecd
Purification of mTSHR-ecd under denaturing conditions followed by
refolding. As shown by Coomassie blue staining and Western
blotting (Fig. 3
, A and C), the mTSHR-ecd was purified
to homogeneity after Ni-NTA column elution, being most enriched in
eluted fractions 3 and 4 (lanes 5 and 6). The purified mTSHR-ecd again
comprised two major species, migrating at 66 and 52 kDa, and lower
amounts of partially glycosylated forms, migrating between 5266 kDa
(Fig. 3B
). Each of the mTSHR-ecd species identified on Coomassie blue
staining was recognized by mAb A10 in Western blots. The facts that mAb
A10 is recognizing an epitope at the extreme NH2-terminus (amino acids
2235), and the C-terminus was immobilized by the Ni-NTA resin before
elution confirm the identity and integrity of all mTSHR-ecd species
purified. The total cell lysate (starting material), flow-through, and
last high stringency wash are shown in lanes 13 of Fig. 3
, A and
C.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3. Purification of the mTSHR-ecd under denaturing
conditions followed by on-column refolding. A, Coomassie blue stain
after SDS-PAGE (10 µg protein/lane). The input, represented by total
unpurified cell lysate of infected insect cells after solubilization in
6 M guanidine-HCl (lane 1), the flow-through (lane 2), and
the last high stringency wash (lane 3) are shown. Lanes 47 show the
purified mTSHR-ecd after refolding and dialysis, present in eluted
fractions 25. Note the highly enriched, purified mTSHR-ecd species,
eluted in fractions 3 and 4 (lanes 5 and 6). B, Detailed composition of
the purified mTSHR-ecd (fraction 4, shown in A; lane 6). Note the
66-kDa main glycosylated species, followed by four or five lower
molecular mass, intermediate glycosylated species and the 52-kDa
nonglycosylated form. C, Western blot developed with mAb A10 (1:10,000
dilution), after SDS-PAGE of 3 µg/lane, of the same fractions as
those presented in A. Lane M contains prestained molecular size
markers.
|
|
Using this approach, milligram amounts of refolded soluble mTSHR-ecd
could be purified. The eluted fractions represented 13% of the total
protein input.
Purification of the cytosolic mTSHR-ecd. A similar analysis of
soluble mTSHR-ecd, purified using native conditions, is shown in Fig. 4
. As shown by Coomassie blue staining (Fig. 4A
), the
purified cytosolic mTSHR-ecd migrated as a unique broad band around 66
kDa and was enriched in the eluted fractions 3 and 4 (lanes 2 and 3). A
control represented by an enriched unpurified insoluble fraction from
insect cells expressing the mTSHR-ecd is shown in lane 4. This fraction
contained the 66-kDa mTSHR-ecd as a major protein and also lower mol wt
contaminant proteins, absent in lanes 2 and 3 containing the purified
mTSHR-ecd. Immunoblotting with mAb A10 confirmed the Coomassie blue
data by identifying the purified mTSHR-ecd fractions (lanes 47). The
unpurified cytosolic fraction (input), flow-through, and last wash are
shown in lanes 13. Under native conditions, the 66-kDa major
glycoform was predominant in the purified fractions of cytosolic
mTSHR-ecd compared with the purification under denaturing/refolding
conditions, where a spectrum of lower mol wt glycosylated
intermediates and the 52-kDa nonglycosylated form were also purified
(Fig. 4B
, lane 8). Using this method, 100-µg amounts of cytosolic
mTSHR-ecd could be purified, representing 0.20.5% of the total
protein input.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4. Purification of the cytosolic mTSHR-ecd under
native conditions. A, Coomassie blue stain of purified cytosolic
mTSHR-ecd fractions. Eluted fractions were mixed with 2 x
SDS-PAGE buffer with 2% ßME and subjected to SDS-PAGE under
denaturing conditions. Lane 1, Molecular mass markers. Lanes 2 and 3,
Eluted fractions 3 and 4 ( 2 µg/lane). Lane 4, A control
represented by a unpurified enriched insoluble fraction from
mTSHR-ecd-infected insect cells (10 µg protein/lane). B, Western blot
after reducing SDS-PAGE (1 µg/lane), developed using mAb A10
(1:10,000 dilution). Lane 1, The unpurified cytosolic fraction of
infected insect cells (input). Lane 2, The column flow-through. The
last wash is shown in lane 3. Lanes 47 illustrate the purified
cytosolic mTSHR-ecd present in eluted fractions 25, confirming the
Coomassie blue stain data. Lane 8, A sample of the purified refolded
mTSHR-ecd, shown for comparison.
