help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cortright, D. N.
Right arrow Articles by Seasholtz, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cortright, D. N.
Right arrow Articles by Seasholtz, A. F.
Endocrinology Vol. 138, No. 5 2098-2108
Copyright © 1997 by The Endocrine Society

Articles

Isolation and Characterization of the Rat Corticotropin-Releasing Hormone (CRH)-Binding Protein Gene: Transcriptional Regulation by Cyclic Adenosine Monophosphate and CRH1

Daniel N. Cortright, Ki A. Goosens, J. Shonee Lesh and Audrey F. Seasholtz

Department of Biological Chemistry (D.N.C., A.F.S.) and the Mental Health Research Institute (K.A.G., J.S.L., A.F.S.), The University of Michigan, Ann Arbor, Michigan 48109-0720

Address all correspondence and requests for reprints to: Audrey F. Seasholtz, Ph.D., Mental Health Research Institute, 205 Zina Pitcher Place, Ann Arbor, Michigan 48109-0720. E-mail: aseashol{at}umich.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CRH-binding protein (CRH-BP) antagonizes the ACTH-releasing activity of the neuropeptide CRH in vitro. However, the function of CRH-BP in vivo and the molecular mechanisms that regulate CRH-BP expression are not well understood. In this study, the rat CRH-BP gene was characterized, and CRH-BP promoter sequences were identified. The rat CRH-BP gene spans almost 12 kilobases and contains 7 exons. Ribonuclease protection experiments indicate that transcription of the CRH-BP gene initiates at multiple sites in rat cerebral cortex. Transfection experiments with CRH-BP-reporter constructs, containing 88–3500 bp 5' flanking and 66 bp 5' untranslated DNA from the rat CRH-BP gene, demonstrate basal promoter activity in multiple cell lines. CRH-BP-reporter constructs also demonstrate positive regulation of promoter activity by cAMP in a variety of cell lines and by CRH in cells expressing the CRH receptor. The DNA sequences between -341 and -88 bp, including the cAMP response element-like sequence at -127 bp, are required for maximal cAMP and CRH regulation of CRH-BP promoter activity. These studies suggest that CRH-BP transcription in vivo may be positively regulated by cAMP and CRH.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CRH IS A 41-amino acid neuroendocrine peptide that regulates a variety of physiological responses to stress. CRH mediates its effects via specific, G protein-coupled CRH receptors that are expressed in numerous regions of the brain and in several peripheral sites, including anterior pituitary. Within the hypothalamic-pituitary-adrenal axis, CRH is the primary hypothalamic regulator of ACTH secretion from anterior pituitary corticotrophs. In the brain, CRH is thought to act as a neurotransmitter/neuromodulator, coordinating a variety of autonomic and behavioral responses to stress (1). In the periphery, CRH also may be involved in immune/inflammatory responses (2, 3) and developmental processes (4, 5).

The CRH-binding protein (CRH-BP) is a 37-kDa secreted glycoprotein that binds human CRH with an affinity greater than the pituitary CRH receptor [Ki = 0.4 and 1.7 nM, respectively (6, 7, 8, 9)]. This binding protein blocks the ACTH-releasing activity of CRH in vitro on rat anterior pituitary primary cultures and mouse anterior pituitary tumor (AtT-20) cells (7, 8, 10). In situ hybridization and immunocytochemical analyses have demonstrated that the CRH-BP is expressed in rat brain and anterior pituitary corticotrophs (11). In the brain, CRH-BP is expressed predominantly in the cerebral cortex and subcortical limbic structures and colocalizes with CRH or CRH receptors in several brain regions (11, 12). The overlapping patterns of CRH-BP, CRH, and CRH receptor expression in brain and pituitary suggest that the CRH-BP may alter the in vivo interaction of CRH with the CRH receptor, thus modulating the activity of CRH. The CRH-BP also may play a role in regulating the activity of the novel, CRH-like peptide, urocortin, which also binds to the CRH-BP with high affinity [Ki = 0.1 nM (13)].

Although the in vivo distribution of CRH-BP mRNA expression and the in vitro interaction of CRH and CRH-BP have been characterized, the exact physiological role of the CRH-BP has not been determined. In the brain, 40–60% of CRH peptide is bound to the CRH-BP (14, 15), consistent with studies suggesting that CRH-BP can modulate the effects of CRH on behavior (16, 17, 18). However, in humans, CRH-BP mRNA is expressed not only in brain, but also in liver and placenta (7, 19), where it may regulate CRH activity during pregnancy (10, 20, 21).

Although these results suggest that CRH-BP may act as a carrier and/or modulator of CRH, little is known about the molecular mechanisms regulating CRH-BP mRNA expression. Studies in primary astrocyte cultures, showing increased CRH-BP steady-state mRNA levels after forskolin/isobutylmethylxanthine (IBMX) treatment, provide our only insight into the regulation of CRH-BP mRNA expression in mammalian brain (22). Because aberrant CRH activity is associated with several psychiatric and neurological disorders, including major depression and Alzheimer’s disease, an understanding of the mechanisms that regulate CRH-BP gene expression in the brain and pituitary may have important clinical implications (1, 14).

To further define the molecular mechanisms regulating CRH-BP gene expression, we have characterized the rat CRH-BP gene structure and mapped the CRH-BP transcription initiation sites in rat brain by ribonuclease (RNase) protection assays. Transfection experiments with CRH-BP reporter constructs have been used to identify functional CRH-BP promoter sequences and to demonstrate positive regulation of CRH-BP promoter activity by cAMP and CRH.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Complementary DNA (cDNA) cloning
The rat CRH-BP cDNA sequence published by Potter and colleagues (7) contained nucleotide sequence corresponding to the 5' untranslated and protein coding regions of the rat CRH-BP cDNA. To obtain the nucleotide sequence of the 3' untranslated region, a rat CRH-BP cDNA was isolated from a rat brain cDNA library (courtesy of Dr. G. X. Xie, University of Michigan). The library was screened in duplicate using a 666-bp PvuII fragment of the rat CRH-BP cDNA isolated by RT-PCR from rat pituitary RNA (8). Filters were hybridized for 20 h at 37 C in Hybridization Buffer (5x sodium chloride/sodium citrate (SSC), 25 mM sodium phosphate (pH 6.5), 5x Denhardts, 5 mM EDTA, 0.1% SDS, and 0.1% sodium pyrophosphate) containing 50% formamide, 100 µg/ml yeast RNA, and 1 x 106 cpm of denatured probe per milliliter of buffer. The filters were washed twice in 2x SSC, 0.1% SDS, 0.1% sodium pyrophosphate for 15 min at room temperature followed by a 30-min wash in 0.2x SSC, 0.1% SDS, 0.1% sodium pyrophosphate at 50 C. The filters were exposed to Kodak XAR-5 film (Eastman Kodak, Rochester, NY) for 16 h at -80 C with intensifying screens. Three hybridization-positive clones were identified and characterized by Southern blot analysis. The entire nucleotide sequence of the clone containing the largest cDNA insert, 7A1, was obtained using Sequenase Version 2.0 (Amersham Life Sciences, Arlington Heights, IL) and deoxy GTP mixes, as described by the manufacturer. The University of Wisconsin Genetics Computer Group (Madison, WI) Sequence Analysis Software Package (GAP program) was used for nucleotide sequence homology determinations.

