| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Medical Research Council Reproductive Biology Unit, Centre for Reproductive Biology, Edinburgh, EH3 9EW, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ligand-induced receptor activation involves a complex series of both temporal and spatial events. Whereas it is evident that ligand binding acts as the initial trigger, the events that follow (i.e. signal propagation through the cell membrane and the activation of the G protein second messenger system) remain largely unknown; however, it is currently thought that changes in receptor configuration play a vital role in signal transduction processes. To further understand the mechanisms underlying such structural changes, it is important to elucidate the primary determinants of tertiary receptor structure both in the absence and the presence of the ligand (resting vs. active receptor state). One key feature exhibited by many GPCRs is the presence of a pair of conserved Cys residues in the extracellular domain and it is thought that these Cys residues are covalently linked to form a disulfide bridge structure (12, 13). Disulfide bond formation between extracellular Cys residues, creates an internal scaffold within the receptor structure, thereby determining its three-dimensional conformation and enhancing receptor stability. Many GPCRs also contain additional, nonconserved, extracellular Cys residues and in some instances the formation of multiple disulfide bonds has been shown to influence tertiary receptor structure and receptor stability (14, 15).
The GnRH-R contains four extracellular Cys residues, and of these, two are conserved within the family of GPCRs. Therefore, it is feasible that intramolecular disulfide bonding interactions might occur between both conserved and nonconserved extracellular Cys residues. The ß-adrenergic receptor like the GnRH-R contains four extracellular Cys residues, and studies by Dohlman et al. 1990 (14) and Noda et al. 1994 (15) have shown the formation of two disulfide bonds within this receptor, paradoxically each bond existing between a conserved and nonconserved residue. The presence of an additional disulfide bond probably acts to further stabilize the extracellular portion of the receptor to aid the passage of the catecholamine into the receptor pore. In the rat GnRH-R, the conserved extracellular Cys residues are located at positions Cys114 and Cys195 in first extracellular loop (EL1) and the second extracellular loop (EL2) respectively and the nonconserved Cys residues are located at Cys14 in the amino terminus and Cys199 in EL2 (3). To establish if all extracellular Cys residues (conserved and nonconserved) are involved in disulfide bridge formation, individual Cys residues were mutated using site-directed mutagenesis. The choice of the substituting amino acid in these experiments is critical, as other mutagenesis experiments in GPCRs have shown that substitution of Cys with the hydrophilic Ser may affect receptor conformation and receptor expression levels (16). Recent studies on rhodopsin have addressed this problem by substituting Cys with the more nonpolar Ala residue that did not appear to have such a deleterious effect on levels of expression, posttranslational modification and retinal binding (17). In this study, Ala residues have been introduced into the GnRH-R at the site normally occupied by extracellular Cys residues. In addition, we have examined the effects of the reducing agent DTT on these mutants to further elucidate the relationship between disulfide bond formation and ligand-receptor interactions. Furthermore, an epitope tag has been incorporated into the receptor constructs to allow us to monitor levels of expression of both mutant and WT GnRH-Rs at the cell surface.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Hemagglutinin (HA) epitope tagging of the GnRH-R
wild-type
The GnRH-R, a 2.2-kb clone, was isolated from a size-selected
ZAPII rat anterior pituitary complementary DNA (cDNA) library (3)
and subcloned into the eukaryotic expression vector pcDNA-3
(Invitrogen, Leek, Netherlands). A double-stranded DNA oligonucleotide
fragment (5'
TATCCATATGATGTTCCAGATTATGCTTATCCATATGATGTT-CCAGATTATGCTTATCCATATGATGTTCCAGATTATGCT
3' 5'
AGCATAATCTGGAACATCATATGGATAAGCATAATCTGGAACATC-ATATGGATAAGCATAATCTGGAACATCATATGGATA
3') was ligated in frame into the region of the GnRH-R cDNA
encoding the amino terminal domain. The sequence of the triple
HA-tagged GnRH-R WT was confirmed using an Applied Biosystems
(Cheshire, UK) 373A automated DNA sequencer.
