| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Orthopaedic Surgery and Division of Endocrinology, Emory University School of Medicine and Veterans Affairs Medical Center, Atlanta, Georgia 30033
Address all correspondence and requests for reprints to: Scott D. Boden, M.D., The Emory Spine Center, 2165 North Decatur Road, Decatur, Georgia 30033.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Treatment with the GC triamcinolone (10-9 M) resulted in a 5- to 8-fold increase in BMP-6 steady-state messenger RNA levels, peaking at 12 h. In contrast, BMPs -2, -4, -5, -7, and transforming growth factor (TGF)-ß1 messenger RNA levels increased by less than 2-fold, after GC treatment, compared with untreated control cultures at 24 h. BMP-6 protein secretion increased 6- to 7-fold by 12 h and 12-fold (from 7.5 to 90 ng/ml) by 24 h, as measured by quantitative Western analysis. Treatment of cells with oligodeoxynucleotides antisense to BMP-6 diminished secretion of BMP-6 protein and significantly inhibited the GC-induced differentiation, as determined by a 10-fold decrease in the number of mineralized bone nodules, compared with controls that were treated with sense oligonucleotides or no oligonucleotides (ANOVA, P < 0.05). The antisense oligonucleotide inhibition of differentiation was rescued by treatment with exogenous recombinant human BMP-6. We conclude that GC-induced differentiation of osteoblasts from the pluripotent precursors is mediated, in part, by BMP-6. These results suggest that BMP-6 has an important and unique role during early osteoblast differentiation.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Bone morphogenetic proteins (BMPs) are growth factors found in bone matrix that have been shown to be important regulators of membranous and endochondral bone formation (16, 17). A synergism between GCs and BMP-2 for induction of osteoblast differentiation from marrow stromal cells has been reported (8). We recently extended that observation to a fetal rat calvarial cell culture model and demonstrated GC potentiation of the differentiating effect of BMP-2 and BMP-4 but only minimal potentiation of the effects of BMP-6. In our culture model, BMP-6 had a greater effect on differentiation than BMP-2 or BMP-4, as measured by discrete mineralized nodule formation (5).
In this investigation, we explored the mechanism of GC stimulation of osteoblast differentiation and the possible mediation of GC action by BMP-6. We found that GC treatment results in a significant and selective increase in BMP-6 message levels and protein expression. Furthermore, blocking the expression of BMP-6 protein, using antisense deoxyoligonucleotides, resulted in a loss of the GC effect on differentiation that could be rescued only with exogenous recombinant human (rh)BMP-6. These results suggest that BMP-6 is an important early mediator in osteoblast differentiation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Calvarial cell preparation
After approval by the Institutional Animal Care and Use
Committee, fetal Sprague-Dawley rats were removed at 20-days gestation
and decapitated and the heads submerged in sterile PBS with 1%
penicillin/streptomycin-5000 U (GIBCO). The crania were dissected using
sterile technique in the laminar flow hood. Parietal and frontal bones
were dissected free from the sutures and subjected to four collagenase
digestions (type 1:type II = 6:1). The specific activity of
collagenase (Worthington Enzymes, Freehold, NJ) was 43 IU/ml in the
first digestion and 172 IU/ml for the remaining three digestions. All
digestions were carried out at 32 C for 20 min each. Cells from the
latter two digestions were pooled to provide a rat osteoblastic
(rOB)-enriched cell suspension (5). The pooled cells were washed,
pelleted, resuspended in MEM/10% FBS, counted by hemocytometer, and
seeded in T-75 vented flasks (Corning, Corning, NY) at 1 x
106 cells/flask. Cells were grown at 37 C in 5%
CO2 with humidification. The cells were fed at 48 h
and again at 96 h with MEM/10% FBS. Seven days after seeding, the
primary culture was trypsinized and passed into 6-well plates at 1
x 105 cells/35-mm well) as first subculture cells. Cells
were grown for an additional 7 days, during which time they reached
second confluence (day zero). Beginning on day 0, media were changed
and treatments (GCs and/or cytokines) were applied under a laminar-flow
hood every 3–4 days. The standard culture protocol was as follows:
days 0–7 = MEM, 10% FBS, 50 µg/ml ascorbic acid; days
8–14 = BGJb medium, 10% FBS, 5 mM
ß-GlyP (as a source of inorganic phosphate to permit mineralization).