Isolation of genomic clones
An EMBL-3 Sp6/T7 Sprague Dawley rat genomic library (Clontech, Palo Alto, CA) was plated on Escherichia coli NM538 and screened in duplicate with the previously described 666-bp PvuII fragment of the rat CRH-BP cDNA (8). Hybridization conditions were as described above. Two hybridization-positive plaques were plaque-purified. The rat CRH-BP genomic clones were mapped by restriction endonuclease and Southern blot analyses using the 666-bp PvuII fragment and numerous rat CRH-BP cDNA-specific oligonucleotides as hybridization probes. DNA fragments were subcloned and nucleotide sequencing performed on both strands, as described above. Nucleotide sequences were numbered using the human liver CRH-BP transcription initiation site as +1 (23).

Southern blot analysis
Ten micrograms of Sprague-Dawley rat genomic DNA were digested with 20 U of restriction endonuclease (PvuII, PstI, or SacI). The reactions were electrophoresed with DNA size standards (1 kilobase (kb) DNA ladder, Life Technologies, Gaithersburg, MD) on a 0.8% agarose gel and then transferred to a Nytran membrane (Schleicher and Schuell, Keene, NH). Hybridization was performed at 55 C in Hybridization Buffer (see above) containing 100 µg/ml yeast RNA and 1 x 106 cpm of denatured probe per ml buffer. One blot was hybridized with the random-primed 666-bp PvuII fragment of the rat CRH-BP cDNA clone, spanning exons 3–7. A second genomic Southern blot was hybridized with a random-primed 187-bp SphI/PstI fragment of the rat CRH-BP cDNA clone (exon 7). The blots were washed successively in 2x SSC, 0.1% SDS at room temperature for 15 min and 0.1x SSC, 0.1% SDS, and 0.1% sodium pyrophosphate for 30 min at 60 C. The blots were exposed to film for 48–72 h at -80 C with intensifying screens. Because of incomplete digestion of the genomic DNA with the restriction enzymes, weakly hybridizing bands are observed at high molecular weights in some of the lanes.

RNase protection assays
Total RNA was isolated from rat cerebral cortex, pituitary, and liver by standard methods (24, 25). The 3.5-kb SacI and 709-bp BamHI/PstI (-632 to +77) fragments of CRH-BP genomic clone 3–3 (see Figs. 1Go and 3Go) were subcloned into the SacI site and BamHI/PstI sites of pGEM-3Z (Promega, Madison, WI) to create pCRHBP-3500Sac and pCRHBP-709Bam/Pst, respectively. These plasmids were linearized with NdeI to generate templates for complementary RNA (cRNA) probe synthesis. NdeI-linearized pCRHBP-3500Sac generates a probe corresponding to nucleotides -341 to +66 of the rat CRH-BP gene plus 54 nucleotides of plasmid linker DNA; linearized pCRHBP-709Bam/Pst generates a probe corresponding to nucleotides -341 to +77 plus 21 nucleotides of linker. One microgram of linearized DNA template was mixed with 1 µl SP6 RNA polymerase (25 U/µl, Epicentre Technologies, Madison, WI), 5 µl (50 µCi) of 32P-UTP (>3000 Ci/mmol, ICN Pharmaceuticals), 1 µl RNasin (28 U/µl, Promega), 10 mM DTT, 0.5 mM each of ATP, GTP, and CTP, 10 µM UTP in 1x transcription buffer (Epicentre) in a vol of 20 µl. The reaction was incubated at 41 C for 90 min. One unit of RNase-free DNase I (Promega) was added, and the reaction was incubated for 10 min at room temperature. To terminate the reaction, 20 µl Loading Dye (95% formamide, 1 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue) were added, followed by a 5-min incubation at 70 C. This sample was then electrophoresed on a 6% polyacrylamide/7 M urea gel. Full-length probe was excised from the gel and eluted in 300 µl 0.5 M ammonium acetate, 1 mM EDTA, 0.2% SDS. For solution hybridization, 50 µg total RNA were precipitated with 0.5–1.0 x 106 cpm cRNA probe, and the pellet was resuspended in 30 µl Solution A [80% deionized formamide, 100 mM sodium citrate (pH 6.4), 300 mM sodium acetate (pH 6.4), 1 mM EDTA; Ambion, Inc., Madison, WI]. The samples were incubated at 95 C for 5 min and then immediately immersed in a 60 C water bath for 12–20 h. Samples were allowed to cool to room temperature for 5–10 min, and 200 µl Solution Bx (Ambion, Inc.) containing 5 µg/ml RNase A and 100 U/ml RNase T1 were added to each tube. Samples were incubated 60 min at 37 C. Subsequently, 300 µl Solution Dx (Ambion) and 200 µl 100% ethanol were added to terminate the reaction and precipitate RNA hybrids. RNA pellets were resuspended in Loading Dye and analyzed on 6% polyacrylamide/7 M urea gels. Radiolabeled RNA probes of various sizes and DNA sequencing reactions were used as size standards. Dried gels were exposed to XAR film for various lengths of time.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 1. Structure and nucleotide sequence of the rat CRH-BP gene. A, Schematic of the rat CRH-BP gene structure. The exons are numbered in bold and all SacI (S) and PvuII (P) restriction endonuclease sites are indicated. *, PvuII sites present in the 666-bp CRH-BP cDNA hybridization probe used for screening and Southern blot analysis in Fig. 2AGo. The position of the exon 7-specific 187-bp SphI/PstI probe used in Fig. 2BGo is shown below the schematic. Positions of {lambda} genomic clones 3–3 and 3–4 also are indicated. B, The nucleotide sequence of each exon and intron/exon junction. Exon sequences are in upper case and intron sequences are in lower case. The size of each intron is shown in bold. The translation start (ATG, +92), translation stop (TGA, +1058), and poly adenylation signal sequences (AATAAA, +1425 and +1590) are underlined. The first 48 nucleotides 3' to the poly(A) addition site are indicated.

 


View larger version (56K):
[in this window]
[in a new window]
  		Figure 3. Nucleotide sequence homology of the 5' flanking DNA of the rat (R) and human (H) CRH-BP genes. Homologous and divergent nucleotides in the 5' flanking and 5' untranslated DNA are shown in upper and lower case, respectively. Potential transcription factor-binding sites are underlined and labeled. Also indicated are three TATA sequences and several restriction endonuclease sites. *, The transcription initiation site of the CRH-BP gene in human liver. The human CRH-BP gene sequence was taken from Behan et al. (23).

 
Cell culture and transfection experiments
AtT-20 (mouse anterior pituitary corticotrope), COS-1 (monkey kidney), NIE-115 (mouse neuroblastoma), and Neuro-2a (mouse neuroblastoma) cells were maintained in DMEM (Life Technologies) containing 10% heat-inactivated FCS (Hyclone, Logan, UT) at 37 C and 5% CO2. PC12 (rat adrenal pheochromocytomoma) cells were maintained in DMEM supplemented with 10% heat-inactivated horse serum and 5% FCS. {alpha}TSH (mouse anterior pituitary thyrotrope) cells were provided by Dr. Pamela L. Mellon (University of California, San Diego, CA) and were maintained as described previously (26).

