| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Articles |
Department of Biological Chemistry (D.N.C., A.F.S.) and the Mental Health Research Institute (K.A.G., J.S.L., A.F.S.), The University of Michigan, Ann Arbor, Michigan 48109-0720
Address all correspondence and requests for reprints to: Audrey F. Seasholtz, Ph.D., Mental Health Research Institute, 205 Zina Pitcher Place, Ann Arbor, Michigan 48109-0720. E-mail: aseashol{at}umich.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The CRH-binding protein (CRH-BP) is a 37-kDa secreted glycoprotein that binds human CRH with an affinity greater than the pituitary CRH receptor [Ki = 0.4 and 1.7 nM, respectively (6, 7, 8, 9)]. This binding protein blocks the ACTH-releasing activity of CRH in vitro on rat anterior pituitary primary cultures and mouse anterior pituitary tumor (AtT-20) cells (7, 8, 10). In situ hybridization and immunocytochemical analyses have demonstrated that the CRH-BP is expressed in rat brain and anterior pituitary corticotrophs (11). In the brain, CRH-BP is expressed predominantly in the cerebral cortex and subcortical limbic structures and colocalizes with CRH or CRH receptors in several brain regions (11, 12). The overlapping patterns of CRH-BP, CRH, and CRH receptor expression in brain and pituitary suggest that the CRH-BP may alter the in vivo interaction of CRH with the CRH receptor, thus modulating the activity of CRH. The CRH-BP also may play a role in regulating the activity of the novel, CRH-like peptide, urocortin, which also binds to the CRH-BP with high affinity [Ki = 0.1 nM (13)].
Although the in vivo distribution of CRH-BP mRNA expression and the in vitro interaction of CRH and CRH-BP have been characterized, the exact physiological role of the CRH-BP has not been determined. In the brain, 40–60% of CRH peptide is bound to the CRH-BP (14, 15), consistent with studies suggesting that CRH-BP can modulate the effects of CRH on behavior (16, 17, 18). However, in humans, CRH-BP mRNA is expressed not only in brain, but also in liver and placenta (7, 19), where it may regulate CRH activity during pregnancy (10, 20, 21).
Although these results suggest that CRH-BP may act as a carrier and/or modulator of CRH, little is known about the molecular mechanisms regulating CRH-BP mRNA expression. Studies in primary astrocyte cultures, showing increased CRH-BP steady-state mRNA levels after forskolin/isobutylmethylxanthine (IBMX) treatment, provide our only insight into the regulation of CRH-BP mRNA expression in mammalian brain (22). Because aberrant CRH activity is associated with several psychiatric and neurological disorders, including major depression and Alzheimer’s disease, an understanding of the mechanisms that regulate CRH-BP gene expression in the brain and pituitary may have important clinical implications (1, 14).
To further define the molecular mechanisms regulating CRH-BP gene expression, we have characterized the rat CRH-BP gene structure and mapped the CRH-BP transcription initiation sites in rat brain by ribonuclease (RNase) protection assays. Transfection experiments with CRH-BP reporter constructs have been used to identify functional CRH-BP promoter sequences and to demonstrate positive regulation of CRH-BP promoter activity by cAMP and CRH.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Isolation of genomic clones
An EMBL-3 Sp6/T7 Sprague Dawley rat genomic library (Clontech,
Palo Alto, CA) was plated on Escherichia coli NM538 and
screened in duplicate with the previously described 666-bp
PvuII fragment of the rat CRH-BP cDNA (8). Hybridization
conditions were as described above. Two hybridization-positive plaques
were plaque-purified. The rat CRH-BP genomic clones were mapped by
restriction endonuclease and Southern blot analyses using the 666-bp
PvuII fragment and numerous rat CRH-BP cDNA-specific
oligonucleotides as hybridization probes. DNA fragments were subcloned
and nucleotide sequencing performed on both strands, as described
above. Nucleotide sequences were numbered using the human liver CRH-BP
transcription initiation site as +1 (23).
Southern blot analysis
Ten micrograms of Sprague-Dawley rat genomic DNA were digested
with 20 U of restriction endonuclease (PvuII,
PstI, or SacI). The reactions were
electrophoresed with DNA size standards (1 kilobase (kb) DNA ladder,
Life Technologies, Gaithersburg, MD) on a 0.8% agarose gel and then
transferred to a Nytran membrane (Schleicher and Schuell, Keene, NH).
Hybridization was performed at 55 C in Hybridization Buffer (see above)
containing 100 µg/ml yeast RNA and 1 x 106 cpm of
denatured probe per ml buffer. One blot was hybridized with the
random-primed 666-bp PvuII fragment of the rat CRH-BP cDNA
clone, spanning exons 3–7. A second genomic Southern blot was
hybridized with a random-primed 187-bp SphI/PstI
fragment of the rat CRH-BP cDNA clone (exon 7). The blots were washed
successively in 2x SSC, 0.1% SDS at room temperature for 15 min and
0.1x SSC, 0.1% SDS, and 0.1% sodium pyrophosphate for 30 min at 60
C. The blots were exposed to film for 48–72 h at -80 C with
intensifying screens. Because of incomplete digestion of the genomic
DNA with the restriction enzymes, weakly hybridizing bands are observed
at high molecular weights in some of the lanes.