Alternatively, for stimulus switch/change experiments: days 0–3 =
MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 1; days
4–7 = MEM, 10% FBS, 50 µg/ml ascorbic acid + stimulus no. 2;
days 8–14 = BGJb medium, 10% FBS, 5 mM
ß-GlyP. Endpoint analysis of bone nodule formation and osteocalcin
secretion was performed at day 14.
The dose of rhBMP-6 was chosen as 50 ng/ml, based on pilot experiments in this system that demonstrated a midrange effect on the dose response curve. The dose of triamcinolone (GC) was chosen as 1 nM, based on previous dose-response experiments in this culture system (5).
Quantitation of bone formation
Cultures were fixed overnight in 70% ethanol and stained with
von Kossa silver stain. A semiautomated computerized video image
analysis system (Optomax 5, Optomax, Hollis, NH) was used to quantitate
nodules in each well. This automated technique was validated previously
against a manual counting technique and demonstrated an r value of 0.92
(P < 0.000001) (5). All data are expressed as the
mean ± SEM, calculated from 5–6 wells at each
condition. Each experiment was reconfirmed at least two times using
cells from different calvarial preparations.
Quantitation of osteocalcin secretion
Osteocalcin levels in the medium were measured using a
competitive RIA with a monospecific polyclonal antibody (PAb) raised in
our laboratory against the C-terminal octapeptide of rat osteocalcin,
as described previously, except for use of an acetylated peptide analog
as radioligand and standard (18). Osteocalcin values were reported as
pmol/ml medium (3-day production). Values are expressed as the
mean ± SEM of triplicate determinations for 5–6
wells for each condition. Each experiment was reconfirmed at least two
times using cells from different calvarial preparations.
RNA extraction and purification
Cellular RNA from duplicate 35-mm wells (6-well culture dish)
was harvested to yield statistical triplicates using 4 M
guanidine isothiocyanate solution (19). Briefly, medium was aspirated
from wells, wells overlaid with 0.6 ml guanidine isothiocyanate
solution per duplicate, and plates swirled for 5–10 sec. Samples were
stored at -70 C for up to 7 days before being processed.
RNA was purified by a modification of standard methods (19). Briefly, thawed samples received 60 µl 2.0 M sodium acetate (pH 4.0), 550 µl phenol (water saturated), and 150 µl chloroform:isoamyl alcohol (49:1); were vortexed, centrifuged (10,000 x g; 20 min; 4 C); the aqueous phase transferred to a fresh tube; and the RNA precipitated overnight (-20 C) upon addition of 600 µl isopropanol.
Samples were centrifuged (20 min; 10,000 x g), supernatant aspirated gently, pellets resuspended in 400 µl diethyl pyrocarbonate (DEPC)-treated water, extracted once with phenol:chloroform (1:1), extracted with chloroform:isoamyl alcohol (24:1), and precipitated overnight at -20 C after addition of 40 µl sodium acetate (3.0 M; pH 5.2) and 1.0 ml absolute ethanol. Samples were centrifuged (10,000 x g; 20 min), washed twice with 70% ethanol, air dried for 5–10 min, and resuspended to 20 µl in DEPC-treated water. Optical densities were determined using a Beckman DU 640 Spectrophotometer (Beckman Instruments Inc., Schaumburg, IL).
RT-PCR
RNA was subjected to RT by a modification of standard
methodologies (20). Briefly, denatured total RNA (5 µg in 10.5 µl
total vol in DEPC-treated H2O at 65 C for 5 min) was added
to tubes containing 4 µl 5 x MMLV-RT buffer (GIBCO), 2 µl
deoxynucleotide triphosphates, 2 µl oligo dT17-mer (10 pmol/ml), 0.5
µl RNAsin (40 U/ml, Promega, Madison, WI), 1 µl MMLV-RT (GIBCO),
and the final vol adjusted to 20 µl. Samples were reverse transcribed
at 37 C for 1 h, and the reaction was halted by heating at 95 C
for 5 min.