The 3500-bp SacI fragment of the rat CRH-BP gene was subcloned into the PXP2 luciferase reporter plasmid (27) in both orientations to give clones 3500BP-LUC and 3500BPrev-LUC. The 407-bp NdeI/SacI fragment (nucleotides -341 to +66) of the rat CRH-BP gene was independently subcloned into PXP2 to create the plasmid 341BP-LUC. Other CRH-BP-LUC reporter constructs were derived from the 3500BP-LUC construct by restriction endonuclease digestion with BamHI or NcoI to form the 631BP-LUC (-631 to +66) or the 88BP-LUC (-88 to +66) plasmids, respectively. Six-centimeter plates containing approximately 250,000 cells ({alpha}TSH, COS-1, NIE-115, Neuro-2a) or 500,000 cells (AtT-20, PC12) were transfected with 12.5 µg reporter DNA using the calcium phosphate method, as previously described (28). A CMVß-galactosidase expression vector (CMVßgal; a gift of Dr. Michael Uhler, University of Michigan) was included in these transfections for normalization purposes. Forty-eight hours post transfection, cells were washed and harvested in PBS. Cell pellets were lysed in 135–200 µl 0.25 M Tris (pH 8.0), 0.1 mM EDTA, 15 mM magnesium sulfate, 1% Triton X-100 and incubated on ice for 10 min. Cell membranes and other debris were removed by centrifugation at 10,000 x g for 10 min at 4 C. Luciferase activity was determined by combining 5–50 µl extract with 100 µl luciferase assay buffer (20 mM Tris (pH 8.0), 1.07 mM magnesium carbonate, 2.67 mM magnesium sulfate, 0.1 mM EDTA, 33.3 mM DTT, 0.27 mM Coenzyme A (Calbiochem, San Diego, CA), 0.53 mM ATP, and 0.47 mM luciferin (Analytical Luminescence, Ann Arbor, MI) in a LKB luminometer and assaying for 30 sec. ß-galactosidase activity was assayed as previously described (29). Luciferase activity was normalized to ß-galactosidase activity to control for differences in transfection efficiency.

For regulation studies, the 3500-bp SacI, the 407-bp NdeI/SacI (containing nucleotides -341 to +66), and the 154-bp NcoI/SacI (containing nucleotides -88 to +66) fragments of the rat CRH-BP gene were subcloned into the promoterless chloramphenicol acetyltransferase (CAT) reporter plasmid, pGSVOCAT (30), to produce the 3500BP-CAT, 341BP-CAT, and 88BP-CAT constructs, respectively. PCR was used for site-directed mutagensis to create the 341({Delta}CRE)BP-CAT construct using 341BP-CAT as template and the following primers: T7 primer (5'TAATACGACTCACTATAGGG3'; anneals to plasmid sequences), BPCREmut1 (5'TGGACCCTCTCGATCGCCACG3'; from -135 to -115 bp), BPCREmut2 (5' CGTGGCGATCGAGAGGGTCCA 3'), and a CAT primer (5'CTTTACGATGCCATTGGG3'). The mutated nucleotides are underlined. The overlapping DNA fragments resulting from PCR with BPCREmut1/CAT and BPCREmut2/T7 primer pairs were combined and subjected to a second round of PCR with the T7 and CAT primers to amplify the sequences from -341 to +66 bp, including the CRE mutation. This PCR product was ligated into the pGSVOCAT construct to create 341({Delta}CRE)BP-CAT, and the entire PCR-derived insert was sequenced to verify the mutation and to ensure that no additional modifications were introduced. Luciferase constructs were not used for this study because the promoterless PXP2 plasmid is positively regulated by forskolin (2-fold) in many of the cell lines used (D. N. Cortright, unpublished observations). Cells were transfected, as described above, with 8–12.5 µg of each CRH-BP-CAT construct. In some experiments, cells were treated with 10 µM forskolin (Calbiochem) and 250 µM IBMX (Sigma) for 6 or 24 h before harvest. In other experiments, cells were treated with 10 µM forskolin or 20 nM ovine CRH (oCRH; American Peptide Company, Sunnyvale, CA) for 12 or 24 h before harvest.

To examine regulation of promoter activity by CRH in cell lines that do not express endogenous CRH receptors, a mouse CRH receptor I (CRH-R1) expression vector was created. A mouse brain cDNA library was screened using a radiolabeled PCR fragment containing nucleotides 638-1025 of the mouse CRH receptor I [(31); GenBank accession no. X72305]. A partial cDNA was isolated, sequenced, and found to span nucleotides 408-2273 of mouse CRH-R1. The remaining 5' sequences of the mouse CRH-R1 cDNA were obtained by PCR from reverse-transcribed mouse brain cDNA. The resulting PCR fragment was ligated to the partial CRH-R1 cDNA clone to form a CRH-R1 cDNA fragment spanning nucleotides 17–2273 (31), including the entire protein coding region. This cDNA subsequently was subcloned into the plasmid pCMVneo (8) to form CMV.CRH-R1, which expresses CRH-R1 under the control of the CMV promoter. Cells were cotransfected with 1.5 µg CMV.CRH-R1 and 8–12.5 µg CRH-BP constructs and treated as previously described.

Because of low transfection efficiency with the calcium phosphate method, AtT-20 cells were transfected with CRH-BP-CAT constructs using lipofectamine (Life Technologies) according to manufacturer’s specifications. Briefly, cells were cultured in 6-well plates and grown to 50% confluency. Cells were serum-deprived for 20 h before transfection. Two to 4 µg DNA per well were transfected for 5 h. Cells were then grown in serum-containing media, with the addition of CRH for 15 h before harvest.

Cells were harvested 44–48 h post transfection and lysed in 60–100 µl 250 mM Tris (pH 8.0), 0.5% Triton X-100. CAT activity was determined, as previously described (28), using 5–60 µl extract for 3–22 h. The protein concentration of the cell extracts did not vary significantly.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Structural organization of the rat CRH-BP gene
Approximately 1 x 106 phage from a rat {lambda} genomic library were plated and screened with the 666-bp PvuII fragment of the rat CRH-BP cDNA, as described in Materials and Methods. After secondary screens, two independent clones (3–3 and 3–4) were plaque-purified. Southern blot analysis with rat CRH-BP cDNA-specific oligonucleotide probes was used to identify and clone DNA fragments from each genomic clone that contained the exons of the rat CRH-BP gene. Nucleotide sequencing and Southern blot analysis of these clones confirmed that genomic clones 3–3 and 3–4 contained distinct, yet overlapping, DNA sequences. The rat CRH-BP gene spans almost 12 kb and contains 7 exons and 6 introns (Fig. 1Go, A and B). Exon 7 is the largest exon (716 nucleotides) in the gene, including the 3' end of the protein coding sequence and the entire 3' untranslated region. The 3' boundary of Exon 7 was determined by comparison of the genomic sequence with rat CRH-BP cDNA clone 7A1 (see Materials and Methods) nucleotide sequences. The 3' untranslated DNA contains two poly(A) signal sequences (Fig. 1Go, underlined) and a poly(ATA) repeat (+1378). Exon 1 contains the translation initiation site (ATG) and 81 bp protein coding sequence.

This gene structure is similar to the human CRH-BP gene (23). All of the exon/intron boundaries are the same in the rat and human genes, and the sequences of the splice sites are highly conserved. The nucleotide sequences of exons 1–6 are highly homologous between the rat and human genes (78–90% sequence identity). Exon 7 has the lowest degree of homology (61%) between the rat and human genes, largely because of the divergence of the 3' untranslated sequence.

Southern analysis of rat genomic DNA
Genomic Southern blot analysis was performed to verify the integrity of the rat CRH-BP genomic clones and determine the number of CRH-BP genes present in the rat genome. Rat genomic DNA was digested with a number of restriction endonucleases and analyzed by Southern blot, as described in Materials and Methods. Analysis of the genomic DNA blot with a CRH-BP cDNA hybridization probe spanning exons 3–7 (666-bp PvuII fragment, as indicated in Fig. 1AGo) demonstrates multiple, hybridization-positive bands (Fig. 2AGo). However, the Exon 7-specific probe (187-bp SphI/PstI fragment of the rat CRH-BP cDNA; Fig. 1AGo) hybridizes with unique SacI (9.0 kb), PvuII (900 bp), and PstI (1.0 kb) DNA fragments (Fig. 2BGo), suggesting the presence of a single rat CRH-BP gene.