RNase protection assays
Total RNA was isolated from rat cerebral cortex, pituitary, and
liver by standard methods (24, 25). The 3.5-kb SacI and
709-bp BamHI/PstI (-632 to +77) fragments of
CRH-BP genomic clone 3–3 (see Figs. 1
and 3) were
subcloned into the SacI site and
BamHI/PstI sites of pGEM-3Z (Promega, Madison,
WI) to create pCRHBP-3500Sac and pCRHBP-709Bam/Pst, respectively. These
plasmids were linearized with NdeI to generate templates for
complementary RNA (cRNA) probe synthesis. NdeI-linearized
pCRHBP-3500Sac generates a probe corresponding to nucleotides -341 to
+66 of the rat CRH-BP gene plus 54 nucleotides of plasmid linker DNA;
linearized pCRHBP-709Bam/Pst generates a probe corresponding to
nucleotides -341 to +77 plus 21 nucleotides of linker. One microgram
of linearized DNA template was mixed with 1 µl SP6 RNA polymerase (25
U/µl, Epicentre Technologies, Madison, WI), 5 µl (50 µCi) of
32P-UTP (>3000 Ci/mmol, ICN Pharmaceuticals), 1 µl
RNasin (28 U/µl, Promega), 10 mM DTT, 0.5 mM
each of ATP, GTP, and CTP, 10 µM UTP in 1x transcription
buffer (Epicentre) in a vol of 20 µl. The reaction was incubated at
41 C for 90 min. One unit of RNase-free DNase I (Promega) was added,
and the reaction was incubated for 10 min at room temperature. To
terminate the reaction, 20 µl Loading Dye (95% formamide, 1
mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue) were
added, followed by a 5-min incubation at 70 C. This sample was then
electrophoresed on a 6% polyacrylamide/7 M urea gel.
Full-length probe was excised from the gel and eluted in 300 µl 0.5
M ammonium acetate, 1 mM EDTA, 0.2% SDS. For
solution hybridization, 50 µg total RNA were precipitated with
0.5–1.0 x 106 cpm cRNA probe, and the pellet was
resuspended in 30 µl Solution A [80% deionized formamide, 100
mM sodium citrate (pH 6.4), 300 mM sodium
acetate (pH 6.4), 1 mM EDTA; Ambion, Inc., Madison, WI].
The samples were incubated at 95 C for 5 min and then immediately
immersed in a 60 C water bath for 12–20 h. Samples were allowed to
cool to room temperature for 5–10 min, and 200 µl Solution Bx
(Ambion, Inc.) containing 5 µg/ml RNase A and 100 U/ml RNase T1 were
added to each tube. Samples were incubated 60 min at 37 C.
Subsequently, 300 µl Solution Dx (Ambion) and 200 µl 100% ethanol
were added to terminate the reaction and precipitate RNA hybrids. RNA
pellets were resuspended in Loading Dye and analyzed on 6%
polyacrylamide/7 M urea gels. Radiolabeled RNA probes of
various sizes and DNA sequencing reactions were used as size standards.
Dried gels were exposed to XAR film for various lengths of time.
|
|
TSH (mouse anterior pituitary thyrotrope) cells were
provided by Dr. Pamela L. Mellon (University of California, San Diego,
CA) and were maintained as described previously (26).
The 3500-bp SacI fragment of the rat CRH-BP gene was
subcloned into the PXP2 luciferase reporter plasmid (27) in both
orientations to give clones 3500BP-LUC and 3500BPrev-LUC. The 407-bp
NdeI/SacI fragment (nucleotides -341 to +66) of
the rat CRH-BP gene was independently subcloned into PXP2 to create the
plasmid 341BP-LUC. Other CRH-BP-LUC reporter constructs were derived
from the 3500BP-LUC construct by restriction endonuclease digestion
with BamHI or NcoI to form the 631BP-LUC (-631
to +66) or the 88BP-LUC (-88 to +66) plasmids, respectively.
Six-centimeter plates containing approximately 250,000 cells (TSH,
COS-1, NIE-115, Neuro-2a) or 500,000 cells (AtT-20, PC12) were
transfected with 12.5 µg reporter DNA using the calcium phosphate
method, as previously described (28). A CMVß-galactosidase expression
vector (CMVßgal; a gift of Dr. Michael Uhler, University of Michigan)
was included in these transfections for normalization purposes.