Site-directed mutagenesis
The epitope tagged WT cDNA was subjected to oligonucleotide
directed mutagenesis (18) where mutations were used to replace the Cys
codons (TGC/T) at positions 14, 114, 195, and 199 with Ala (GCC/T),
generating the constructs Cys14Ala, Cys114Ala, Cys195Ala, and
Cys199Ala. Sequencing of the cDNA clones was carried out several times
in both orientations and analysis was performed by means of the program
GeneJockey II (Biosoft, Cambridge, UK).
Cell culture and receptor expression
COS-1 cells used for transient transfection were routinely
maintained in DMEM containing glutamine (0.3 mg/ml), penicillin (100
IU/ml), streptomycin (100 µg/ml) and 10% heat-inactivated FCS
(HIFCS). Monolayer cultures of COS-1 cells in 75 cm2
culture flasks were transiently transfected with GnRH-R WT and mutant
cDNA (10 µg), using the DEAE dextran method (Promega, Madison,
WI).
Total inositol phosphate (IP) assays
After transfection (24 h) cells were trypsinized, transferred to
24-well plates, labeled with 3[H]myo-inositol (1.0
µCi/well, Amersham, Buckinghamshire, UK) in inositol free DMEM
containing 1% vol/vol dialyzed HIFCS, glutamine (0.3 mg/ml),
penicillin (100 IU/ml) and streptomycin (100 µg/ml) and incubated for
a further 24 h. COS-1 cells were washed with 1 mg/ml fatty acid
free BSA, 140 mM NaCl, 20 mM HEPES, 4
mM KCl, 8 mM D-glucose, 1
mM MgCl2, and 1 mM
CaCl2, pH 7.2 and incubated for 20 min in 20 mM
LiCl, before peptide stimulation. Total IPs were extracted with 2.5%
PCA/5 mM EDTA/phytic acid (1.8 mg/ml) solution and
separated using Ag 1-X8 anion exchange resin (Bio-Rad, Herts, UK).
Total counts were measured by solubilizing the cells from the plates
using 0.1 M NaOH and neutralizing with 0.66% acetic acid
before counting. Total IP production is expressed as dpm/100,000 total
counts.
Receptor binding assays
Cell membranes were prepared 48 h post transfection.
Membranes were resuspended in assay buffer (40 mM Tris-HCl,
2 mM MgCl2, pH 7.2), and 50 µg total protein
added per tube. Saturation binding assays were performed with an
iodinated radiolabeled GnRH agonist (GnRH-A),
125I-des-Gly10,[D]-Trp6]-GnRH
(over a concentration range 0.25 nM to 5 nM),
prepared using the glucose oxidase/lactoperoxidase method, and purified
by chromatography on a Sephadex G-25 column in 0.01 M
acetic acid/0.1% BSA (19). The specific activity of the
125I-GnRH-A tracer ranged from 20–75 µCi/µg and was
calculated from self-displacement assays using either rat pituitary
homogenates or COS-1 cells transiently transfected with the WT GnRH-R
cDNA. Assays were incubated for 2 h at 4 C before filtration
through a cell harvester using Whatman GFB filter paper. Receptor
dissociation constant (Kd) and receptor number
(Bmax) were calculated using a hyperbolic function fit on
the Macintosh version of Sigma Plot (Jandel Scientific). All assay
points were in duplicate/triplicate and experiments were performed on
at least three independent occasions.
Protein assays
Protein assays were carried out in 96-well microtitre plates
using BSA protein standards (Bio-Rad, Herts, UK) diluted to
concentrations of 7 µg/ml, 14 µg/ml, 21 µg/ml, 35 µg/ml, 70
µg/ml, 105 µg/ml, and 140 µg/ml for standard curve measurements.