|
|
Deglycosylation of purified mTSHR-ecd
When refolded mTSHR-ecd was deglycosylated, using Endo F, which
cleaves high mannose and complex carbohydrate side-chains, the 66-kDa
species was converted to 52 kDa, confirming the glycosylated state of
the 66-kDa form (Fig. 5A
, lanes 1 and 2). The smaller
amounts of partially glycosylated intermediates (not as evident here)
were also reduced. Similar results were obtained after digestion with
Endo H, which is known to cleave only high mannose sugars (Fig. 5A
, lanes 3 and 4). Figure 5B
shows that these enzymes had the same effect
on the 66-kDa glycosylated species purified from the cytosol using
native conditions. These deglycosylation patterns demonstrate that no
significant differences could be found in the glycosylation status of
the two mTSHR-ecd preparations, and that most of the carbohydrate
side-chains were of the high mannose type. This finding is not
unexpected, as it is known that insect cells are able to add high
mannose oligosaccharides to N-acetylglucosamine residues
linked to asparagine and to partially trim these structures to shorter
oligosaccharides, but are generally not able to add complex sugars such
as galactose and sialic acid to the trimmed sugar backbone (19).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 5. Glycosylation status of highly purified mTSHR-ecd.
A, Deglycosylation of the refolded mTSHR-ecd. The receptor preparations
not subjected to deglycosylation with Endo F or Endo H contain both
66-kDa glycosylated and 52-kDa nonglycosylated main species (lanes 1
and 3). Deglycosylation with Endo F or Endo H reduced the 66-kDa
species to a 52-kDa nonglycosylated form (lanes 2 and 4). Western blot
after reducing SDS-PAGE of 1 µg protein/lane, developed with mAb A10
(1:10,000 dilution). B, Deglycosylation of the cytosolic mTSHR-ecd. The
cytosolic receptors not subjected to deglycosylation with Endo F or
Endo H contain the 66-kDa glycosylated form (lanes 1 and 3). Treatment
with Endo F or Endo H reduced this glycoprotein to a 52-kDa
nonglycosylated species (lanes 2 and 4). The blot was developed with
mAb A10 (1:10,000 dilution).
|
|
Binding of TSH to purified mTSHR-ecd
JP-09 CHO cells stably expressing functional hTSHR bound
23003500 cpm (3542%) of the total [125I]TSH.
Unlabeled bTSH inhibited this binding in a dose-dependent manner, with
50% inhibition achieved with concentrations of 68 x
10-9 M (
103 mIU/L; Fig. 6B
, inset). Solubilized porcine TSHR, known
to bind TSH with high affinity (28), also inhibited the binding of
[125I]TSH to the hTSHR expressed in CHO cells in a
dose-dependent manner (Fig. 6A
), confirming the validity of the assay.
Based on quantitative data derived from Western blot analyses, nanogram
amounts of the porcine TSHR were effective at inhibiting
[125I]TSH binding, achieving 50% inhibition at a
concentration of
5 x 10-11 M. Both
the purified cytosolic and refolded mTSHR-ecd similarly inhibited
labeled TSH binding in a dose-dependent manner. The inhibition induced
by the two preparations had almost identical affinities, confirming the
functional activity of both preparations (Fig. 6A
). Although
concentrations of 2 x 10-7 M for the
cytosolic and 3.3 x 10-7 M for the
refolded receptor produced almost complete inhibition, 50% inhibition
was achieved by concentrations of 45 x 10-8
M (Fig. 6A
). Compared to the inhibitory effect of unlabeled
bTSH, the affinity of the purified mTSHR-ecd was lower by about 1 log.