View larger version (70K):
[in this window]
[in a new window]
  		Figure 2. Southern blot analysis of rat genomic DNA. Rat genomic DNA was digested with the indicated restriction endonucleases, electrophoresed, and transferred to Nytran membranes. Blots were then hybridized with radiolabeled fragments of the rat CRH-BP cDNA: A, 666-bp PvuII fragment (spanning Exons 3–7); or B, 187-bp SphI/PstI fragment (Exon 7; shown in Fig. 1AGo). DNA size standards in nucleotides are indicated along the left edge of the blots.

 
The sizes of the hybridization-positive fragments from genomic Southern analysis in Fig. 2Go match the restriction endonuclease analysis of genomic clones 3–3 and 3–4 (Fig. 1AGo), verifying the integrity of the overlapping genomic clones. For example, the 666-bp CRH-BP cDNA probe hybridizes to the 9.0-kb, 2.8-kb, and 1.4-kb SacI genomic fragments whereas the 187-bp probe recognizes only the 9.0-kb fragment. Similarly, the 666-bp hybridization probe recognizes the 5.5-kb and 3.5-kb PvuII fragments, whereas the 187-bp probe hybridizes to the 900-bp PvuII fragment containing most of exon 7.

Homology of the 5' flanking DNA of the rat and human CRH-BP genes
Comparison of the 5' flanking and 5' untranslated DNA sequences of the rat and human (23) CRH-BP genes indicates high sequence identity (85%) between the two genes from nucleotides +77 to -215 (Fig. 3Go). Promoter sequence analysis reveals multiple potential transcription factor-binding sites present in both the rat and human 5' flanking DNAs, based on homology to consensus binding sites. These potential transcription factor-binding sites include a CREB/ATF site [-127 to -123; (32)], a LF-A1 site [-135 to -130; (23)], one OTX site [-93 to -88; (33)], one AP-2 site [-121 to -114; (34)], two Sp1 sites (-147 to -139 and -169 to -162), and two AP-1 sites[(-177 to -171, -196 to -190 (35)]. Other potential binding sites found in the rat CRH-BP gene sequence include two TATA sites (-221 to -217 and -478 to -474), a Pit-1 site (-297 to -290), a NF-kB site (-550 to -541), an AP-1 site (-238 to -232), and an AP-2 site [-188 to -182 (35)]. The human CRH-BP gene sequence 5' to nucleotide -215 contains several regions of homology (including two TATA sequences) with the rat gene sequence; however, the spacing of these regions in the 5' flanking DNA is different in the two genes.

Mapping of transcription initiation sites in the rat CRH-BP gene
RNase protection assays were used to determine the transcription initiation site(s) of the rat CRH-BP gene. As shown in Fig. 4AGo, cRNA probes corresponding to nucleotides -341 to +77 or -341 to +66 protect a major RNA transcript in RNA from rat cerebral cortex (lanes 2 and 4), but not yeast (lanes 3 and 5), that is located 77 or 65 nucleotides 5' to the PstI and SacI sites, respectively, in the rat CRH-BP promoter (asterisk at +1; Fig. 3Go). This site corresponds to the transcription initiation site of CRH-BP in human liver (23) and is located 32 bp 3' to a consensus TATA sequence (-31 to -25). However, longer exposures reveal additional upstream initiation sites. As shown by the representative experiment in Fig. 4BGo, multiple CRH-BP transcripts are present in rat cerebral cortex (lanes 2 and 5) but not in rat liver (lane 3) or yeast (lane 4) RNA. Similarly sized transcripts were protected with both the -341 to +77 and -341 to +66 probes, allowing for the 11-nucleotide difference in probe length. These experiments demonstrate that CRH-BP transcription initiates at multiple sites up to, but not past, nucleotide -341. The majority of transcripts initiate between size markers 77 and 160 (nucleotides -83 to +1; Fig. 3Go) with greater than 50% of the transcripts initiating at +1. Several of the upstream transcription initiation sites correspond to the 5' ends of CRH-BP cDNAs cloned from mouse brain (A. Nicoletti, unpublished observations) and the 5' end of the rat brain CRH-BP cDNA cloned by Potter and colleagues (7)(size marker 105, Fig. 4BGo and nucleotide -27, Fig. 3Go). Additional studies demonstrated a similar pattern of protected CRH-BP transcripts in pituitary RNA (data not shown).



View larger version (78K):
[in this window]
[in a new window]
  		Figure 4. RNase protection analysis of CRH-BP transcription initiation sites in rat cerebral cortex. RNase protection assays contained 50 µg total RNA with rat CRH-BP gene-specific cRNA probes, as described in Materials and Methods. A, Lanes 1–3 contain the -341 to +77 probe, and lanes 4–6 contain the -341 to +66 probe, as denoted by the brackets. Lanes 1 and 6, undigested probe; Lanes 2 and 4, protected RNA hybrids from rat cerebral cortex RNA; and Lanes 3 and 5, protected RNA hybrids from yeast RNA. B, Similar to A, except lanes 1–4 contain the -341 to +77 probe and lanes 5 and 6 contain the -341 to +66 probe, as denoted at the bottom of the figure. Lanes 2 and 5, protected RNA hybrids from cerebral cortex RNA; lane 3, rat liver RNA; and lane 4, yeast RNA. DNA size markers are indicated in nucleotides on the left of both figures.

 
The identification of functional CRH-BP promoter sequences
The identification of transcription initiation sites within nucleotides -341 to +1 of the rat CRH-BP gene suggested that the 3.5-kb SacI fragment of the rat CRH-BP gene contained functional promoter sequences. Transfection experiments with CRH-BP-luciferase reporter constructs were used to determine the basal promoter activity within this fragment. The 3.5-kb SacI fragment was cloned into the promoterless luciferase vector [PXP2; (27)] in two orientations. The 3500BP-LUC construct contains the fragment in the 5'-3' orientation, whereas the 3500BPrev-LUC construct contains the fragment in the opposite orientation. As shown in Fig. 5AGo, significant luciferase activity (relative to the promoterless PXP2 vector) was detected after transient transfection with the 3500BP-LUC construct in Neuro-2a and NIE-115 (mouse neuroblastoma), {alpha}TSH, AtT-20 (anterior pituitary corticotrope), PC12, and COS-1 cells. In contrast, the 3500BPrev-LUC construct lacks promoter activity in these cells, consistent with the orientation dependence of basal promoter elements.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 5. Basal CRH-BP promoter activity in cultured mammalian cells. A, {alpha}TSH, Neuro-2a, NIE-115, AtT-20, PC12, and COS-1 cells were transfected with the luciferase reporter constructs 3500BP-LUC, 3500BPrev-LUC, or PXP2. Normalized luciferase activity is expressed as a fold-induction relative to PXP2. The data shown are the results of at least three experiments ± SEM. B, Rat CRH-BP promoter deletion constructs were transfected into COS-1, Neuro-2a, and {alpha}TSH cells. Normalized luciferase activities are expressed as in A. The data shown for COS-1, Neuro-2a, and {alpha}-TSH cells are the mean of 3–11 independent experiments ± SEM.

 
To further examine the nucleotide sequences that mediate CRH-BP basal promoter activity, several 5' deletions of the 3500BP-LUC construct were tested. The construct 631BP-LUC contains nucleotides -631 to +66, 341BP-LUC contains nucleotides -341 to +66, and 88BP-LUC contains nucleotides -88 to +66 of the rat CRH-BP gene fused to the luciferase cDNA (Fig. 5BGo). COS-1, Neuro-2a, and {alpha}TSH cells were transiently transfected with these constructs, as well as the 3500BP-Luc and PXP2 constructs. The results, shown in Fig. 5BGo, demonstrate that all constructs exhibit promoter activity in the cell lines tested, indicating that as little as 88 bp rat CRH-BP 5' flanking DNA is required to observe basal promoter activity.