The samples were diluted in sterile water and 50 µl of standard or
sample added in triplicate into the individual wells of the microtitre
plates. In addition, 150 µl of water, 100 µl of 0.2 M
NaOH, and 50 µl of Farbstoff-Konzentrat dye reagent (Bio-Rad, Herts,
UK) were also added. The plates were mixed for 20 min, the color
absorbance measured at 620 nm, and the total protein concentration per
sample calculated.
ELISA detection
COS-1-cells in 60-mm plates were transfected with various
concentrations of WT GnRH-R cDNA (0–10 µg) for standard curve
measurements. In addition, COS-1 cells were transfected with either 3
µg of WT cDNA (positive control), mutant receptor cDNA or pcDNA3
vector only (negative control). Twenty-four hours later, cells were
trypsinized, then transferred into 96-well plates (50,000 cells/well)
and after a further 24 h fixed using 4% paraformaldehyde in PBS
(30 min at room temperature). After fixation, the cells were washed
(x3) with PBS, the nonspecific binding sites blocked with DMEM
containing 10% HIFCS, and the primary mouse monoclonal anti-HA
antibody 12CA5 (Boehringer Mannheim, Germany) added at 1:500 dilution
in DMEM. This anti-HA antibody recognizes the HA peptide sequence
(YPYDVPDYA) derived from the human influenza hemagglutinin protein.
Cells were incubated with the anti-HA antibody overnight at 4 C,
subsequently washed with PBS (x3) and then further incubated with a
1:2000 dilution of a peroxidase conjugated goat/sheep antimouse IgG
(Sigma) in DMEM for 1 h at 37 C. The final substrate (200 µl), 5
mM O-phenylenediamine/0.03% H2O2
in 0.1 M citrate/phosphate buffer (pH 5.0), was added in a
light-excluded environment for 30 min at room temperature and the
enzymatic reaction stopped with 50 µl of 2 N
H2SO4 solution. An orange color reaction was
produced when the substrate reacted with the peroxidase enzyme
conjugated on the second antibody and the color density of each well
measured using a Labsystems Multiscan MCC/340 reader at 495 nm
wavelength.
Statistical analysis
Statistical analysis was performed using t tests. A
P value of P < 0.05 was considered as
significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is a sequence alignment of the
extracellular regions of the GnRH-R in different species isolated to
date. The position of conserved extracellular Cys residues in the GPCR
superfamily are highlighted with asterisks and constitute Cys114 in EL1
and Cys195 in EL2 in the rat GnRH-R. The position of nonconserved
extracellular Cys residues are also shown, and in the rat GnRH-R, these
are present at Cys14 in the amino terminus and Cys199 in EL2. Four
extracellular Cys residues can also been found in analogous positions
in the mouse, human, sheep, and cow GnRH-R amino acid sequences.
However, the porcine GnRH-R only possesses three extracellular Cys
residues, lacking the nonconserved Cys in the EL2 region.
|
, Fig. 2). In contrast, the receptor
affinity of GnRH-R mutant Cys14Ala was significantly reduced
(P < 0.05) compared with GnRH-R WT; however, the
apparent decrease in receptor number was not significant (Table 1, Fig. 2). GnRH-R mutants Cys114Ala and Cys195Ala (mutations of the conserved
extracellular Cys residues) showed no radiolabeled GnRH-A binding when
expressed in COS-1 cells (Table 1, Fig. 2).
|
|
). Although labeled GnRH-A
specific binding to mutants Cys14Ala and Cys199Ala were lower than that
for the GnRH-R WT control (16.1 ± 0.8 and 37.2 ± 1.7%,
respectively), a significant reduction (P < 0.05) in
binding in the presence of DTT (8.1 ± 1.2% and 15.4 ±
4.0%, respectively) was observed (Fig. 3). In the mutants, Cys114Ala
and Cys195Ala, the levels of binding were undetectable either in the
absence or presence of DTT.