The wild-type baculovirus-infected insect cell protein lysate
(subjected to similar mock procedures as the purified mTSHR-ecd) did
not compete for [125I]TSH binding to the hTSHR-CHO cells
(Fig. 6A
). When the refolded mTSHR-ecd was preincubated with the
hTSHR-CHO cells and then removed before the addition of
[125I]TSH, no binding inhibition was achieved, confirming
the direct binding of the recombinant mTSHR-ecd preparations to
[125I]TSH. In contrast to results with the cytosolic and
refolded mTSHR-ecd species, denatured and unfolded mTSHR-ecd failed to
compete for the binding of [125I]TSH at similar protein
concentrations (Fig. 6A
). The unfolded mTSHR-ecd preparation was intact
and migrated at the correct molecular mass, as evaluated by
immunoblotting with mAb A10 and mAb A7 (not shown). These data
demonstrated the critical importance of the folding state of the
mTSHR-ecd for TSH binding.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6. Binding of TSH to the mTSHR-ecd. Increasing
amounts of affinity-purified cytosolic or refolded mTSHR-ecd (0.016.6
µg; molar range, 10-9 to 3.3 x 10-7
M) were diluted in 50 µl binding buffer, preincubated
with 65008000 cpm [125I]TSH, and added to the wt-hTSHR
expressed in CHO cells as described in Materials and
Methods. Nonspecific binding was calculated in the presence of
10-6 M bTSH (37% of the bound
[125I]TSH) and subtracted from the bound counts to yield
specific [125I]TSH binding (expressed as a percentage of
the maximum). A, Both cytosolic and refolded mTSHR-ecd inhibited
[125I]TSH binding to the hTSHR expressed in CHO cells
with apparently similar affinities. Unfolding of the mTSHR-ecd
abolished ligand binding. Preincubation of the JP09 cells with the
refolded mTSHR-ecd did not influence [125I]TSH binding,
confirming direct binding of TSH to the ectodomain. Wild-type
baculovirus-infected insect cell control lysate was also inactive. The
native porcine TSHR inhibited the [125I] TSH binding with
a significantly higher affinity. The results are representative of
three separate experiments with three different batches of purified
cytosolic and refolded mTSHR-ecd. B, This inset shows
the binding inhibition curve of bTSH with the transfected JPO9 CHO
cells (mean values of two separate experiments).
|
|
Binding of hTSHR-Ab to purified mTSHR-ecd
The direct binding of different hTSHR-Abs to soluble refolded
mTSHR-ecd was assessed using enzyme-linked immunosorbent assays. This
recombinant receptor was highly immunoreactive with murine monoclonal
antibodies, recognizing three different TSHR epitopes: mAb A9 (amino
acids 147229; Figs. 7A
and 8
), mAb A7
(amino acids 402415; not shown), and mAb A10 (amino acids 2235;
Fig. 7B
). The functional relevance of the refolded mTSHR-ecd
immunoreactivity was further demonstrated by the marked degree of
binding of a standard Graves TSHR-Ab-positive serum (expressed in MRC
LATS Standard B units) and tested in 1:50 and 1:100 serum equivalent
dilutions (Fig. 7A
). This standard serum also recognized an hTSHR-ecd
preparation, but did not react with wild-type baculovirus-infected
insect cell control protein lysate or BSA (Fig. 7A
). The recognition of
recombinant mTSHR-ecd by hTSHR-Ab was confirmed by the examination of
14 additional serum samples from patients with hyperthyroid Graves
disease with high titers of hTSHR-Ab (as determined by competition with
labeled TSH for binding to porcine TSHR). The purified refolded
mTSHR-ecd interacted with 4 of the 14 Graves sera (28%), but did not
react with any of 6 normal control sera negative for hTSHR-Ab (Fig. 8
).
None of the Graves or normal sera reacted with control antigens (Fig. 8
).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Binding of hTSHR-Ab to refolded mTSHR-ecd. A,
Recognition of refolded mTSHR-ecd by the MRC standard Graves TSHR Ab.