Transcribed samples (5 µl) were subjected to PCR using standard methodologies (20). Briefly, samples were added to tubes containing water and appropriate amounts of PCR buffer (Perkin Elmer, Foster City, CA), 25 mM MgCl2, dNTPs, forward and reverse primers (10 pM final concentration) for glyceraldehyde phosphate dehydrogenase (GAPDH) or BMP-6, 32P-deoxycytosine triphosphate, and Amplitaq (Perkin Elmer). PCR was performed for 22 cycles (94 C, 30 sec; 58 C, 30 sec; 72 C, 20 sec). Primer sequences from 5' to 3' were: BMP-6 (forward) = GTACCGGCGGCTCAAGACGC, BMP-6 (reverse) = GGGACGAGCTGGCTGCTTCG, GAPDH (forward) = CTGGTCATCAATGGGAAAC, GAPDH (reverse) = CAAAGTTGTCA-TGGATGACC.
Quantitation of RT-PCR products by PAGE and PhosphorImager
analysis
RT-PCR products received 5 µl/tube loading dye, were mixed,
heated (65 C x 10 min), centrifuged, and 10 µl each subjected
to 12% PAGE under standard conditions (19). Gels were then incubated
in gel-preserving buffer (10% vol/vol glycerol, 7% vol/vol acetic
acid, 40% vol/vol methanol, 43% deionized water) for 30 min, dried at
80 C on a GelDryer (Bio-Rad Laboratories, Hercules, CA) in
vacuo 1–2 h, and analyzed by PhosphorImager (Molecular Dynamics,
Sunnyvale, CA). Visualized band intensities were measured after
background correction. Intensities were normalized to a GAPDH control
(a housekeeping gene not regulated by GC) to account for unequal
loading and potential changes in cell number at different points in
time.
Ribonuclease (RNAse) protection assay (RPA)
Labeled riboprobe for BMP-6 messenger RNA (mRNA) was prepared
from BMP-6 vector, generously supplied by Drs. Wozney and Celeste
(Genetics Institute). Briefly, the SP6 promoter site was used to
initiate the complementary riboprobe strand (Riboprobe Gemini II,
Promega). Labeled riboprobe was added to a sample of total RNA (10–100
µg) resuspended in 20 µl hybridization buffer, and RPA was
performed according to standard protocol (Boehringer Mannheim Kit No.
1427–580). Purified double-stranded RNA was separated by 6% urea
denaturing gel electrophoresis, and the presence of BMP-6 RNA was
determined by phosphorimaging.
Quantitation of BMP-6 protein
BMP-6 protein was quantitated by Western blot analysis of
homogenates prepared from whole cultures. Cells were scraped into the
medium and lysed by repeated freezing at -70 C and thawing. Resulting
microvesicles were sonicated five times (Heat Systems, Ultrasonics,
Inc.) for 30 sec at full power and cooled in ice. Homogenates were
stored at -70 C in the presence of 0.5 mM
phenylmethysulfonyl fluoride and 0.2 mM leupeptin for up to
3 weeks before analysis.
Proteins (50 µg) within the homogenates were separated under reducing conditions by 12% PAGE (21). Gels were transblotted to polyvinylidene difluoride membrane (Bio-Rad) in Tris-glycine buffer overnight at 75 mA (22). Where necessary, proteins were visualized by transient Ponceau staining (23). The membranes were prewashed (5 x 10 min) in Tris-buffered saline (TBS), blocked for 1 h at room temperature with TBS/10% FBS/3% BSA, and washed (3 x 5 min) in TBS/1% FBS. PAb specific to the mature region of BMP-6 (1 µg/ml 2A06-TB3, a generous gift of Drs. Wozney and Celeste at Genetics Institute) was applied overnight at 4 C to biotinylated goat antirabbit antiserum (Bio-Rad) diluted 1:250 in TBS/1% FBS. Membranes were washed again (3 x 5 min) in TBS/1% FBS, exposed for 1 h at room temperature to horseradish peroxidase-conjugated streptavidin (Bio-Rad) diluted 1:250 in TBS/1% FBS, and washed (3 x 5 min) in TBS/1% FBS. Bands were visualized using the TMB Peroxidase Substrate System (KPL, Gaithersburg, MD). Lanes were scanned and digitized using a densitometer (Scanjet II, Hewlett-Packard) and the total density in each lane quantitated using densitometric software (Molecular Dynamics). The specificity of 2A06-TB3 for BMP-6 was confirmed by preblocking the primary antibody with 5-fold molar excess of rhBMP-6. The optimum antibody dilution was determined by serial antibody dilution curves using 10 µg rhBMP-5, 6, and 7 as antigen. The dilution chosen had minimal cross-reactivity with BMP-5 or BMP-7.