Forty-eight hours post transfection, cells were washed and harvested in
PBS. Cell pellets were lysed in 135–200 µl 0.25 M Tris
(pH 8.0), 0.1 mM EDTA, 15 mM magnesium sulfate,
1% Triton X-100 and incubated on ice for 10 min. Cell membranes and
other debris were removed by centrifugation at 10,000 x
g for 10 min at 4 C. Luciferase activity was determined by
combining 5–50 µl extract with 100 µl luciferase assay buffer (20
mM Tris (pH 8.0), 1.07 mM magnesium carbonate,
2.67 mM magnesium sulfate, 0.1 mM EDTA, 33.3
mM DTT, 0.27 mM Coenzyme A (Calbiochem, San
Diego, CA), 0.53 mM ATP, and 0.47 mM luciferin
(Analytical Luminescence, Ann Arbor, MI) in a LKB luminometer and
assaying for 30 sec. ß-galactosidase activity was assayed as
previously described (29). Luciferase activity was normalized to
ß-galactosidase activity to control for differences in transfection
efficiency.
For regulation studies, the 3500-bp SacI, the 407-bp
NdeI/SacI (containing nucleotides -341 to +66),
and the 154-bp NcoI/SacI (containing nucleotides
-88 to +66) fragments of the rat CRH-BP gene were subcloned into the
promoterless chloramphenicol acetyltransferase (CAT) reporter plasmid,
pGSVOCAT (30), to produce the 3500BP-CAT, 341BP-CAT, and 88BP-CAT
constructs, respectively. PCR was used for site-directed mutagensis to
create the 341(
CRE)BP-CAT construct using 341BP-CAT as template and
the following primers: T7 primer (5'TAATACGACTCACTATAGGG3'; anneals to
plasmid sequences), BPCREmut1 (5'TGGACCCTCTCGATCGCCACG3';
from -135 to -115 bp), BPCREmut2 (5'
CGTGGCGATCGAGAGGGTCCA 3'), and a CAT primer
(5'CTTTACGATGCCATTGGG3'). The mutated nucleotides are underlined. The
overlapping DNA fragments resulting from PCR with BPCREmut1/CAT and
BPCREmut2/T7 primer pairs were combined and subjected to a second round
of PCR with the T7 and CAT primers to amplify the sequences from -341
to +66 bp, including the CRE mutation. This PCR product was ligated
into the pGSVOCAT construct to create 341(CRE)BP-CAT, and the entire
PCR-derived insert was sequenced to verify the mutation and to ensure
that no additional modifications were introduced. Luciferase constructs
were not used for this study because the promoterless PXP2 plasmid is
positively regulated by forskolin (2-fold) in many of the cell lines
used (D. N. Cortright, unpublished observations). Cells were
transfected, as described above, with 8–12.5 µg of each CRH-BP-CAT
construct. In some experiments, cells were treated with 10
µM forskolin (Calbiochem) and 250 µM IBMX
(Sigma) for 6 or 24 h before harvest. In other experiments, cells
were treated with 10 µM forskolin or 20 nM
ovine CRH (oCRH; American Peptide Company, Sunnyvale, CA) for 12 or
24 h before harvest.
To examine regulation of promoter activity by CRH in cell lines that do not express endogenous CRH receptors, a mouse CRH receptor I (CRH-R1) expression vector was created. A mouse brain cDNA library was screened using a radiolabeled PCR fragment containing nucleotides 638-1025 of the mouse CRH receptor I [(31); GenBank accession no. X72305]. A partial cDNA was isolated, sequenced, and found to span nucleotides 408-2273 of mouse CRH-R1. The remaining 5' sequences of the mouse CRH-R1 cDNA were obtained by PCR from reverse-transcribed mouse brain cDNA. The resulting PCR fragment was ligated to the partial CRH-R1 cDNA clone to form a CRH-R1 cDNA fragment spanning nucleotides 17–2273 (31), including the entire protein coding region. This cDNA subsequently was subcloned into the plasmid pCMVneo (8) to form CMV.CRH-R1, which expresses CRH-R1 under the control of the CMV promoter. Cells were cotransfected with 1.5 µg CMV.CRH-R1 and 8–12.5 µg CRH-BP constructs and treated as previously described.
Because of low transfection efficiency with the calcium phosphate method, AtT-20 cells were transfected with CRH-BP-CAT constructs using lipofectamine (Life Technologies) according to manufacturer’s specifications. Briefly, cells were cultured in 6-well plates and grown to 50% confluency. Cells were serum-deprived for 20 h before transfection. Two to 4 µg DNA per well were transfected for 5 h. Cells were then grown in serum-containing media, with the addition of CRH for 15 h before harvest.