mAb A9 recognized both murine and human TSHR-ecd. Similarly, the MRC
standard Graves TSHR-Ab had a high reactivity for both murine and
human TSHR-ecd, but did not react with wild-type baculovirus-infected
insect cell lysate (control) or BSA. B, Binding of mAb A10 to the
mTSHR-ecd is folding independent. The mAb A10 recognized both refolded
and unfolded mTSHR-ecd preparations with similar reactivities. C,
Binding of hTSHR-Ab to the mTSHR-ecd is folding dependent. Two-fold
dilutions of the MRC Graves standard serum were reacted with refolded
and unfolded mTSHR-ecd, and the results are expressed as a percentage
of mAb A10 recognition. As opposed to mAb A10, the MRC Graves
standard serum clearly preferred the folded, rather than the unfolded,
state of the mTSHR-ecd.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Figure 8. Binding of Graves sera to the purified
mTSHR-ecd. As a positive control, mAb A9 (1:50,000 dilution) recognized
the mTSHR-ecd. Although none of the 6 normal sera (1:50 dilution) bound
to the mTSHR-ecd, 4 of the 14 Graves sera tested were highly
reactive. Note the MRC standard serum (no. 8) and Graves sera 16, 17,
19, and 20. None of the normal or Graves sera reacted with control
antigens (BSA).
|
|
Influence of folding on TSHR-Ab recognition of mTSHR-ecd
To evaluate the influence of folding on the recognition of
mTSHR-ecd by hTSHR-Ab, serial dilutions of the standard Graves serum
and mAb A10 were reacted with folded and reduced (unfolded) mTSHR-ecd.
The folding state of the mTSHR-ecd had little influence on the binding
of mAb A10, as expected from its highly restricted epitope located in a
region probably not affected by folding (Fig. 7B
). In contrast,
reduction of the folded ectodomain markedly diminished, but did not
abolish, the binding of standard Graves TSHR-Ab (Fig. 7C
).
Approximately 75% of the activity was lost when expressed in relation
to mAb A10 binding, indicating that the folding state of the mTSHR-ecd
was an important determinant of the degree of hTSHR-Ab binding.
 |
Discussion
|
|---|
The TSHR is the primary antigen of the human autoimmune thyroid
disease known as Graves disease (30). This disorder is a uniquely
human abnormality associated with T cells and autoantibodies to the
TSHR. In particular, the TSHR-Ab may act as TSH agonists and induce the
thyroid overactivity characteristic of the disease (2). Alternatively,
some TSHR-Ab may act as TSH antagonists and reduce thyroid function
(31). There are currently no animal models of Graves disease. We
believe, therefore, that the characterization of the mouse thyroidal
TSHR antigen may be important because the mouse is the most appropriate
animal for the development of a Graves disease model considering the
profusion of immunological reagents available for such murine studies.
In support of this concept is the use of the mouse as a bioassay for
hTSHR-Ab, which are known to cross-react with the mTSHR (3). However,
only 15% of human stimulatory TSHR-Ab bind and stimulate the mouse
receptor; the remaining autoantibodies bind and act as neutral
autoantibodies or are TSH antagonists (4). Hence, significant
structural/immunological differences must be present between the mouse
and human TSHRs. This was supported by the sequence data. Although
there were only six primarily conservative amino acid substitutions in
our mTSHR-ecd sequence compared with that published for the BALB/c
mouse (7), most likely due to mouse strain differences, comparison of
the mTSHR-ecd sequence with the human sequence gave different
information. Although there was an overall 85% similarity, it was
apparent that a number of significant differences were present,
particularly in the N- and C-terminal regions. These structural
differences between hTSHR-ecd and mTSHR-ecd, which lead to different
computed indexes of average hydrophilicity profiles (15), are likely to
form the basis of the dissimilarities in structure-function
relationships shown by hTSHR-Abs and require more detailed
evaluation.
Using a baculovirus-insect cell system, we synthesized and purified the
murine TSHR-ecd and characterized the product as a test antigen.
Compared to our previous data (18) and those of other workers (32, 33),
we obtained a much higher degree of purity as well as quantity of
soluble recombinant TSHR-ecd. Affinity-purified antigen was present as
two major species [glycosylated (66 kDa) and unglycosylated (52 kDa)]
as well as minor, partially glycosylated forms. The purified mTSHR-ecd
inhibited binding of radiolabeled TSH to CHO cells expressing
functional hTSHRs and provided indirect evidence of TSH binding to the
recombinant product. The fact that the refolded mTSHR-ecd inhibited
[125I]TSH binding with a similar affinity as the natively
folded (cytosolic) mTSHR-ecd confirmed the correct refolding of this
preparation. However, the level of inhibition was less than that
attained using solubilized porcine TSHR. This lower reactivity could be
partly explained by the lower affinity of TSH for the mTSHR (our
unpublished observations). Indeed, native mTSHR has been shown to
exhibit 1 order of magnitude lower affinity for TSH compared to the
hTSHR (5).