Antisense treatment and cell culture
Antisense oligonucleotide inhibition of BMP-6 expression was
accomplished with a specific 19-base oligonucleotide binding 7
nucleotides downstream of the translation start site. Oligonucleotides
spanning the methionyl initiation codon were not used because of
homology with other members of the TGF-ß superfamily. BMP-6 antisense
oligonucleotide sequence was as follows: 5'-TGCTAGTTGCTGTGATGTC-3'.
Controls were treated with the complementary sense oligonucleotide or
no oligonucleotide treatment. Transfection of DNA was accomplished with
similar results using either of two protocols (in the presence or
absence of lipofectamine). In both protocols, 11 µg sense or
antisense BMP-6 oligonucleotides were incubated in MEM for 45 min at
room temperature. Either more MEM or preincubated lipofectamine + MEM
(7% vol/vol; 45 min at room temperature) was added to achieve a final
oligonucleotide concentration of 0.1 µM. The resulting
mixture was incubated 15 min at room temperature.
Treatment of cells with one of the three oligonucleotide mixtures (antisense, sense, or vehicle) was performed in standard media with or without GC stimulation. Media containing lipofectamine were changed after 4 h of incubation and replaced with fresh media with neither lipofectamine nor oligonucleotides. Cultures transfected without lipofectamine had their media changed at 24 h to media containing no oligonucleotide. Protein was harvested at 0, 12, 24, 48, and 72 h; RNA was harvested at 0, 12, 24, 36, 48, 60, and 72 h or 0, 1, 3, 5, and 7 days. Several cultures from each experiment were grown to 14 days (including the usual media change to BGJb at day 7) to determine mineralized nodule counts and osteocalcin secretion.
Statistical methods
Nodule counts and osteocalcin levels from representative
experiments are expressed as the mean ± SEM from an
N = 5–6 per group. Data were normalized to the maximum value for
each parameter to allow simultaneous graphing of nodule counts,
mineralized areas, and osteocalcin. For RT-PCR, RPA, or Western blot
analysis, data from triplicate samples of representative experiments
were used to determine the mean ± SEM. Graphs are
shown normalized to either day zero or no-treatment controls and
expressed as fold increases above control values. Statistical
significance was evaluated using a one-way ANOVA with post
hoc multiple comparison corrections of Bonferroni (Sigmastat,
Jandel Scientific, Corte Madera, CA). 
levels for significance were
defined as P less than 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
demonstrates a 5.6-fold induction of BMP-6
steady-state mRNA levels after 24 h of GC treatment, compared with
untreated cells at the same time point. In contrast, mRNA levels for
BMP-2, BMP-4, BMP-5, BMP-7, and TGF-ß1 were increased with GC
treatment by less than 2-fold (F = 69.8, P <
0.0001).
|
). Treatment
with rhBMP-2 resulted in a slightly decreased level of BMP-6 mRNA. The
BMP-6 PCR product was sequenced by both automated and manual
techniques. By both methods, the sequence obtained was greater than
90% homologous to the published rat BMP-6 sequence and less than 75%
homologous to either mouse BMP-5 or rat BMP-7. The deduced amino acid
homology was 100% between our PCR product and published rat BMP-6
protein sequence. To confirm the quantitation of the RT-PCR technique,
the same RNA was analyzed using RNase RPA for BMP-6. Figure 2B
demonstrates nearly identical quantitation of the GC induction of BMP-6
(2.7 ± .4 vs. 2.5 ± 0.2, not significant) to
that of the RT-PCR method. The GC-induced increase in BMP-6 mRNA was
2-fold less than that seen in other experiments because the data in
Fig. 2 were obtained from a single calvarial cell preparation to
validate the mRNA quantitation. This emphasizes the rationale for
confirming all results in cells from three different calvarial
preparations, as was the case for all remaining experiments.