Cells were harvested 44–48 h post transfection and lysed in 60–100 µl 250 mM Tris (pH 8.0), 0.5% Triton X-100. CAT activity was determined, as previously described (28), using 5–60 µl extract for 3–22 h. The protein concentration of the cell extracts did not vary significantly.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
genomic library were plated and screened with the 666-bp
PvuII fragment of the rat CRH-BP cDNA, as described in
Materials and Methods. After secondary screens, two
independent clones (3–3 and 3–4) were plaque-purified. Southern blot
analysis with rat CRH-BP cDNA-specific oligonucleotide probes was used
to identify and clone DNA fragments from each genomic clone that
contained the exons of the rat CRH-BP gene. Nucleotide sequencing and
Southern blot analysis of these clones confirmed that genomic clones
3–3 and 3–4 contained distinct, yet overlapping, DNA sequences. The
rat CRH-BP gene spans almost 12 kb and contains 7 exons and 6 introns
(Fig. 1
, A and B). Exon 7 is the largest exon (716 nucleotides) in the
gene, including the 3' end of the protein coding sequence and the
entire 3' untranslated region. The 3' boundary of Exon 7 was determined
by comparison of the genomic sequence with rat CRH-BP cDNA clone 7A1
(see Materials and Methods) nucleotide sequences. The 3'
untranslated DNA contains two poly(A) signal sequences (Fig. 1, underlined) and a poly(ATA) repeat (+1378). Exon 1 contains
the translation initiation site (ATG) and 81 bp protein coding
sequence. This gene structure is similar to the human CRH-BP gene (23). All of the exon/intron boundaries are the same in the rat and human genes, and the sequences of the splice sites are highly conserved. The nucleotide sequences of exons 1–6 are highly homologous between the rat and human genes (78–90% sequence identity). Exon 7 has the lowest degree of homology (61%) between the rat and human genes, largely because of the divergence of the 3' untranslated sequence.
Southern analysis of rat genomic DNA
Genomic Southern blot analysis was performed to verify the
integrity of the rat CRH-BP genomic clones and determine the number of
CRH-BP genes present in the rat genome. Rat genomic DNA was digested
with a number of restriction endonucleases and analyzed by Southern
blot, as described in Materials and Methods. Analysis of the
genomic DNA blot with a CRH-BP cDNA hybridization probe spanning exons
3–7 (666-bp PvuII fragment, as indicated in Fig. 1A)
demonstrates multiple, hybridization-positive bands (Fig. 2A). However, the Exon 7-specific probe (187-bp
SphI/PstI fragment of the rat CRH-BP cDNA; Fig. 1A) hybridizes with unique SacI (9.0 kb), PvuII
(900 bp), and PstI (1.0 kb) DNA fragments (Fig. 2B),
suggesting the presence of a single rat CRH-BP gene.
|
match the restriction endonuclease analysis of
genomic clones 3–3 and 3–4 (Fig. 1A), verifying the integrity of the
overlapping genomic clones. For example, the 666-bp CRH-BP cDNA probe
hybridizes to the 9.0-kb, 2.8-kb, and 1.4-kb SacI genomic
fragments whereas the 187-bp probe recognizes only the 9.0-kb fragment.
Similarly, the 666-bp hybridization probe recognizes the 5.5-kb and
3.5-kb PvuII fragments, whereas the 187-bp probe hybridizes
to the 900-bp PvuII fragment containing most of exon 7.
Homology of the 5' flanking DNA of the rat and human CRH-BP
genes
Comparison of the 5' flanking and 5' untranslated DNA
sequences of the rat and human (23) CRH-BP genes indicates high
sequence identity (85%) between the two genes from nucleotides +77 to
-215 (Fig. 3). Promoter sequence analysis reveals
multiple potential transcription factor-binding sites present in both
the rat and human 5' flanking DNAs, based on homology to consensus
binding sites. These potential transcription factor-binding sites
include a CREB/ATF site [-127 to -123; (32)], a LF-A1 site [-135
to -130; (23)], one OTX site [-93 to -88; (33)], one AP-2 site
[-121 to -114; (34)], two Sp1 sites (-147 to -139 and -169 to
-162), and two AP-1 sites[(-177 to -171, -196 to -190 (35)].
Other potential binding sites found in the rat CRH-BP gene sequence
include two TATA sites (-221 to -217 and -478 to -474), a Pit-1
site (-297 to -290), a NF-kB site (-550 to -541), an AP-1 site
(-238 to -232), and an AP-2 site [-188 to -182 (35)]. The human
CRH-BP gene sequence 5' to nucleotide -215 contains several
regions of homology (including two TATA sequences) with the rat
gene sequence; however, the spacing of these regions in the 5' flanking
DNA is different in the two genes.