Rat CRH-BP promoter activity is induced by cAMP and CRH
The identification of potential CREB/ATF and AP-2 binding sites in the rat CRH-BP promoter sequence suggested that promoter activity might be transcriptionally regulated by cAMP. As shown in Fig. 6AGo, COS-1 cells transfected with the 3500BP-CAT construct, containing 3500 bp rat CRH-BP 5' flanking DNA, and treated with forskolin/IBMX (For/I) for 6 or 24 h demonstrate 3.6 ± 0.7-fold (mean ± SEM) and 9.5 ± 1.3-fold inductions in promoter activity, respectively. Positive cAMP regulation of the 3500BP-CAT construct also was observed in other cell lines with Neuro-2a cells demonstrating the lowest induction (2-fold relative to control) and {alpha}TSH cells showing the highest induction with forskolin/IBMX. Differences in the levels of phosphodiesterases, adenylate cyclases, cAMP-dependent protein kinases, and transcription factors expressed in various cell lines may partly explain these different levels of cAMP-induced promoter activity.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 6. CRH-BP promoter activity is induced by cAMP and CRH. A, COS-1 cells were transiently transfected with the 3500BP-CAT construct and cultured in the absence (zero h) or presence of 10 µM forskolin/0.25 mM IBMX for 6 or 24 h before harvest. B, {alpha}TSH cells were cotransfected with 3500BP-CAT/CMVneo or 3500BP-CAT/CMV-CRH-R1 and cultured in the absence (Con) or presence of either 10 µM forskolin (For) or 20 nM ovine CRH (CRH) for 12 h before harvest. The inductions in CAT activity shown in A and B represent the induced CAT activity divided by the control CAT activity for each construct. The data represent the average of three or more experiments ± SEM. C, AtT-20 cells were transfected with 3500BP-CAT or the promoterless CAT construct (pGSVOCAT) using lipofectamine, as described in Materials and Methods. Transfected cells were cultured in the absence (Con) or presence of 20 nM CRH for 15 h before harvest. CAT activity is shown as percent conversion of 14C-chloramphenicol to acetylated products. The experiment was repeated multiple times with similar results; data shown are from a representative experiment.

 
Because CRH receptors are positively coupled to adenylate cyclase, the positive regulation of CRH-BP promoter activity by cyclic AMP suggested that CRH might affect CRH-BP transcription. To assay for CRH regulation of CRH-BP promoter activity, {alpha}TSH cells were transiently cotransfected with the 3500BP-CAT and CRH receptor expression (CMV-CRH-R1) constructs. Alternatively, cells were cotransfected with the 3500BP-CAT and CMVneo constructs as a negative control. As shown in Fig. 6BGo, a 12-h treatment of transfected {alpha}TSH cells with 10 µM forskolin (For) results in an 8-fold induction in CAT activity relative to control in the absence or presence of the CRH receptor. In contrast, a 12-h treatment of transfected {alpha}TSH cells with 20 nM oCRH results in increased activity of the 3500BP-CAT construct, relative to control levels, but only when the CRH receptor is coexpressed. These results demonstrate that CRH increases CRH-BP promoter activity in {alpha}TSH cells and that the increase is CRH receptor-dependent.

CRH regulation of CRH-BP promoter activity is also observed in AtT-20 cells that express endogenous CRH receptors. Transfection of AtT-20 cells with the 3500BP-CAT or promoterless CAT construct results in barely detectable levels of basal CAT activity. However, treatment of 3500BP-CAT-transfected cells with 20 nM oCRH for 15 h dramatically increases CAT activity. No increase in CAT activity is detected in cells transfected with the promoterless CAT construct. Together, these results demonstrate positive regulation of CRH-BP promoter activity by CRH in cells expressing endogenous or transfected CRH receptors.

Localization of 5' CRH-BP DNA sequences involved in cAMP and CRH regulation
To further define the nucleotide sequences in the CRH-BP 5' flanking region required for cAMP or CRH induction of this gene, two additional CRH-BP-CAT plasmids were constructed that contained either 341 (341BP-CAT) or 88 (88BP-CAT) bp 5' flanking DNA in addition to 66 bp 5' untranslated CRH-BP sequences. These plasmids were transfected into COS-1 and {alpha}TSH cells (cotransfected with CMV-CRH-R1), and CAT activity was determined after 24 h of treatment with For/I, For, or CRH. As shown in Fig. 7Go, cells transfected with the 341BP-CAT construct retain cAMP and CRH inducibility at levels similar to the 3500BP-CAT construct. However, deletion of CRH-BP promoter sequences to -88 bp (88BP-CAT) results in dramatic reductions in both cAMP (Fig. 7Go, A and B) and CRH inductions (Fig. 7BGo). These results suggest that the CRH-BP DNA sequences between -341 and -88 bp mediate, in large part, the cAMP and CRH regulation of CRH-BP promoter activity. However, small cAMP and CRH inductions remain in the 88BP-CAT transfections in {alpha}TSH cells, suggesting that additional sequences may contribute to the cAMP and CRH regulation in these cells.



View larger version (22K):
[in this window]
[in a new window]
  		Figure 7. Localization of 5' CRH-BP DNA sequences involved in cAMP and CRH regulation. A, COS-1 cells were transiently transfected with the 3500BP-CAT, 341BP-CAT, 341({Delta}CRE)BP-CAT, or 88BP-CAT constructs and cultured in the absence (Con) or presence of 10 µM forskolin/0.25 mM IBMX (For/I) for 24 h before harvest. B, {alpha}TSH cells were cotransfected with the 3500BP-CAT, 341BP-CAT, 341({Delta}CRE)BP-CAT, or 88BP-CAT constructs in addition to the CMV-CRH-R1 plasmid and cultured in the absence (Con) or presence of either 10 µM forskolin (For) or 20 nM ovine CRH for 24 h before harvest. The induction in CAT activity represents the induced CAT activity divided by the control CAT activity for each construct. The data represent the average of three or more experiments ± SEM.

 
The identification of potential CREB/ATF and AP-2 transcription factor-binding sites within this region suggested that these CRH-BP DNA sequences might be important for cAMP and/or CRH regulation. The potential cAMP response element (CRE) sequence CGTCA (-127 to -123 bp) is a truncated version of the palindromic consensus CRE sequence TGACGTCA, previously shown to be important in the cAMP regulation of many genes (36). However, the shortened CGTCA motif has been shown to play a role in cAMP regulation of the human GH gene (32). To determine the role of this potential transcription factor-binding site in CRH-BP promoter regulation, the CGTCA sequence in the CRH-BP 5' flanking DNA was mutated to CTCGA using site-directed mutagenesis to create 341({Delta}CRE)BP-CAT. This construct is identical to 341BP-CAT, except for the mutation of the putative CRE sequences. When this plasmid is transfected into COS-1 cells, the For/I-mediated induction in CAT activity decreases from 19-fold in 341BP-CAT-transfected cells to 1.2-fold in cells transfected with 341({Delta}CRE)BP-CAT. Similar decreases in forskolin- and CRH-mediated inductions are observed upon transfection of the 341({Delta}CRE)BP-CAT into {alpha}TSH cells cotransfected with the CRH receptor. The small cAMP and CRH inductions remaining in {alpha}TSH cells after mutation of the CRE sequence are comparable with the inductions in the 88BP-CAT construct. These results demonstrate that the CRE-like DNA sequence at -127 to -123 bp in the CRH-BP promoter mediates, in large part, the cAMP and CRH inducibility of the CRH-BP promoter in transfected COS-1 and {alpha}TSH cells.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
To further define the molecular mechanisms regulating CRH-BP gene expression, the rat CRH-BP gene was isolated and characterized. Southern blot analysis of rat genomic DNA with a 187-bp CRH-BP cDNA-specific probe demonstrates a single hybridization-positive fragment with each restriction endonuclease, providing evidence for a single CRH-BP gene in the rat genome. Restriction endonuclease mapping and nucleotide sequence analysis of the isolated rat genomic clones demonstrate that the rat CRH-BP gene contains seven exons and six introns, similar to the human CRH-BP gene. The nucleotide sequences of the protein-encoding exons are highly homologous in the human and rat CRH-BP genes, and all the exon/intron boundaries have been conserved. In addition, the first 215 bp of the 5' flanking DNA also are highly homologous (>85%) between the rat and human genes, suggesting that important transcriptional control elements have been conserved through evolution to maintain the regulation of the CRH-BP gene.