There are at least two alternative explanations for the lower affinity
of the mTSHR-ecd for TSH; the absence of the transmembrane region and
differences in the glycosylation status of the recombinant product.
Although it is generally agreed that the large ectodomain of
glycoprotein receptors is primarily involved in ligand binding, and the
transmembrane domain is involved in signal transduction, the issue of
whether these domains must interact for high affinity binding remains
open. Recent studies have shown that the hyt/hyt mutation in
the mTSHR (Pro556 Leu in the fourth transmembrane region),
abolished TSH binding and receptor function (34). Similarly, mutation
of Asp383 to Asn in the second transmembrane region of the
LH receptor (35), significantly lowered the affinity of lutropin ligand
for its receptor. These studies suggest that the transmembrane region
may be important for direct high affinity ligand binding or may
indirectly stabilize the ligand-ectodomain binding complex. However,
studies comparing binding of TSH by the
-subunit of the hTSHR
(lacking the transmembrane region) and solubilized full-length hTSHR of
transfected cells (36) could not find significant ligand binding
affinity differences, although these binding affinities were
inexplicably low (10-5 M). Similarly, studies
comparing binding of LH to insect cell-expressed full-length and
truncated LH receptors (37) could not detect significant differences,
although both were 1 order of magnitude less than the natural ovarian
LH receptor. Further studies are clearly necessary to clarify the role
of the transmembrane region in ligand binding. As far as the
glycosylation status of the mTSHR-ecd was concerned, most of the insect
cell-expressed murine ectodomain was glycosylated in a high mannose
state. It has previously been demonstrated that TSH was able to bind,
albeit with a lower affinity, to insect cell-expressed,
nonglycosylated, refolded hTSHR-ecd (26). In contrast, Zhang et
al. (37) have shown that tunicamycin-treated insect cells
expressing a carbohydrate-free LH receptor lacked ligand-binding
activity, as opposed to insect cell LH receptor glycosylated in a high
mannose state. Hence, the LH and TSH receptors may differ in their
requirements for ligand binding. Our data showed that the high mannose
glycosylation of the mTSHR-ecd did not hinder TSH binding. Indeed,
differential enzymatic cleavage of insect cell-expressed LH receptor
has shown that only the proximal N-acetylglucosamine
residue, common to both high mannose and complex carbohydrate
side-chains, is necessary for acquisition of a correctly folded
receptor that binds LH with high affinity (37). Therefore, the folding
status seems to be more important than glycosylation in ligand
binding.
We thought that for physiological characterization, a soluble,
correctly folded recombinant mTSHR-ecd product was necessary. Obtaining
a soluble form of recombinant TSHR-ecd has been problematic. Harsh
preparative techniques were originally used to render prokaryotic
products soluble (20), although new procedures for hydrophilic products
have been recently described (38). With eukaryotic insect cell systems,
however, either no soluble product was found or only very small
quantities of soluble receptor were identified after extensive
purification (32). In the present studies, 100-µg amounts of soluble
cytosolic mTSHR-ecd were obtained, enough to allow a quantitative,
direct comparison to the initially insoluble forms that were rendered
soluble by in vitro refolding. Both the molecular sizes and
degrees of glycosylation appeared identical, and both products competed
with radiolabeled TSH with equal avidity. The unfolding of the
mTSHR-ecd resulted in marked diminution of TSH binding to the
recombinant product. Hence, the final folding status of the product was
more important than the initial solubility status. The purified
mTSHR-ecd also bound some, but not all (30%), of the human TSHR
autoantibodies present in the sera of selected patients with
hyperthyroid Graves disease. In contrast with the monoclonal
antibodies, human autoantibodies from patients with Graves disease
had a higher affinity for the folded state, indicating the presence of
antibodies to important conformationally dependent epitopes. Similar
results were obtained from structure-activity studies of thyroid
peroxidase autoantigen and thyroid peroxidase antibodies (25).