Mapping of transcription initiation sites in the rat CRH-BP
gene
RNase protection assays were used to determine the transcription
initiation site(s) of the rat CRH-BP gene. As shown in Fig. 4A, cRNA probes corresponding to nucleotides -341 to
+77 or -341 to +66 protect a major RNA transcript in RNA from rat
cerebral cortex (lanes 2 and 4), but not yeast (lanes 3 and 5), that is
located 77 or 65 nucleotides 5' to the PstI and
SacI sites, respectively, in the rat CRH-BP promoter
(asterisk at +1; Fig. 3). This site corresponds to the
transcription initiation site of CRH-BP in human liver (23) and is
located 32 bp 3' to a consensus TATA sequence (-31 to -25). However,
longer exposures reveal additional upstream initiation sites. As shown
by the representative experiment in Fig. 4B, multiple CRH-BP
transcripts are present in rat cerebral cortex (lanes 2 and 5) but not
in rat liver (lane 3) or yeast (lane 4) RNA. Similarly sized
transcripts were protected with both the -341 to +77 and -341 to +66
probes, allowing for the 11-nucleotide difference in probe length.
These experiments demonstrate that CRH-BP transcription initiates at
multiple sites up to, but not past, nucleotide -341. The majority of
transcripts initiate between size markers 77 and 160 (nucleotides -83
to +1; Fig. 3) with greater than 50% of the transcripts initiating at
+1. Several of the upstream transcription initiation sites correspond
to the 5' ends of CRH-BP cDNAs cloned from mouse brain (A. Nicoletti,
unpublished observations) and the 5' end of the rat brain CRH-BP cDNA
cloned by Potter and colleagues (7)(size marker 105, Fig. 4B and
nucleotide -27, Fig. 3). Additional studies demonstrated a similar
pattern of protected CRH-BP transcripts in pituitary RNA (data not
shown).
|
, significant luciferase activity (relative to the
promoterless PXP2 vector) was detected after transient transfection
with the 3500BP-LUC construct in Neuro-2a and NIE-115 (mouse
neuroblastoma), TSH, AtT-20 (anterior pituitary corticotrope), PC12,
and COS-1 cells. In contrast, the 3500BPrev-LUC construct lacks
promoter activity in these cells, consistent with the orientation
dependence of basal promoter elements.
|
). COS-1, Neuro-2a, and TSH cells were transiently
transfected with these constructs, as well as the 3500BP-Luc and PXP2
constructs. The results, shown in Fig. 5B, demonstrate that all
constructs exhibit promoter activity in the cell lines tested,
indicating that as little as 88 bp rat CRH-BP 5' flanking DNA is
required to observe basal promoter activity.
Rat CRH-BP promoter activity is induced by cAMP and CRH
The identification of potential CREB/ATF and AP-2 binding sites in
the rat CRH-BP promoter sequence suggested that promoter activity might
be transcriptionally regulated by cAMP. As shown in Fig. 6A, COS-1 cells transfected with the 3500BP-CAT
construct, containing 3500 bp rat CRH-BP 5' flanking DNA, and treated
with forskolin/IBMX (For/I) for 6 or 24 h demonstrate 3.6
± 0.7-fold (mean ± SEM) and 9.5 ± 1.3-fold
inductions in promoter activity, respectively. Positive cAMP regulation
of the 3500BP-CAT construct also was observed in other cell lines with
Neuro-2a cells demonstrating the lowest induction (2-fold relative to
control) and TSH cells showing the highest induction with
forskolin/IBMX. Differences in the levels of phosphodiesterases,
adenylate cyclases, cAMP-dependent protein kinases, and transcription
factors expressed in various cell lines may partly explain these
different levels of cAMP-induced promoter activity.
|
TSH cells were transiently
cotransfected with the 3500BP-CAT and CRH receptor expression
(CMV-CRH-R1) constructs. Alternatively, cells were cotransfected with
the 3500BP-CAT and CMVneo constructs as a negative control. As shown in
Fig. 6B, a 12-h treatment of transfected TSH cells with 10
µM forskolin (For) results in an 8-fold induction in CAT
activity relative to control in the absence or presence of the CRH
receptor. In contrast, a 12-h treatment of transfected TSH cells
with 20 nM oCRH results in increased activity of the
3500BP-CAT construct, relative to control levels, but only when the CRH
receptor is coexpressed. These results demonstrate that CRH increases
CRH-BP promoter activity in TSH cells and that the increase is CRH
receptor-dependent. CRH regulation of CRH-BP promoter activity is also observed in AtT-20 cells that express endogenous CRH receptors. Transfection of AtT-20 cells with the 3500BP-CAT or promoterless CAT construct results in barely detectable levels of basal CAT activity. However, treatment of 3500BP-CAT-transfected cells with 20 nM oCRH for 15 h dramatically increases CAT activity. No increase in CAT activity is detected in cells transfected with the promoterless CAT construct. Together, these results demonstrate positive regulation of CRH-BP promoter activity by CRH in cells expressing endogenous or transfected CRH receptors.