To define a potential rat CRH-BP promoter sequence, transcription initiation sites in the rat CRH-BP gene were identified (Fig. 4Go). RNase protection assays revealed that CRH-BP transcripts initiate at multiple sites in rat cerebral cortex, including a major initiation site. The major CRH-BP initiation site in rat cerebral cortex corresponds to the previously mapped human liver CRH-BP CAP site (23) and is located 31 nucleotides 3' to a conserved TATA sequence (-31 to -25; Fig. 3Go). The identification of multiple upstream initiation sites is consistent with the isolation of rat and mouse brain CRH-BP cDNAs with 5' ends that extend beyond the 5' end of the human liver CRH-BP cDNA (7, 8). The number and pattern of transcription initiation sites were similar in rat cerebral cortex and pituitary, indicating that the mechanisms controlling basal CRH-BP gene transcription are similar in these tissues. The DNA sequences controlling transcription initiation at upstream sites may include the TATA sequence at -221 and Sp1 sites at -147 and -169 (37). The presence of multiple sites of transcription initiation of the CRH-BP gene in rat brain and pituitary, but not in human liver, may be explained partly by the differences in the 5' flanking DNA of the rat and human CRH-BP genes. Alternatively, multiple transcription initiation sites also may exist for the CRH-BP gene expressed in human brain and pituitary, suggesting that the different transcription initiation sites may be tissue-specific.

The identification of CRH-BP transcription initiation sites suggested that the 3.5-kb SacI fragment of the rat CRH-BP gene would contain functional promoter activity. Transfection experiments with the 3500BP-LUC construct in cultured mammalian cells demonstrated basal CRH-BP promoter activity in a variety of different cell types, including neuroblastoma (Neuro-2a and NIE-115), anterior pituitary corticotrope (AtT-20), anterior pituitary thyrotrope ({alpha}TSH), adrenal (PC12), and kidney (COS-1) cells. Analysis of deletion mutants of the 3500BP-LUC construct indicates that nucleotides -341 to +66 of the rat CRH-BP gene contain promoter activity equivalent to nucleotides -3500 to +66 in Neuro-2a and COS-1 cells. Removal of nucleotides -341 to -88, which deletes transcription initiation sites 5' of the 160 marker in Fig. 4BGo, results in decreased promoter activity in COS-1, Neuro-2a, and {alpha}TSH cells (Fig. 5BGo). These results suggest that nucleotide sequences between -341 to -88 may play a role in directing basal transcription of the rat CRH-BP gene, in addition to the basal promoter activity contained within nucleotides -88 to +1.

Several neuronal and neuroendocrine cell lines were selected for transfection experiments because rat CRH-BP mRNA is expressed in brain and pituitary. To determine whether these cell lines express endogenous CRH-BP mRNA, Northern blot analysis was performed with 20–50 µg total RNA. CRH-BP mRNA was not detected in any cell line. However, RT-PCR and RNase protection (with 50–100 µg total RNA) experiments indicate that Neuro-2a, NIE-115, AtT20, and PC12 cells express endogenous CRH-BP mRNA at very low levels. Although CRH-BP mRNA was not detected in COS-1 cells by Northern blot, more sensitive analysis of COS-1 RNA by RT-PCR and RNase protection was not possible because the monkey CRH-BP cDNA has not been isolated. Although CRH-BP mRNA is expressed at very low, basal levels in a variety of neuronal and neuroendocrine cell lines, the tissue- and cell-specific expression of CRH-BP in vivo may require DNA elements not included in the CRH-BP promoter constructs and/or cell-specific transcription factors.

The presence of potential CREB/ATF and AP-2 transcription factor-binding sites in the 5' flanking DNA suggested that CRH-BP gene transcription might be regulated by cAMP. This hypothesis was supported by the finding that rat CRH-BP promoter activity from the 3500BP-CAT construct was induced by forskolin or forskolin/IBMX treatment in multiple cell lines. Similar results were observed with the 341BP-CAT construct, whereas the 88BP-CAT construct exhibited dramatically reduced inductions in CRH-BP-CAT activity after forskolin ({alpha}TSH) or forskolin/IBMX (COS-1) treatment. These results indicated that the DNA sequences between nucleotides -341 to -88 of the rat CRH-BP promoter, including potential CRE and AP-2 sites, were required for transcriptional regulation by cAMP. Mutation of the putative CRE sequence (CGTCA) at -127 bp decreased cAMP-mediated inductions in COS and {alpha}TSH cells to the levels observed with the 88BP-CAT construct, demonstrating the important role of the CGTCA sequence in the cAMP regulation of CRH-BP promoter activity. These results suggest that the CREB/ATF family of transcription factors that binds to CRE sequences may be important mediators of the cAMP regulation of CRH-BP promoter activity.

The demonstration of positive cAMP regulation of CRH-BP promoter activity is consistent with a recent study showing positive forskolin/IBMX regulation of steady-state CRH-BP mRNA levels in primary cultured rat neurons and astrocytes (22). Our results suggest that the induction of steady-state CRH-BP mRNA levels by cAMP in these cells may be mediated, at least in part, by positive regulation of CRH-BP gene transcription.

The demonstration of positive cAMP regulation of CRH-BP promoter activity also raised the possibility that CRH-BP gene transcription might be regulated by CRH, via the Gs-coupled CRH receptor, in cells that express both CRH-BP and CRH receptor, such as anterior pituitary corticotropes. AtT-20 cells, which serve as an excellent model for anterior pituitary corticotropes in culture, were transfected with the 3500BP-CAT construct to study the CRH regulation of CRH-BP promoter activity. Although the basal expression of CRH-BP-CAT constructs in these cells is very low because of poor transfection efficiency, treatment of the transfected cells with CRH resulted in increased CRH-BP promoter activity. This result demonstrates that CRH can positively regulate CRH-BP promoter activity in AtT-20 cells via endogenous CRH receptors. To further characterize the regulation by CRH, {alpha}TSH (anterior pituitary thyrotrope-like) cells were transiently cotransfected with a CRH-R1 expression construct (CMV-CRH-R1) and the 3500BP-CAT or 341BP-CAT constructs. CRH treatment of the transfected {alpha}TSH cells resulted in increased CRH-BP promoter activity, consistent with the hypothesis that CRH-BP transcription is positively regulated by CRH receptor activation. Mutation of the CRE sequence (341({Delta}CRE)BP-CAT) or deletion of promoter sequences to -88 bp (88BP-CAT) dramatically reduced the CRH induction, suggesting that the CGTCA sequence is important for CRH regulation of CRH-BP promoter activity. The observation that CRH mediates positive regulation of CRH-BP-reporter activity via CRH receptors suggests that CRH-BP expression may be increased in CRH target cells after exposure to CRH. For example, increased hypothalamic CRH secretion in response to stress may activate CRH-BP gene transcription in corticotropes. In light of the ability of CRH-BP to attenuate CRH activity in vitro and in vivo (7, 8, 10, 14), these results further support the hypothesis that the CRH-BP may play an important role as a negative regulator of CRH activity.