|
shows steady-state BMP-6 mRNA levels (by
RT-PCR) for 7 days of GC treatment. The peak BMP-6 mRNA level was seen
on day 1 and was 5.6 ± .5-fold greater than on day 0 (F =
92.3, P < 0.0001), whereas the increase in BMP-6
expression in untreated cells was only 1.7 ± .1-fold. This
experiment was repeated with more sampling time points in a 72-h time
period. Figure 3B demonstrates an even greater increase in BMP-6
message level after 12 h of GC than that seen after 24 h
(13.7 ± 0.2 vs. 6.0 ± .7). Again, the untreated
cells showed minimal increase in BMP-6 expression (F = 60.4,
P < 0.0001).
|
. The peak
in total BMP-6 protein levels within these cultures was determined by
Western analysis to occur 24 h after GC treatment (Fig. 4A); this was 12 h after the peak rise in BMP-6
mRNA levels. Significantly less BMP-6 protein was observed in the
untreated control cultures (F = 63.8, P <
0.0001). A representative blot of a gel run under reduced conditions
(Fig. 4B) shows the expected four bands detected by the BMP-6 antibody.
The 90-kDa and 65-kDa bands represent pre-pro forms of BMP-6 that are
synthesized as homodimers. Before secretion, they are cleaved to the
16-kDa mature form, which when glycosylated, appears as a 23-kDa band.
The PAb was raised against an epitope within the mature region of the
BMP-6 protein and does not detect subunits cleaved from the pre-pro
homodimer. Identification of the various BMP-6 species was aided by
electrophoresing the same samples under nonreducing conditions. When
not reduced, 125-kDa and 45-kDa bands were detected by the BMP-6
specific antibody. These represent homodimers of the 65-kDa and 23-kDa
protein species. Gas phase sequence analysis determined that the 16-kDa
and 23-kDa bands contain N-terminal sequence consistent with rat BMP-6.
The quantitation data in Fig. 4A includes all four bands detected by
the BMP-6 antibody under reducing conditions; however, the result is
unchanged when only the mature 16-kDa and 23-kDa species are considered
for quantitation.
|
Inhibition of BMP-6 protein synthesis
To determine if BMP-6 was a critical factor in GC-induced
osteoblast differentiation, we performed experiments with
oligodeoxynucleotides antisense to BMP-6. Antisense oligonucleotides
form DNA:RNA duplexes with the specific mRNA species, thereby blocking
binding of the mRNA to the 40 S ribosomal subunit and preventing
translation (24). Figure 5A demonstrates a significant
decrease (F = 87.0, P < 0.0001) in BMP-6 protein
levels when untreated control cells were treated with antisense BMP-6
oligonucleotides for 12 h (67 ± 6% decrease); a larger
decrease was observed in cells stimulated to differentiate with GC
(84 ± 5% decrease). Similar results in BMP-6 protein levels
(74 ± 5% decrease) were observed after transfection of
oligonucleotides with lipofectamine for 4 h. Sense
oligonucleotides had no significant effect on BMP-6 protein, similar to
control cultures not treated with oligonucleotides. As expected, Fig. 5B demonstrates that the steady-state BMP-6 mRNA levels, as measured by
RT-PCR, did not change as a result of the sense or antisense BMP-6
oligonucleotides or the lipofectamine (F = 20.0, P
< 0.0001). These data are consistent with the expected antisense
oligonucleotide inhibition of translation rather than
transcription.
|
). We elected not to measure alkaline phosphatase
activity as a potential early marker because of its lower tissue
specificity and more variable correlation with the mature osteoblast
phenotype, compared with nodule formation and osteocalcin secretion.