|
). COS-1 cells transfected with GnRH-R mutants
Cys14Ala and Cys199Ala also showed a dose-dependent production of total
IP after GnRH challenge; however, the ED50 values were
lower than those observed in the WT control (see Table 1
). In contrast,
GnRH-R mutants Cys114Ala and Cys195Ala were unable to respond above
basal levels to GnRH stimulation.
|
) and the
GnRH ligand binding capacity of membrane preparations from the same
transfect (Fig. 5b). Results indicate that increasing the concentration
of GnRH-R cDNA in the transfection procedure leads to a significant
increase in the optical density readings at DNA transfection levels
above 0.5 µg DNA. A concentration-dependent effect can be seen with
increasing amounts of DNA up to a maximal response at 3 µg of DNA.
Further increasing the DNA in the transfection procedure results in an
inhibition from the maximal optical density readings observed at 3 µg
DNA. A similar profile was observed on measuring the ligand binding
capacity of cell membranes prepared from the same transfected COS-1
cells; however, the inhibition in receptor binding of the cells
transfected with higher concentrations of DNA (5 µg and 10 µg) was
more pronounced (Fig. 5b). ELISA detection of mutant receptor levels
revealed that all the mutants were expressed at a high level in the
plasma membrane ranging from 68–92% of the GnRH-R WT level (Table 2), thus indicating the deficiency in receptor binding
displayed by these mutations was due to changes in disulfide bond
formation and was not caused by a decrease in cell surface receptor
expression (Table 2).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several lines of evidence have lead us to conclude that extracellular GnRH-R Cys residues are involved in disulfide bridge formation: 1) in other GPCRs, conserved Cys residues have been implicated in disulfide bond formation (14, 16, 17, 20, 21, 22, 23); and 2) earlier studies by Keinan et al., 1985 (24), measuring the specific binding of iodinated Buserelin in rat pituitary homogenates, revealed a decrease in specific binding of Buserelin with increasing concentrations of DTT. Our study using transfected cells expressing the GnRH-R have also shown that the addition of DTT results in a decrease in specific binding. Together, these results indicate that disulfide bonds are likely to exist within the GnRH-R to permit chemical alteration of the receptor structure and hence its function, although they do not allude to the precise nature of disulfide bonding patterns between the individual Cys residues. To identify which specific amino acids participate in disulfide bonding, it was necessary to individually alter the structure of the GnRH-R at the position of the four extracellular Cys residues. Site-directed mutagenesis results revealed that substitution of the conserved Cys residues (Cys114 and Cys195) to Ala abolished receptor binding and ligand-induced second messenger function. However, these mutations retained sufficient levels of receptor expression at the level of the membrane, dispelling any theory that the loss of receptor binding was due to an impairment of cell surface receptor expression. In contrast, the GnRH-R mutants Cys14Ala and Cys199Ala maintained ligand binding and ligand-induced functional activity. Of these two mutations, Cys199Ala displayed functional characteristics similar to that of the WT receptor with a comparable receptor affinity and receptor number. The effects of substitution of Cys14 to Ala were, however, more pronounced, with both receptor affinity and ligand-induced total IP production significantly reduced compared with the WT, although receptor expression was maintained at a level similar to WT. This result was unexpected, and we can only speculate as to why this mutation had a significant effect on receptor function. It may be that the Cys14Ala mutation somehow alters overall receptor conformation or that this site is involved in ligand recognition. Because the ligand binding domain is thought to be within the TM domain (25), it is more likely that this residue is of structural significance. It is possible that Cys14 may be involved in the formation of GnRH-R dimers through interreceptor disulfide bonds, a phenomenon shown to occur in receptors coupled to the tyrosine kinase second messenger system, for example, the epidermal-derived growth factor receptor (26, 27) and the insulin receptor (28).