Transcription of the POMC gene, which is also expressed in anterior pituitary corticotropes, is positively regulated by CRH. Although the mechanisms and transcription factors that mediate this response are not completely characterized, CRH regulation of the POMC promoter is mediated, in part, by AP-1 transcription factors cFos and cJun via a conserved AP-1 site in exon 1 (38). CRH regulation of the POMC promoter is also mediated by other, AP-1-independent pathways, possibly through the actions of the transcription factor AP-2 or the CRH-responsive element-binding protein (39, 40). The CRH-BP promoter, like POMC, contains consensus binding sites for AP-1 and AP-2 transcription factors. However, unlike POMC, the CRH-BP promoter contains a CRE-like site (-127 bp), suggesting that the mechanisms of CRH-BP transcriptional regulation by CRH may be distinct from POMC. In fact, our results suggest that the sequences from -341 to -88 bp, including the CGTCA sequence at -127 bp, are required for maximal CRH- and cAMP-mediated regulation of promoter activity in COS-1 and {alpha}-TSH cells. Future studies in AtT-20 cells will further address the role of the different transcription factor-binding sites in cAMP and CRH regulation of CRH-BP-reporter expression in cells expressing endogenous CRH receptors. Finally, it should be noted that CRH receptor mRNA levels also are regulated by CRH but in an opposite fashion to POMC and CRH-BP. Pozzoli and colleagues (41) have demonstrated that CRH negatively regulates CRH receptor steady-state mRNA levels in rat anterior pituitary cell cultures. However, the molecular mechanisms involved in CRH regulation of CRH receptor gene expression have not yet been determined.

In this study, we have characterized the structural organization and nucleotide sequence of the CRH-BP gene. Mapping of the 5' ends of rat CRH-BP transcripts in brain and pituitary demonstrates that transcription initiation occurs at multiple sites, in contrast to the single initiation site observed in human liver, suggesting that the regulation of CRH-BP transcription initiation is tissue- and/or species-specific. These experiments also provide the first description of CRH-BP promoter activity in cultured cells and demonstrate that CRH-BP promoter activity is induced by cAMP and CRH. Both the cAMP and CRH regulation seem to be mediated by nucleotide sequences between -341 and -88 bp in the CRH-BP 5' flanking DNA, in large part, via the CREB/ATF transcription factor-binding site (CGTCA) localized at -127 bp. Further characterization of the signaling mechanisms that regulate CRH-BP promoter activity and gene expression will help to elucidate the role of CRH-BP in modulating CRH activity in the brain and pituitary.


   Acknowledgments
 
The authors would like to thank Linda Gates, Frank Bourbonais, and Jennifer Shin for expert technical assistance. We also would like to thank Dr. Michael D. Uhler and Dr. Robert C. Thompson (University of Michigan Reproductive Sciences Molecular Biology Core) for helpful assistance and discussions.


   Footnotes
 
1 This work was supported by NIH Grant DK-42730 (to A.F.S.) and NIH Genetics Training Grant T32-GM-07544 (to D.N.C.). The rat CRH-BP gene sequence has been submitted to GenBank. Back