Formation of such mineralized nodules in vitro represents a
late stage in osteoblast differentiation, as these nodules are capable
of secreting the bone-specific matrix protein osteocalcin. The
oligonucleotides antisense to BMP-6 resulted in a significant decrease
in bone nodule formation: 79 ± 7% decrease (-GC); 91 ±
5% decrease (+GC); and 89 ± 5% decrease (+GC/lipofectamine)
(F = 90.2, P < 0.0001). Treatment with the sense
BMP-6 oligonucleotides did not result in a significant decrease in
nodule formation.
|
). Addition of rhBMP-6 reversed the effect of BMP-6
antisense oligonucleotides on GC-stimulated nodule formation and
eliminated the low rate of spontaneous nodule formation in control
cultures not treated with GC. Experiments in which rhBMP-2 (50
ng/ml x 7 days) was added after the BMP-6 antisense
oligonucleotide treatment, did not demonstrate restoration of
GC-induced differentiation (data not shown). These results indicate
that antisense oligonucleotides were not substantially toxic to the
cultures and also support the specificity of BMP-6 effects on early
osteoblast differentiation.
|
) and
osteocalcin secretion (F = 107.4, P < 0.0001) on
day 14 (Fig. 8B). These results suggest that BMP-6 is largely
responsible for the differentiating effects of GCs in osteoblast
cultures. In addition, BMP-6 given early seems to potentiate the effect
of BMP-2 given later during differentiation, suggesting a unique
temporal sequence and specific roles for individual BMPs during
osteoblast differentiation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we found that BMP-6 played a uniquely important role, compared with BMPs-2, -4, -5, -7, or TGF-ß1, during early osteoblast differentiation in a rat calvarial cell culture model. This result is consistent with the hypothesis of Hughes et al. (39) that BMP-6 may act principally on an early stage of osteoprogenitor cell based on its greater potency, as demonstrated in a primary rat calvarial cell culture system. In addition, these results reinforce our previous observations that BMP-6 seemed to play an important role during differentiation in a secondary rat calvarial cell culture system (5).
Because of the close homology between BMP-6 and its other subfamily members, BMP-5 and BMP-7, we took several precautions to insure that the GC increase in BMP-6 expression was indeed specific to BMP-6. First, we demonstrated that BMP-5 and BMP-7 mRNA were not induced with GC treatment during the early (24 h) differentiation period, as measured by RT-PCR. We then confirmed the authenticity of the sequence of the BMP-6 PCR product. Although quantitative PCR can be unreliable, similar quantitation by a second methodology, such as RNase protection, increases the validity of the observation. In addition, we confirmed the specificity of BMP-6 protein detection on Western blots by peptide sequence analysis and by a series of antibody titrations targeting BMP-5, 6, and 7. The anti-BMP-6 antiserum concentration for Western blot analysis was determined, to avoid any substantial cross-reactivity with BMP-5 or BMP-7.
The close correlation in timing of BMP-6 protein detection with that of increased BMP-6 mRNA levels is an important observation in our system. Previous studies have shown that BMP-6 protein is not found in all tissues shown to express BMP-6 message (32). This suggests that there may be tissue specific posttranscriptional regulation of BMP-6 expression.
Few studies have looked specifically at the role of BMP-6 during bone formation. BMP-6 has been postulated to play a role during epithelial differentiation, central nervous system development, and hypertrophic cartilage (29, 32, 38, 40, 41). Tumors expressing BMP-6 have induced fibrosis and endochondral bone formation in vivo (42). During primary rat calvarial cell differentiation, BMP-6 mRNA has been detected on days 7–10 by Harris et al. (43). BMP-6 expression increases during differentiation in the pluripotential rOB cell line ROB-C26 (44). Additional evidence for a crucial role of BMP-6 in osteoblast differentiation was highlighted when the osteoinductive effect of matrix from C26 cells that overexpressed BMP-6 was blocked by a neutralizing BMP-6 antibody (44). In addition, treatment of the pluripotential rOB cells ROB-C26 with retinoic acid results in osteoblastic differentiation that is accompanied by an increase in BMP-6 expression and a decrease in expression of BMP-2 and -4 (45).