The addition of DTT to the membrane preparations of the GnRH-R WT and mutant constructs also suggested that Cys14 and Cys199 are not involved in disulfide bond formation. In the absence of DTT, the levels of GnRH-A specific binding in mutants Cys14Ala and Cys199Ala were decreased in comparison to the GnRH-R WT; however, incubation in the presence of 10 mM DTT for 1 h resulted in a further reduction in GnRH-A binding. These observations imply that disulfide bonds are formed between the conserved Cys residues within these two mutants, in a similar fashion to that observed in the GnRH-R WT and hence specific binding can be reduced by breaking the disulfide bonds with the chemical reducing agent DTT. In contrast, no binding was detectable in the Cys114Ala and Cys195Ala mutants, and therefore the presence of DTT could not affect an already minimal response.
The incorporation of the tag sequence into the GnRH-R has been critical in the interpretation of the results presented in this study, as without a measurement of mutant receptor expression at the cell surface it is impossible to differentiate between receptor mutants that actually affect ligand-receptor interactions and those that interfere with, for example, translation, translocation and/or insertion of the receptor into the cell membrane. When ELISA measurements were carried out, all of the GnRH-R mutations expressed at a slightly lower level when compared with the WT. GnRH-R mutant Cys114Ala showed the greatest reduction in expression, although it still expressed at 68.7% of the WT level, and this may have resulted from the critical position of this residue close to the extracellular/transmembrane interface. It is possible that amino acids juxtapositioned to the membrane have an important role in determining the appropriate stereo conformation of the receptor both in the resting and active state.
In the GPCR superfamily (apart from the glycoprotein hormone receptors), the functional role of the extracellular domains in regulating ligand-receptor binding mechanisms has not been extensively studied. It has been postulated that GnRH binds to its receptor in a hair pin configuration (29) and that the ends of the carboxyl terminal residues have a functional role in receptor binding, whereas those in the amino terminus trigger second messenger pathways (30) via activation of the Gq/G11 G proteins (31, 32). Davidson et al., 1994 (33) suggested that one possible role of the extracellular region of the GnRH-R, in particular amino acid Glu301, is to conform the ligand before its entry into the TM domain. However, whereas there is uncertainty as to a direct participation of the extracellular domains in ligand binding processes, there seems to be an established structural role for disulfide bonded extracellular Cys residues. This bonding pattern is thought to be important in stabilizing three-dimensional receptor conformation by generating an internal scaffold, and thus indirectly facilitating ligand-induced receptor activation.
In this study, the substitution of Cys114 and Cys195 residues for Ala resulted in a receptor with absent ligand binding and functional activity, effects most likely related to the loss of the disulfide bond. The loss of extracellular conformation after destruction of the disulfide bridge probably affects the ligand binding capacity of the receptor in an indirect fashion by changing or obstructing the path of the ligand to its recognition site in the TM domain. However, although we may understand the function of disulfide bonding, the mechanisms that control their formation are unknown; for example, what factors dictate that Cys114 and Cys195 form a disulfide bridge important for ligand binding, whereas Cys14 and Cys199 do not. One possible explanation may be that Cys14 and Cys199 are atomically too far apart to interact or that their relative positions make them inaccessible for disulfide bond formation. It is also unlikely that a disulfide bond exists between these nonconserved residues because Cys199 is not found in every species of the GnRH-Rs isolated to date [mouse, (1, 2, 6), rat, (3, 4, 6), human, (5, 7) sheep, (8, 9) and cow (10)]. In the porcine receptor, the nonconserved Cys present in the EL2 is substituted to glycine (11). However, nonconserved Cys residues are known to participate in disulfide bonding in other GPCRs; for example, in the ß-adrenergic receptor (15).
In conclusion, this study indicates that only one disulfide bond is present in the GnRH-R between the conserved extracellular Cys residues Cys114 and Cys195. The approach undertaken in this study was based on identifying conserved and nonconserved extracellular Cys residues by comparative sequence homology data, and then further investigating the structure-function role of these amino acids using site-directed mutagenesis and chemical modifying agents. This classical approach to structure-function studies provides critical information as to the possible interactions between extracellular positioned amino acids, especially in the absence of any three-dimensional models of the extra/intracellular domains. As can be seen from these results, the loss of the disulfide bond has a critical effect on receptor structure and hence its ability to bind ligand and couple to a second messenger pathway, indicating the importance of such a bond in maintaining a structurally intact and functionally responsive receptor.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work is supported by the Medical Research Council and the Ernst
Schering Research Foundation. 