Unfolding the mTSHR-ecd did not totally abolish autoantibody
recognition, as 25% of the binding remained. Hence, linear epitopes
are also viable interaction sites for human TSHR-Abs, in agreement with
their significant, but low, affinity recognition of prokaryotic antigen
(18, 20).
In conclusion, we have succeeded in generating large quantities
of biologically active mTSHR-ecd. However, compared to the natural
TSHR, the binding of TSH was of lower affinity and was recognized by
only 30% of hTSHR-Abs from patients with Graves disease. The fact
that only a minority of TSHR autoantibodies bound both natural TSHR and
recombinant mTSHR-ecd suggested that structural differences existed
between them. Such differences may have been secondary to the lack of
the transmembrane region in the recombinant product, variation in the
glycosylation status, or differences in the protein structures of the
ectodomains. These structural dissimilarities are likely to generate
fine changes in nonlinear epitopes, which may only be mapped knowing
the crystallographic structure of the molecule.
 |
Acknowledgments
|
|---|
We thank Dr. Paul Banga (University of London) for supplying the
monoclonal antibodies used in this study.
 |
Footnotes
|
|---|
1 This work was supported in part by grants from the NIDDK
(DK-35764 and DK-45011), the Irvington Institute for Immunological
Research, the David Owen Segal Endowment, and Knoll Pharmaceuticals. 
2 Present address: University of Nagasaki, Nagasaki, Japan. 
3 Theodore and Florence Baumritter professor. 
Received October 21, 1996.
 |
References
|
|---|
-
Nagayama Y, Rapoport B 1992 The thyrotropin
receptor 25 years after its discovery: new insight after its molecular
cloning. Mol Endocrinol 6:145156[Abstract]
-
Rees Smith B, McLachlan SM, Furmaniak J 1988 Autoantibodies to the thyrotropin receptor. Endocr Rev 9:106121[Abstract]
-
McKenzie JM 1958 Delayed thyroid response to serum
from thyrotoxic patients. Endocrinology 62:865868
-
Hardisty CA, Hanford L, Humphries H, Munro DS 1981 Long-acting thyroid stimulator (LATS) and LATS-Protector in untreated
thyrotoxicosis. Clin Endocrinol (Oxf) 14:631639[Medline]
-
Shishiba Y, Ozawa Y, Ohtsuki N, Shimizu T 1982 Discrepancy between thyroid-stimulating and thyrotropin-binding
inhibitory activities of Graves immunoglobulin
Gs assessed in the mouse. J Clin Endocrinol
Metab 54:858862[Abstract]
-
Davies TF 1981 Autoantibodies to the human
thyrotropin receptor are not species specific. J Clin Endocrinol
Metab 52:426430[Abstract]
-
Stein SA, Oates EL, Hall CR, Grumbles RM, Fernandez LM,
Taylor NA, Puett D, Jin S 1994 Identification of a point mutation
in the thyrotopin receptor of the hyt/hyt hypothyroid mouse. Mol
Endocrinol 8:129138[Abstract]
-
Matsuoka N, Unger P, Ben-Nun A, Graves P, Davies
TF 1994 Thyroglobulin-induced murine thyroiditis assessed by
intrathyroidal T cell receptor sequencing. J Immunol 152:25622568[Abstract]
-
Davies TF, Weiss I, Gerber MA 1984 Influence
of methimazole on murine thyroiditis. Evidence for immunosuppression in
vivo. J Clin Invest 73:397404
-
Kotani T, Umeki K, Hirai K, Ohtaki S 1990 Experimental murine thyroiditis induced by porcine thyroid peroxidase
and its transfer by the antigen-specific T cell line. Clin Exp Immunol 80:1118[Medline]
-
Kong YM, Bagnasco M, Canonica GW 1986 How do T
cells mediate autoimmune thyroiditis? Immunol Today 7:337339[CrossRef]
-
Costagliola S, Many MC, Stalmans-Falys M, Vassart G,
Ludgate M 1995 The autoimmune response induced by immunizing
female mice with recombinant human TSH receptor varies with the genetic
background. Mol Cell Endocrinol 115:199206[CrossRef][Medline]
-
Carayanniotis G, Huang GC, Nicholson LB, Scott T, Allain
P, McGregor AM, Banga JP 1995 Unaltered thyroid function in mice
responding to a highly immunogenic thyrotropin receptor: implications
for the establishment of a mouse model for Graves disease. Clin Exp
Immunol 99:294302[Medline]
-
Wagle NM, Dallas JS, Seetharamaiah GS, Fan JL, Desai RK,
Memar O, Rajamaran S, Prabhakar BS 1994 Induction of