Our demonstration of the ability to block GC-induced osteoblast differentiation with oligonucleotides antisense to BMP-6 suggests that the mechanism of GC-induced differentiation may share a common pathway with that of retinoic acid via induction of BMP-6. Although we did not observe a decrease in BMP-6 mRNA levels, we did observe a significant decrease in BMP-6 protein expression and bone nodule formation. The antisense oligonucleotides are presumed to inhibit the translation of BMP-6 mRNA by preventing binding of mRNA to the 40 S ribosomal subunit (24). We obtained similar results with 4 h of oligonucleotide treatment in combination with lipofectamine and after 24 h of treatment without a transfection agent.
Inspection of the BMP-6 protein bands, separated under reducing conditions and detected by Western blot analysis, demonstrated that 12 h of GC treatment induced the higher molecular mass bands (90 kDa and 65 kDa). These bands are likely to represent newly synthesized immature BMP-6 consistent with sizes previously reported (32). Before secretion, a portion of the BMP-6 pre-pro molecule is cleaved, resulting in the mature form, which can be glycosylated at several different sites. The 16-kDa band represents the unglycosylated mature form of BMP-6, whereas the 23-kDa band most likely represents the glycosylated form of the mature molecule. The diffuse appearance of the 23-kDa band is most likely caused by variably glycosylated forms of the mature BMP-6 molecule migrating slightly differently from each other. Our data demonstrate that the GC treatment resulted in an induction of all four of the detected BMP-6 species, with the larger sizes appearing slightly earlier than the more mature, smaller, secreted forms.
Although other growth factors not measured in these studies may play a role in early osteoblast differentiation, these data suggest that BMP-6 is one of the more critical TGF-ß superfamily members. Not only does the induction of BMP-6 enhance bone nodule formation in cultures, but the specific inhibition of BMP-6 protein expression directly interferes with nodule formation. These data, taken with the observation that the biological activity of rhBMP-2 can be enhanced by GC or by rhBMP-6, but that the BMP-6 antisense oligonucleotide inhibition of nodule formation cannot be effectively rescued by rhBMP-2, suggest that BMP-6 may represent a critical component of the osteoblast differentiation pathway. These findings also demonstrate that specific BMPs may have unique temporal and functional roles in bone formation that are not necessarily redundant or interchangeable.
|
Footnotes |
|---|
Received January 14, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. Garimella, S. E. Tague, J. Zhang, F. Belibi, N. Nahar, B. H. Sun, K. Insogna, J. Wang, and H. C. Anderson Expression and Synthesis of Bone Morphogenetic Proteins by Osteoclasts: A Possible Path to Anabolic Bone Remodeling J. Histochem. Cytochem., June 1, 2008; 56(6): 569 - 577. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Donn, A. Berry, A. Stevens, S. Farrow, J. Betts, R. Stevens, C. Clayton, J. Wang, L. Warnock, J. Worthington, et al. Use of gene expression profiling to identify a novel glucocorticoid sensitivity determining gene, BMPRII FASEB J, February 1, 2007; 21(2): 402 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Derfoul, G. L. Perkins, D. J. Hall, and R. S. Tuan Glucocorticoids Promote Chondrogenic Differentiation of Adult Human Mesenchymal Stem Cells by Enhancing Expression of Cartilage Extracellular Matrix Genes Stem Cells, June 1, 2006; 24(6): 1487 - 1495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Deregowski, E. Gazzerro, L. Priest, S. Rydziel, and E. Canalis Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/beta-Catenin but Not Bone Morphogenetic Protein Signaling J. Biol. Chem., March 10, 2006; 281(10): 6203 - 6210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-S. Wang, C.-L. Lin, Y.-J. Chen, C.-J. Wang, K. D. Yang, Y.-T. Huang, Y.-C. Sun, and H.