Localization of 5' CRH-BP DNA sequences involved in cAMP and CRH
regulation
To further define the nucleotide sequences in the CRH-BP 5'
flanking region required for cAMP or CRH induction of this gene, two
additional CRH-BP-CAT plasmids were constructed that contained either
341 (341BP-CAT) or 88 (88BP-CAT) bp 5' flanking DNA in addition to 66
bp 5' untranslated CRH-BP sequences. These plasmids were transfected
into COS-1 and TSH cells (cotransfected with CMV-CRH-R1), and CAT
activity was determined after 24 h of treatment with For/I, For,
or CRH. As shown in Fig. 7, cells transfected with the
341BP-CAT construct retain cAMP and CRH inducibility at levels similar
to the 3500BP-CAT construct. However, deletion of CRH-BP promoter
sequences to -88 bp (88BP-CAT) results in dramatic reductions in both
cAMP (Fig. 7, A and B) and CRH inductions (Fig. 7B). These results
suggest that the CRH-BP DNA sequences between -341 and -88 bp
mediate, in large part, the cAMP and CRH regulation of CRH-BP promoter
activity. However, small cAMP and CRH inductions remain in the 88BP-CAT
transfections in TSH cells, suggesting that additional sequences may
contribute to the cAMP and CRH regulation in these cells.
|
CRE)BP-CAT. This construct is identical to 341BP-CAT, except for
the mutation of the putative CRE sequences. When this plasmid is
transfected into COS-1 cells, the For/I-mediated induction in CAT
activity decreases from 19-fold in 341BP-CAT-transfected cells to
1.2-fold in cells transfected with 341(CRE)BP-CAT. Similar decreases
in forskolin- and CRH-mediated inductions are observed upon
transfection of the 341(CRE)BP-CAT into TSH cells cotransfected
with the CRH receptor. The small cAMP and CRH inductions remaining in
TSH cells after mutation of the CRE sequence are comparable with the
inductions in the 88BP-CAT construct. These results demonstrate that
the CRE-like DNA sequence at -127 to -123 bp in the CRH-BP promoter
mediates, in large part, the cAMP and CRH inducibility of the CRH-BP
promoter in transfected COS-1 and TSH cells. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To define a potential rat CRH-BP promoter sequence, transcription
initiation sites in the rat CRH-BP gene were identified (Fig. 4). RNase
protection assays revealed that CRH-BP transcripts initiate at multiple
sites in rat cerebral cortex, including a major initiation site. The
major CRH-BP initiation site in rat cerebral cortex corresponds to the
previously mapped human liver CRH-BP CAP site (23) and is located 31
nucleotides 3' to a conserved TATA sequence (-31 to -25; Fig. 3).
The identification of multiple upstream initiation sites is consistent
with the isolation of rat and mouse brain CRH-BP cDNAs with 5' ends
that extend beyond the 5' end of the human liver CRH-BP cDNA (7, 8).
The number and pattern of transcription initiation sites were similar
in rat cerebral cortex and pituitary, indicating that the mechanisms
controlling basal CRH-BP gene transcription are similar in these
tissues. The DNA sequences controlling transcription initiation at
upstream sites may include the TATA sequence at -221 and Sp1 sites at
-147 and -169 (37). The presence of multiple sites of transcription
initiation of the CRH-BP gene in rat brain and pituitary, but not in
human liver, may be explained partly by the differences in the 5'
flanking DNA of the rat and human CRH-BP genes. Alternatively, multiple
transcription initiation sites also may exist for the CRH-BP gene
expressed in human brain and pituitary, suggesting that the different
transcription initiation sites may be tissue-specific.
The identification of CRH-BP transcription initiation sites suggested
that the 3.5-kb SacI fragment of the rat CRH-BP gene would
contain functional promoter activity. Transfection experiments with the
3500BP-LUC construct in cultured mammalian cells demonstrated basal
CRH-BP promoter activity in a variety of different cell types,
including neuroblastoma (Neuro-2a and NIE-115), anterior pituitary
corticotrope (AtT-20), anterior pituitary thyrotrope (TSH), adrenal
(PC12), and kidney (COS-1) cells. Analysis of deletion mutants of the
3500BP-LUC construct indicates that nucleotides -341 to +66 of the rat
CRH-BP gene contain promoter activity equivalent to nucleotides -3500
to +66 in Neuro-2a and COS-1 cells. Removal of nucleotides -341 to
-88, which deletes transcription initiation sites 5' of the 160 marker
in Fig. 4B, results in decreased promoter activity in COS-1, Neuro-2a,
and TSH cells (Fig. 5B). These results suggest that nucleotide
sequences between -341 to -88 may play a role in directing basal
transcription of the rat CRH-BP gene, in addition to the basal promoter
activity contained within nucleotides -88 to +1.