Received August 30, 1996.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Owens M, Nemeroff C 1991 Physiology and pharmacology of corticotropin-releasing factor. Pharmacol Rev 43:425–473[Medline]
  2. Crofford LJ, Sano H, Karalis K, Webster EL, Goldmuntz EA, Chrousos GP, Wilder RL 1992 Local secretion of corticotropin-releasing hormone in the joints of Lewis rat with inflammatory arthritis. J Clin Invest 90:2555–2564
  3. Crofford LJ, Sano H, Karalis K, Friedman TC, Epps HR, Remmers EF, Mathern P, Chrousos GP, Wilder RL 1993 Corticotropin-releasing hormone in synovial fluids and tissues of patients with rheumatoid arthritis and osteoarthritis. J Immunol 151:1587–1596[Abstract]
  4. Keegan CE, Herman JP, Karolyi IJ, O’Shea KS, Camper SA, Seasholtz AF 1994 Differential expression of corticotropin-releasing hormone in developing mouse embryos and adult brain. Endocrinology 134:2547–2555[Abstract]
  5. Muglia LJ, Jacobson L, Dikkes P, Majzoub JA 1995 Corticotropin-releasing hormone deficiency reveals major fetal but not adult glucocorticoid need. Nature 373:427–432[CrossRef][Medline]
  6. Orth DN, Mount CD 1987 Specific high-affinity binding protein for human corticotropin-releasing hormone in normal human plasma. Biochem Biophys Res Commun 143:411–417[CrossRef][Medline]
  7. Potter E, Behan DP, Fischer WH, Linton EA, Lowry PJ, Vale WW 1991 Cloning and characterization of the cDNAs for human and rat corticotropin releasing factor-binding proteins. Nature 349:423–426[CrossRef][Medline]
  8. Cortright DN, Nicoletti A, Seasholtz AF 1995 Molecular and biochemical characterization of the mouse brain CRH-binding protein. Mol Cell Endocrinol 111:147–157[CrossRef][Medline]
  9. Perrin MH, Donaldson CJ, Chen R, Lewis KA, Vale WW1993 Cloning and functional expression of a rat corticotropin releasing factor (CRF) receptor. Endocrinology 133:3058–3061
  10. Linton E, Behan DP, Saphier PW, Lowry PJ 1990 Corticotropin-releasing hormone (CRH)-binding protein: reduction in the adrenocorticotropin-releasing activity of placental but not hypothalamic CRH. J Clin Endocrinol Metab 70:1574–1580[Abstract]
  11. Potter E, Behan DP, Liton EA, Lowry PJ, Sawchenko PE, Vale WW 1992 The central distribution of a corticotropin-releasing factor(CRF)-binding protein predicts multiple sites and modes of interaction with CRF. Proc Natl Acad Sci USA 89:4192–4196[Abstract/Free Full Text]
  12. Potter E, Sutton S, Donaldson C, Chen R, Perrin M, Lewis K, Sawchenko PE, Vale W 1994 Distribution of corticotropin-releasing factor receptor mRNA expression in the rat brain and pituitary. Proc Natl Acad Sci USA 91:8777–8781[Abstract/Free Full Text]
  13. Vaughn J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, Rivier J, Sawchenko PE, Vale W 1995 Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378:287–292[CrossRef][Medline]
  14. Behan DP, Heinrichs SC, Troncoso JC, Liu X-J, Kawas CH, Ling N, De Souza EB 1995 Displacement of corticotropin releasing factor from its binding protein as a possible treatment for Alzheimer’s disease. Nature 378:284–287[CrossRef][Medline]
  15. Behan DP, De Souza EB, Lowry PJ, Potter E, Sawchenko P, Vale WW 1995 Corticotropin releasing factor (CRF) binding protein: a novel regulator of CRF and related peptides. Front Neuroendocrinol 16:362–382[CrossRef][Medline]
  16. Britton KT, Lee G, Vale W, Rivier J, Koob G 1986 Corticotropin releasing factor (CRF) receptor antagonist blocks activating and ’anxiongenic’ actions of CRF in the rat. Brain Res 369:303–306[CrossRef][Medline]
  17. Menzaghi F, Howard RL, Heinrichs SC, Vale W, Rivier J, Koob GF 1994 Characterization of a novel and potent corticotropin-releasing factor antagonist in rats. J Pharmacol Exp Ther 269:564–572[Abstract/Free Full Text]
  18. Behan DP, DeSouza EB, Potter E, Sawchenko P, Lowry PJ, Vale WW 1996 Modulatory actions of corticotropin-releasing factor-binding protein. Ann NY Acad Sci 780:81–95
  19. Petraglia F, Potter E, Cameron VA, Sutton S, Behan DP, Woods RJ, Sawchenko PE, Lowry PJ, Vale W 1993 Corticotropin-releasing factor-binding protein is produced by human placenta and intrauterine tissues. J Clin Endocrinol Metab 77:919–924[Abstract]
  20. Suda T, Iwashita M, Tozawa F, Ushiyama T, Tomori N, Sumitomo T, Nakagami Y, Demura H, Shizume K 1988 Characterization of corticotropin-releasing hormone binding protein in human plasma by chemical cross-linking and its binding during pregnancy. J Clin Endocrinol Metab 67:1278–1283[Abstract]
  21. Linton EA, Perkins AV, Woods RJ, Eben F, Wolfe CDA, Behan D, Potter E, Vale WW, Lowry PJ 1993 Corticotropin-releasing hormone-binding protein (CRH-BP): plasma levels decrease during the third trimester of normal human pregnancy. J Clin Endocrinol Metab 76:260–262[Abstract]
  22. Behan DP, Maciejewski D, Chalmers D, De Souza EB 1995 Corticotropin releasing factor binding protein (CRF-BP) is expressed in neuronal and astrocytic cells. Brain Res 698:259–264[CrossRef][Medline]
  23. Behan DP, Potter E, Lewis KA, Jenkins NA, Copeland N, Lowry PJ, Vale WW 1993 Cloning and structure of the human corticotrophin releasing factor-binding protein gene (CRHBP). Genomics 16:63–68[CrossRef][Medline]
  24. Chomczynski P, Sacchi N 1987 Single-step isolation of RNA by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  25. Stallard B, Collard M, Griswold M 1991 A transferrinlike (hemiferrin) mRNA is expressed in the germ cells of rat testis. Mol Cell Biol 11:1448–1453[Abstract/Free Full Text]
  26. Akerblom IE, Ridgway EC, Mellon PL 1990 An {alpha}-subunit-secreting cell line derived from a mouse thyrotrope tumor. Mol Endocrinol 4:589–596[Abstract]
  27. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–457[Medline]
  28. Seasholtz AF, Thompson RC, Douglass JO 1988 Identification of a cyclic adenosine monophosphate-responsive element in the rat corticotropin-releasing hormone gene. Mol Endocrinol 2:1311–1319[Abstract]
  29. Edlund T, Walker MD, Barr PJ, Rutter WJ 1983 Cell specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements. Science 221:551–553
  30. Youngblood GL, Payne AH 1992 Isolation and characterization of the mouse P450 17alpha-hydroxylase/C17–20-lyase gene (cyp17): transcriptional regulation of the gene by cyclic adenosine 3'-5'-monophosphate in MA-10 Leydig cells. Mol Endocrinol 6:927–934[Abstract]
  31. Vita N, Laurent P, Lefort S, Chalon P, Lelias J-M, Kaghad M, Le Fur G, Caput D, Ferrara P 1993 Primary structure and functional expression of mouse pituitary and human brain corticotropin releasing factor receptors. FEBS Lett 335:1–5[CrossRef][Medline]
  32. Shepard AR, Zhang W, Eberhardt NL 1994 Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells. J Biol Chem 269:1804–1814[Abstract/Free Full Text]
  33. Mao CA, Gan L, Klein HW 1994 Multiple Otx binding sites required for expression of the Strongylocentrotus purpuratus Spec2a gene. Dev Biol 165:229–242[CrossRef][Medline]
  34. Imagawa M, Chiu R, Karin M 1987 Transcription factor AP-2 mediates induction by two different signal transduction pathways: protein kinase C and cAMP. Cell 51:251–260[CrossRef][Medline]
  35. Faisst S, Meyer S 1992 Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20:3–26[Free Full Text]
  36. Montminy M, Gonzalez GA, Yamamoto KK 1990 Regulation of cAMP-inducible genes by CREB. Trends Neurosci 13:184–188[CrossRef][Medline]
  37. Ye K, Dinarello CA, Clark BD 1993 Identification of the promoter region of human interleukin 1 type I receptor gene: multiple initiation sites, high G+C content, and constitutive expression. Proc Natl Acad Sci USA 90:2295–2299[Abstract/Free Full Text]
  38. Boutillier AL, Monnier D, Lorang D, Landblad JR, Roberts JL, Loeffler JP 1995 Corticotropin-releasing hormone stimulates proopiomelanocortin transcription by cFos-dependent and -independent pathways: characterization on an AP1 site in Exon 1. Mol Endocrinol 9:745–755[Abstract]
  39. Bishop JF, Mouradian MM 1993 Characterization of a corticotropin-releasing hormone responsive region in the murine proopiomelanocortin gene. Mol Cell Endocrinol 97:165–171[CrossRef][Medline]
  40. Jin WD, Boutillier AL, Glucksman MJ, Salton SRJ, Loeffler JP, Roberts JL 1994 Characterization of a CRH-responsive element in the rat POMC gene promoter and molecular cloning of its binding protein. Mol Endocrinol 8:1377–1388[Abstract]
  41. Pozzoli G, Bilezikjian LM, Perrin MH, Blount AL, Vale WW 1996 Corticotropin-releasing factor (CRF) and glucocorticoids modulate the expression of type I CRF receptor messenger RNA in rat anterior pituitary cell cultures. Endocrinology 137:65–71[Abstract]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
N. J. Westphal and A. F. Seasholtz
Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
A. van de Stolpe, A. J. Slycke, M. O. Reinders, A. W. M. Zomer, S. Goodenough, C. Behl, A. F. Seasholtz, and P. T. van der Saag
Estrogen Receptor (ER)-Mediated Transcriptional Regulation of the Human Corticotropin-Releasing Hormone-Binding Protein Promoter: Differential Effects of ER{alpha} and ER{beta}
Mol. Endocrinol., December 1, 2004; 18(12): 2908 - 2923.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. A. Nanda, P. H. Roseboom, G. A. Nash, J. M. Speers, and N. H. Kalin
Characterization of the Human Corticotropin-Releasing Factor2(a) Receptor Promoter: Regulation by Glucocorticoids and the Cyclic Adenosine 5'-Monophosphate Pathway
Endocrinology, December 1, 2004; 145(12): 5605 - 5615.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. E. Levine
Editorial: Stressing the Importance of Sex
Endocrinology, December 1, 2002; 143(12): 4502 - 4504.
[Full Text] [PDF]

Home page
 EndocrinologyHome page
D. B. Speert, S. J. MCClennen, and A. F. Seasholtz
Sexually Dimorphic Expression of Corticotropin-Releasing Hormone-Binding Protein in the Mouse Pituitary
Endocrinology, December 1, 2002; 143(12): 4730 - 4741.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Timofeeva, Y. Deshaies, F. Picard, and D. Richard
Corticotropin-releasing hormone-binding protein in brain and pituitary of food-deprived obese (fa/fa) Zucker rats
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 1999; 277(6): R1749 - R1759.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. J. McClennen and A. F. Seasholtz
Transcriptional Regulation of Corticotropin-Releasing Hormone-Binding Protein Gene Expression in Astrocyte Cultures
Endocrinology, September 1, 1999; 140(9): 4095 - 4103.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
S. J. McClennen, D. N. Cortright, and A. F. Seasholtz
Regulation of Pituitary Corticotropin-Releasing Hormone-Binding Protein Messenger Ribonucleic Acid Levels by Restraint Stress and Adrenalectomy
Endocrinology, November 1, 1998; 139(1