hyperthyroxinemia in BALB/c but not in other several other strains of
mice. Autoimmunity 18:103112[Medline]
-
Vlase H, Nakashima M, Graves PN, Tomer Y, Morris J,
Davies TF 1995 Defining the major antibody epitopes on the human
TSH receptor in immunized mice. Endocrinology 136:44154423[Abstract]
-
Feinberg AP, Vogelstein B 1984 Radiolabelling DNA
restriction endonuclease fragments to high specific activity. Anal
Biochem 137:266267[CrossRef][Medline]
-
Gruenwald S, Heitz J 1993 Baculovirus Expresion
Vector System: Procedures and Methods Manual. Pharmingen, San Diego
-
Vlase H, Graves PN, Magnusson R, Davies TF 1995 Human autoantibodies to the TSH receptor: recognition of linear, folded
and glycosylated recombinant extracellular domain. J Clin
Endocrinol Metab 80:4653[Abstract]
-
Summers MD, Smith GE 1987 A manual of methods for
baculovirus vectors and insect cell culture procedures. Texas
Agricultural Station Publications, College Station, TX
-
Graves PN, Vlase H, Davies TF 1995 Folding of the
recombinant hTSH receptor extracellular domain: identification of
folded monomeric and tetrameric complexes which bind TSH receptor
autoantibodies. Endocrinology 136:521527[Abstract]
-
Nicholson LB, Vlase H, Graves PN, Nilsson M, Molne J,
Huang GC, Morgenthaler NG, Davies TF, McGregor AM, Banga JP 1996 Monoclonal antibodies to the human TSH receptor: epitope mapping
and binding to the native receptor on the basolateral plasma membrane
of thyroid follicular cells. J Mol Endocrinol 16:159170[Abstract]
-
Graves PN, Vlase H, Bobovnikova Y, Davies TF 1996 Multimeric complex formation by the natural TSH receptor. Endocrinology 137:39153920[Abstract]
-
Costagliola S, Swillens S, Niccoli P, Dumont JE, Vassart
G, Ludgate M 1992 Binding assay for thyrotropin receptor
autoantibodies using the recombinant receptor protein. J Clin
Endocrinol Metab 75:15401544[Abstract]
-
Filetti S, Foti D, Costante G, Rapoport B 1991 Recombinant human TSH receptor in a radioreceptor assay for the
measurement of TSH receptor autoantibodies. J Clin Endocrinol
Metab 72:10961101[Abstract]
-
Nakajima Y, Howells RD, Pegg C, Davies Jones E, Rees
Smith B 1987 Structure-activity analysis of microsomal
antigen/thyroid peroxidase. Mol Cell Endocrinol 53:1523[CrossRef][Medline]
-
Gattadahalli S, Seetharamiah S, Kurosky A, Desai RK,
Dallas JS, Prabhakar BS 1994 A recombinant extracellular domain of
the TSH receptor binds TSH in the absence of membranes. Endocrinology 134:549554[Abstract]
-
Shewring G, Rees Smith B 1982 An improved
radioreceptor assay for TSH receptor antibodies. Clin Endocrinol (Oxf) 17:409411[Medline]
-
Graves PN, Tomer Y, Davies TF 1992 Cloning and
sequencing of a 1.3 kb variant of human thyrotropin receptor mRNA
lacking the transmembrane domain. Biochem Biophys Res Commun 187:11351143[CrossRef][Medline]
-
Schulz GE, Shirmer RH 1979 Amino acids. In: Cantor
C (ed) Principles of Protein Structure. Springer Verlag, New York, pp
1530
-
Martin A, Davies TF 1992 T cells and human
autoimmune thyroid disease: emerging data show lack of need to invoke
suppressor T-cell problems. Thyroid 2:247261[Medline]
-
Kraiem Z, Lahat N, Glaser B, Baron E, Sadeh O, Sheinfeld
M 1987 Thyrotropin receptor blocking antibodies: incidence,
characterization and in vitro synthesis. Clin Endocrinol
(Oxf) 27:409421[Medline]
-
Chazenbalk GD, Rapoport B 1995 Expression of the
extracellular domain of the TSH receptor in the baculovirus system
using a promoter active earlier than the polyhedrin promoter. J
Biol Chem 270:15431549[Abstract/Free Full Text]
-
Huang GC, Page MJ, Nicholson LB, Collison KS, McGregor
AM, Banga JP 1993 The thyrotropin receptor of Graves disease:
overexpression of the extracellular domain in insect cells using
recombinant baculovirus, immunoaffinity purification and analysis of
autoantibody binding. J Mol Endocrinol 10:127142[Abstract]
-
Gu W, Du G, Kopp P, Rentoumis A, Albanese C, Kohn
LD, Madison LD, Jameson JL 1995 The TSH receptor transmembrane
domain mutation (Pro 556-Leu) in the hypothyroid hyt/hyt/mouse results
in the plasma membrane targeting but defective TSH binding.