Several neuronal and neuroendocrine cell lines were selected for transfection experiments because rat CRH-BP mRNA is expressed in brain and pituitary. To determine whether these cell lines express endogenous CRH-BP mRNA, Northern blot analysis was performed with 20–50 µg total RNA. CRH-BP mRNA was not detected in any cell line. However, RT-PCR and RNase protection (with 50–100 µg total RNA) experiments indicate that Neuro-2a, NIE-115, AtT20, and PC12 cells express endogenous CRH-BP mRNA at very low levels. Although CRH-BP mRNA was not detected in COS-1 cells by Northern blot, more sensitive analysis of COS-1 RNA by RT-PCR and RNase protection was not possible because the monkey CRH-BP cDNA has not been isolated. Although CRH-BP mRNA is expressed at very low, basal levels in a variety of neuronal and neuroendocrine cell lines, the tissue- and cell-specific expression of CRH-BP in vivo may require DNA elements not included in the CRH-BP promoter constructs and/or cell-specific transcription factors.
The presence of potential CREB/ATF and AP-2 transcription
factor-binding sites in the 5' flanking DNA suggested that CRH-BP gene
transcription might be regulated by cAMP. This hypothesis was supported
by the finding that rat CRH-BP promoter activity from the 3500BP-CAT
construct was induced by forskolin or forskolin/IBMX treatment in
multiple cell lines. Similar results were observed with the 341BP-CAT
construct, whereas the 88BP-CAT construct exhibited dramatically
reduced inductions in CRH-BP-CAT activity after forskolin (TSH) or
forskolin/IBMX (COS-1) treatment. These results indicated that the DNA
sequences between nucleotides -341 to -88 of the rat CRH-BP promoter,
including potential CRE and AP-2 sites, were required for
transcriptional regulation by cAMP. Mutation of the putative CRE
sequence (CGTCA) at -127 bp decreased cAMP-mediated inductions in COS
and TSH cells to the levels observed with the 88BP-CAT construct,
demonstrating the important role of the CGTCA sequence in the cAMP
regulation of CRH-BP promoter activity. These results suggest that the
CREB/ATF family of transcription factors that binds to CRE sequences
may be important mediators of the cAMP regulation of CRH-BP promoter
activity.
The demonstration of positive cAMP regulation of CRH-BP promoter activity is consistent with a recent study showing positive forskolin/IBMX regulation of steady-state CRH-BP mRNA levels in primary cultured rat neurons and astrocytes (22). Our results suggest that the induction of steady-state CRH-BP mRNA levels by cAMP in these cells may be mediated, at least in part, by positive regulation of CRH-BP gene transcription.
The demonstration of positive cAMP regulation of CRH-BP promoter
activity also raised the possibility that CRH-BP gene transcription
might be regulated by CRH, via the Gs-coupled CRH receptor,
in cells that express both CRH-BP and CRH receptor, such as anterior
pituitary corticotropes. AtT-20 cells, which serve as an excellent
model for anterior pituitary corticotropes in culture, were transfected
with the 3500BP-CAT construct to study the CRH regulation of CRH-BP
promoter activity. Although the basal expression of CRH-BP-CAT
constructs in these cells is very low because of poor transfection
efficiency, treatment of the transfected cells with CRH resulted in
increased CRH-BP promoter activity. This result demonstrates that CRH
can positively regulate CRH-BP promoter activity in AtT-20 cells via
endogenous CRH receptors. To further characterize the regulation by
CRH, TSH (anterior pituitary thyrotrope-like) cells were transiently
cotransfected with a CRH-R1 expression construct (CMV-CRH-R1) and the
3500BP-CAT or 341BP-CAT constructs. CRH treatment of the transfected
TSH cells resulted in increased CRH-BP promoter activity, consistent
with the hypothesis that CRH-BP transcription is positively regulated
by CRH receptor activation. Mutation of the CRE sequence
(341(CRE)BP-CAT) or deletion of promoter sequences to -88 bp
(88BP-CAT) dramatically reduced the CRH induction, suggesting that the
CGTCA sequence is important for CRH regulation of CRH-BP promoter
activity. The observation that CRH mediates positive regulation of
CRH-BP-reporter activity via CRH receptors suggests that CRH-BP
expression may be increased in CRH target cells after exposure to CRH.
For example, increased hypothalamic CRH secretion in response to stress
may activate CRH-BP gene transcription in corticotropes. In light of
the ability of CRH-BP to attenuate CRH activity in vitro and
in vivo (7, 8, 10, 14), these results further support the
hypothesis that the CRH-BP may play an important role as a negative
regulator of CRH activity.