-C. Huang Secreted Frizzled-Related Protein 1 Modulates Glucocorticoid Attenuation of Osteogenic Activities and Bone Mass Endocrinology, May 1, 2005; 146(5): 2415 - 2423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, E. M. Schwarz, M. J. Zuscik, R. N. Rosier, A. M. Ionescu, J. E. Puzas, H. Drissi, T.-J. Sheu, and R. J. O'Keefe Retinoic Acid Stimulates Chondrocyte Differentiation and Enhances Bone Morphogenetic Protein Effects through Induction of Smad1 and Smad5 Endocrinology, June 1, 2003; 144(6): 2514 - 2523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Canalis, A. N. Economides, and E. Gazzerro Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton Endocr. Rev., April 1, 2003; 24(2): 218 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Pereira, A. N. Economides, and E. Canalis Bone Morphogenetic Proteins Induce Gremlin, a Protein That Limits Their Activity in Osteoblasts Endocrinology, December 1, 2000; 141(12): 4558 - 4563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gilbert, X. He, P. Farmer, S. Boden, M. Kozlowski, J. Rubin, and M. S. Nanes Inhibition of Osteoblast Differentiation by Tumor Necrosis Factor-{alpha} Endocrinology, November 1, 2000; 141(11): 3956 - 3964. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. C. Pereira, D. Durant, and E. Canalis Transcriptional regulation of connective tissue growth factor by cortisol in osteoblasts Am J Physiol Endocrinol Metab, September 1, 2000; 279(3): E570 - E576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Yamaguchi, T. Komori, and T. Suda Regulation of Osteoblast Differentiation Mediated by Bone Morphogenetic Proteins, Hedgehogs, and Cbfa1 Endocr. Rev., August 1, 2000; 21(4): 393 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. O. Abu, A. Horner, V. Kusec, J. T. Triffitt, and J. E. Compston The Localization of the Functional Glucocorticoid Receptor {alpha} in Human Bone J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 883 - 889. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. A. Zlotolow, A. R. Vaccaro, M. L. Salamon, and T. J. Albert The Role of Human Bone Morphogenetic Proteins in Spinal Fusion J. Am. Acad. Ortho. Surg., January 1, 2000; 8(1): 3 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Binkert, M. Demetriou, B. Sukhu, M. Szweras, H. C. Tenenbaum, and J. W. Dennis Regulation of Osteogenesis by Fetuin J. Biol. Chem., October 1, 1999; 274(40): 28514 - 28520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. R. Reid Glucocorticoid Osteoporosis: Reid IR Glucocorticoid osteoporosis J Intensive Care Med 1999, 14231-242 J Intensive Care Med, September 1, 1999; 14(5): 231 - 242. [PDF]
|
|
|
|
 |
|
 R.T. Franceschi The Developmental Control of Osteoblast-Specific Gene Expression: Role of Specific Transcription Factors and the Extracellular Matrix Environment Critical Reviews in Oral Biology & Medicine, January 1, 1999; 10(1): 40 - 57. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Pereira, F. Blanquaert, and E. Canalis Cortisol Enhances the Expression of mac25/Insulin-Like Growth Factor-Binding Protein-Related Protein-1 in Cultured Osteoblasts Endocrinology, January 1, 1999; 140(1): 228 - 232. [Abstract] [Full Text]
|
|
|
|
 |
|
 I. Borcsok, H. U. Schairer, U. Sommer, G. K. Wakley, U. Schneider, F. Geiger, F. U. Niethard, R. Ziegler, and C. H. Kasperk Glucocorticoids Regulate the Expression of the Human Osteoblastic Endothelin A Receptor Gene J. Exp. Med., November 2, 1998; 188(9): 1563 - 1573. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Sokol, X. Zhang, P. Lu, and A. M. Gewirtz Real time detection of DNA·RNA hybridization in living cells PNAS, September 29, 1998; 95(20): 11538 - 11543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Canalis Editorial: Inhibitory Actions of Glucocorticoids on Skeletal Growth. Is Local Insulin-Like Growth Factor I to Blame? Endocrinology, July 1, 1998; 139(7): 3041 - 3042. [Full Text] [PDF]
|
|
|
|
|
|
L. Gilbert, X. He, P. Farmer, J. Rubin, H. Drissi, A. J. van Wijnen, J. B. Lian, G. S. Stein, and M. S. Nanes Expression of the Osteoblast Differentiation Factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) Is Inhibited by Tumor Necrosis Factor-alpha J. Biol. Chem., January 18, 2002; 277(4): 2695 - 2701. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