Endocrinology 136:31463153[Abstract]
-
Ji I, Ji TH 1991 Asp383 in the second transmembrane
domain of the LH receptor is important for high affinity hormone
binding and cAMP production. J Biol Chem 266:1495314957[Abstract/Free Full Text]
-
Couet J, Sar S, Jolivet A, Hai MV, Milgrom E, Misrahi
M 1996 Shedding of human TSH receptor ectodomain: involvement of a
matrix metalloprotease. J Biol Chem 271:45454552[Abstract/Free Full Text]
-
Zhang R, Cai H, Fatima N, Buczko E, Dufau ML 1995 Functional glycosylation sites of the rat LH receptor required for
ligand binding. J Biol Chem 270:2172221728[Abstract/Free Full Text]
-
Bobovnikova Y, Graves PN, Vlase H, Davies TF 1997 Characterization of soluble, disulfide bond-stablized, prokaryotically
expressed human TSH receptor ectodomain. Endocrinology 138:588593[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. M. McLachlan, Y. Nagayama, and B. Rapoport
Insight into Graves' Hyperthyroidism from Animal Models
Endocr. Rev.,
October 1, 2005;
26(6):
800 - 832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Oda, J. Sanders, S. Roberts, M. Maruyama, A. Kiddie, J. Furmaniak, and B. Rees Smith
Analysis of Carbohydrate Residues on Recombinant Human Thyrotropin Receptor
J. Clin. Endocrinol. Metab.,
June 1, 1999;
84(6):
2119 - 2125.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Kita, L. Ahmad, R. C. Marians, H. Vlase, P. Unger, P. N. Graves, and T. F. Davies
Regulation and Transfer of a Murine Model of Thyrotropin Receptor Antibody Mediated Graves' Disease
Endocrinology,
March 1, 1999;
140(3):
1392 - 1398.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Nagayama, H. Namba, N. Yokoyama, S. Yamashita, and M. Niwa
Role of Asparagine-linked Oligosaccharides in Protein Folding, Membrane Targeting, and Thyrotropin and Autoantibody Binding of the Human Thyrotropin Receptor
J. Biol. Chem.,
December 11, 1998;
273(50):
33423 - 33428.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Rapoport, G. D. Chazenbalk, J. C. Jaume, and S. M. McLachlan
The Thyrotropin (TSH)-Releasing Hormone Receptor: Interaction with TSH and Autoantibodies
Endocr. Rev.,
December 1, 1998;
19(6):
673 - 716.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. R. Da Costa and A. P. Johnstone
Production of the Thyrotrophin Receptor Extracellular Domain as a Glycosylphosphatidylinositol-anchored Membrane Protein and Its Interaction with Thyrotrophin and Autoantibodies
J. Biol. Chem.,
May 8, 1998;
273(19):
11874 - 11880.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Osuga, S.-G. Liang, J. S. Dallas, C. Wang, and A. J. W. Hsueh
Soluble Ecto-Domain Mutant of Thyrotropin (TSH) Receptor Incapable of Binding TSH Neutralizes the Action of Thyroid-Stimulating Antibodies from Graves' Patients
Endocrinology,
February 1, 1998;
139(2):
671 - 676.
[Abstract]
[Full Text]
[PDF]
|
 |
|