Received December 26, 1996.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-T3–1 pituitary gonadotroph cells. J Endocrinol 136:51–58This article has been cited by other articles:
 |
|
 |
|
  Y. Yang, M. Chen, R. A. Kesterson Jr., and C. M. Harmon Structural insights into the role of the ACTH receptor cysteine residues on receptor function Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1120 - R1126. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Kohout, Q. Xie, S. Reijmers, K. J. Finn, Z. Guo, Y.-F. Zhu, and R. S. Struthers Trapping of a Nonpeptide Ligand by the Extracellular Domains of the Gonadotropin-Releasing Hormone Receptor Results in Insurmountable Antagonism Mol. Pharmacol., August 1, 2007; 72(2): 238 - 247. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Conner, S. R. Hawtin, J. Simms, D. Wootten, Z. Lawson, A. C. Conner, R. A. Parslow, and M. Wheatley Systematic Analysis of the Entire Second Extracellular Loop of the V1a Vasopressin Receptor: KEY RESIDUES, CONSERVED THROUGHOUT A G-PROTEIN-COUPLED RECEPTOR FAMILY, IDENTIFIED J. Biol. Chem., June 15, 2007; 282(24): 17405 - 17412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stitham, S. R. Gleim, K. Douville, E. Arehart, and J. Hwa Versatility and Differential Roles of Cysteine Residues in Human Prostacyclin Receptor Structure and Function J. Biol. Chem., December 1, 2006; 281(48): 37227 - 37236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nie, J. R. Hobbs, S. Vigues, W. J. Olson, G. L. Conn, and S. D. Munger Expression and Purification of Functional Ligand-Binding Domains of T1R3 Taste Receptors Chem Senses, July 1, 2006; 31(6): 505 - 513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Janovick, P. E. Knollman, S. P. Brothers, R. Ayala-Yanez, A. S. Aziz, and P. M. Conn Regulation of G Protein-coupled Receptor Trafficking by Inefficient Plasma Membrane Expression: MOLECULAR BASIS OF AN EVOLVED STRATEGY J. Biol. Chem., March 31, 2006; 281(13): 8417 - 8425. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ray, S. P. Ghosh, and J. K. Northup The Role of Cysteines and Charged Amino Acids in Extracellular Loops of the Human Ca2+ Receptor in Cell Surface Expression and Receptor Activation Processes Endocrinology, August 1, 2004; 145(8): 3892 - 3903. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. P. Brothers, A. Cornea, J. A. Janovick, and P. M. Conn Human Loss-of-Function Gonadotropin-Releasing Hormone Receptor Mutants Retain Wild-Type Receptors in the Endoplasmic Reticulum: Molecular Basis of the Dominant-Negative Effect Mol. Endocrinol., July 1, 2004; 18(7): 1787 - 1797. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Millar, Z.-L. Lu, A. J. Pawson, C. A. Flanagan, K. Morgan, and S. R. Maudsley Gonadotropin-Releasing Hormone Receptors Endocr. Rev., April 1, 2004; 25(2): 235 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. P. Brothers, J. A. Janovick, and P. M. Conn Unexpected Effects of Epitope and Chimeric Tags on Gonadotropin-Releasing Hormone Receptors: Implications for Understanding the Molecular Etiology of Hypogonadotropic Hypogonadism J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6107 - 6112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Runge, C. Gram, H. Brauner-Osborne, K. Madsen, L. B. Knudsen, and B. S. Wulff Three Distinct Epitopes on the Extracellular Face of the Glucagon Receptor Determine Specificity for the Glucagon Amino Terminus J. Biol. Chem., July 18, 2003; 278(30): 28005 - 