Transcription of the POMC gene, which is also expressed in anterior
pituitary corticotropes, is positively regulated by CRH. Although the
mechanisms and transcription factors that mediate this response are not
completely characterized, CRH regulation of the POMC promoter is
mediated, in part, by AP-1 transcription factors cFos and cJun via a
conserved AP-1 site in exon 1 (38). CRH regulation of the POMC promoter
is also mediated by other, AP-1-independent pathways, possibly through
the actions of the transcription factor AP-2 or the CRH-responsive
element-binding protein (39, 40). The CRH-BP promoter, like POMC,
contains consensus binding sites for AP-1 and AP-2 transcription
factors. However, unlike POMC, the CRH-BP promoter contains a CRE-like
site (-127 bp), suggesting that the mechanisms of CRH-BP
transcriptional regulation by CRH may be distinct from POMC. In fact,
our results suggest that the sequences from -341 to -88 bp, including
the CGTCA sequence at -127 bp, are required for maximal CRH- and
cAMP-mediated regulation of promoter activity in COS-1 and -TSH
cells. Future studies in AtT-20 cells will further address the role of
the different transcription factor-binding sites in cAMP and CRH
regulation of CRH-BP-reporter expression in cells expressing endogenous
CRH receptors. Finally, it should be noted that CRH receptor mRNA
levels also are regulated by CRH but in an opposite fashion to POMC and
CRH-BP. Pozzoli and colleagues (41) have demonstrated that CRH
negatively regulates CRH receptor steady-state mRNA levels in rat
anterior pituitary cell cultures. However, the molecular mechanisms
involved in CRH regulation of CRH receptor gene expression have not yet
been determined.
In this study, we have characterized the structural organization and nucleotide sequence of the CRH-BP gene. Mapping of the 5' ends of rat CRH-BP transcripts in brain and pituitary demonstrates that transcription initiation occurs at multiple sites, in contrast to the single initiation site observed in human liver, suggesting that the regulation of CRH-BP transcription initiation is tissue- and/or species-specific. These experiments also provide the first description of CRH-BP promoter activity in cultured cells and demonstrate that CRH-BP promoter activity is induced by cAMP and CRH. Both the cAMP and CRH regulation seem to be mediated by nucleotide sequences between -341 and -88 bp in the CRH-BP 5' flanking DNA, in large part, via the CREB/ATF transcription factor-binding site (CGTCA) localized at -127 bp. Further characterization of the signaling mechanisms that regulate CRH-BP promoter activity and gene expression will help to elucidate the role of CRH-BP in modulating CRH activity in the brain and pituitary.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 30, 1996.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-subunit-secreting cell line derived from a mouse thyrotrope tumor.
Mol Endocrinol 4:589–596This article has been cited by other articles:
 |
|
 |
|
  A. F Seasholtz, M. Ohman, A. Wardani, and R. C Thompson Corticotropin-releasing hormone receptor expression and functional signaling in murine gonadotrope-like cells J. Endocrinol., February 1, 2009; 200(2): 223 - 232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Westphal and A. F. Seasholtz Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. van de Stolpe, A. J. Slycke, M. O. Reinders, A. W. M. Zomer, S. Goodenough, C. Behl, A. F. Seasholtz, and P. T. van der Saag Estrogen Receptor (ER)-Mediated Transcriptional Regulation of the Human Corticotropin-Releasing Hormone-Binding Protein Promoter: Differential Effects of ER{alpha} and ER{beta} Mol. Endocrinol., December 1, 2004; 18(12): 2908 - 2923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Nanda, P. H. Roseboom, G. A. Nash, J. M. Speers, and N. H. Kalin Characterization of the Human Corticotropin-Releasing Factor2(a) Receptor Promoter: Regulation by Glucocorticoids and the Cyclic Adenosine 5'-Monophosphate Pathway Endocrinology, December 1, 2004; 145(12): 5605 - 5615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Levine Editorial: Stressing the Importance of Sex Endocrinology, December 1, 2002; 143(12): 4502 - 4504. [Full Text] [PDF]
|
|
|
|
|
|
D. B. Speert, S. J. MCClennen, and A. F. Seasholtz Sexually Dimorphic Expression of Corticotropin-Releasing Hormone-Binding Protein in the Mouse Pituitary Endocrinology, December 1, 2002; 143(12): 4730 - 4741. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Timofeeva, Y. Deshaies, F. Picard, and D. Richard Corticotropin-releasing hormone-binding protein in brain and pituitary of food-deprived obese (fa/fa) Zucker rats Am J Physiol Regulatory Integrative Comp Physiol, December 1, 1999; 277(6): R1749 - R1759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. McClennen and A. F. Seasholtz Transcriptional Regulation of Corticotropin-Releasing Hormone-Binding Protein Gene Expression in Astrocyte Cultures Endocrinology, September 1, 1999; 140(9): 4095 - 4103. [Abstract] [Full Text]
|
|
|
|
|
|
S. J. McClennen, D. N. Cortright, and A. F. Seasholtz Regulation of Pituitary Corticotropin-Releasing Hormone-Binding Protein Messenger Ribonucleic Acid Levels by Restraint Stress and Adrenalectomy Endocrinology, November 1, 1998; 139(11): 4435 - 4441. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