28010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Ding, S. Kim, R. T. Dorsam, J. Jin, and S. P. Kunapuli Inactivation of the human P2Y12 receptor by thiol reagents requires interaction with both extracellular cysteine residues, Cys17 and Cys270 Blood, May 15, 2003; 101(10): 3908 - 3914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Janovick, G. Maya-Nunez, and P. M. Conn Rescue of Hypogonadotropic Hypogonadism-Causing and Manufactured GnRH Receptor Mutants by a Specific Protein-Folding Template: Misrouted Proteins as a Novel Disease Etiology and Therapeutic Target J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3255 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Maya-Nunez, J. A. Janovick, A. Ulloa-Aguirre, D. Soderlund, P. M. Conn, and J. P. Mendez Molecular Basis of Hypogonadotropic Hypogonadism: Restoration of Mutant (E90K) GnRH Receptor Function by a Deletion at a Distant Site J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 2144 - 2149. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Hofmann, S. Sydow, O. Jahn, L. Van Werven, T. Liepold, K. Eckart, and J. Spiess Functional and protein chemical characterization of the N-terminal domain of the rat corticotropin-releasing factor receptor 1 Protein Sci., October 19, 2001; 10(10): 2050 - 2062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Madigou, E. Mañanos-Sanchez, S. Hulshof, I. Anglade, S. Zanuy, and O. Kah Cloning, Tissue Distribution, and Central Expression of the Gonadotropin-Releasing Hormone Receptor in the Rainbow Trout (Oncorhynchus mykiss) Biol Reprod, December 1, 2000; 63(6): 1857 - 1866. [Abstract] [Full Text]
|
|
|
|
|
|
S. H. Hoffmann, T. t. Laak, R. Kühne, H. Reiländer, and T. Beckers Residues within Transmembrane Helices 2 and 5 of the Human Gonadotropin-Releasing Hormone Receptor Contribute to Agonist and Antagonist Binding Mol. Endocrinol., July 1, 2000; 14(7): 1099 - 1115. [Abstract] [Full Text]
|
|
|
|
|
|
B. E. Troskie, J. P. Hapgood, R. P. Millar, and N. Illing Complementary Deoxyribonucleic Acid Cloning, Gene Expression, and Ligand Selectivity of a Novel Gonadotropin-Releasing Hormone Receptor Expressed in the Pituitary and Midbrain of Xenopus laevis Endocrinology, May 1, 2000; 141(5): 1764 - 1771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chauvin, A. Bérault, Y. Lerrant, M. Hibert, and R. Counis Functional Importance of Transmembrane Helix 6 Trp279 and Exoloop 3 Val299 of Rat Gonadotropin-Releasing Hormone Receptor Mol. Pharmacol., March 1, 2000; 57(3): 625 - 633. [Abstract] [Full Text]
|
|
|
|
|
|
S. Barroso, F. Richard, D. Nicolas-Etheve, J.-L. Reversat, J.-M. Bernassau, P. Kitabgi, and C. Labbe-Jullie Identification of Residues Involved in Neurotensin Binding and Modeling of the Agonist Binding Site in Neurotensin Receptor 1 J. Biol. Chem., January 7, 2000; 275(1): 328 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. B. Willars, A. Heding, M. Vrecl, R. Sellar, M. Blomenrohr, S. R. Nahorski, and K. A. Eidne Lack of a C-terminal Tail in the Mammalian Gonadotropin-releasing Hormone Receptor Confers Resistance to Agonist-dependent Phosphorylation and Rapid Desensitization J. Biol. Chem., October 15, 1999; 274(42): 30146 - 30153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. P. Pralong, F. Gomez, E. Castillo, S. Cotecchia, L. Abuin, M. L. Aubert, L. Portmann, and R. C. Gaillard Complete Hypogonadotropic Hypogonadism Associated with a Novel Inactivating Mutation of the Gonadotrop |
