help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugawara, A.
Right arrow Articles by Abe, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugawara, A.
Right arrow Articles by Abe, K.
Endocrinology Vol. 138, No. 8 3175-3180
Copyright © 1997 by The Endocrine Society


ARTICLES

Retinoid X Receptors in the Kidney: Their Protein Expression and Functional Significance

Akira Sugawara, Naoko Sanno, Nobuyuki Takahashi, R. Yoshiyuki Osamura and Keishi Abe

The 2nd Department of Internal Medicine (A.S., N.T., K.A.), Tohoku University School of Medicine, Sendai 980 Japan; and Department of Pathology (N.S., R.Y.O.), Tokai University School of Medicine, Isehara-city 259-11, Japan

Address all correspondence and requests for reprints to: Dr. Akira Sugawara, The 2nd Department of Internal Medicine, Tohoku University School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Retinoid X receptors (RXRs) heterodimerize with 1,25-dihydroxyvitamin D3 (VD) receptor (VDR), and play important roles in VD-regulated transactivation. VD acts on many tissues including kidney for the regulation of calcium homeostasis. In the kidney, the expression of VDR in the tubular cells has been well studied. In contrast, little is known about the localization and the functional significance of RXRs there. In order to elucidate these questions, we first performed immunohistochemical analyses of rat kidney using isoform-specific antimouse RXR antibodies we have previously reported. Interestingly, all RXR isoforms, predominantly RXR{alpha}, mainly localized to the proximal and the distal tubules, but not to the glomeruli. The serial section staining using anti-VDR antibody showed the colocalization of RXR{alpha} and VDR in those tubular cells. In order to elucidate the functional significance of endogenous receptors in the tubular cells, we next performed transient transfection studies using the tubular-cell derived Madin-Darby bovine kidney cells, which express both endogenous VDR and RXR. We transfected a reporter plasmid containing direct repeat 3 (DR3) sequence, to which only RXR/VDR heterodimer can bind, and found that VD and 9-cis retinoic acid, as well as VD and RXR selective agonist LG100153, had an additive effect for the DR3 transactivation. Taken together, we speculate that endogenous RXRs co-localize with VDR, and coregulate VD-dependent genes in the tubular cells of the kidney as RXR/VDR heterodimer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RETINOID X RECEPTORS (RXRs) are transcription factors that belong to the steroid/thyroid hormone receptor superfamily (1, 2, 3, 4, 5), and 9-cis retinoic acid (9cRA) has been identified as their ligand (5, 6, 7). Three RXR isoforms ({alpha}, ß, {gamma}) have been identified so far (2, 5). RXRs not only work as homodimers (8), but also as heterodimers with other nuclear hormone receptors including 1, 25-dihydroxyvitamin D3 (VD) receptor (VDR), retinoic acid receptors (RARs), and thyroid hormone receptors (1, 2, 3, 4, 5, 9). Among the genes that are regulated by VD, many of them contain VD response element (VDRE) composed of direct repeated pairs of motif (consensus: AGGTCA) spaced by three nucleotides called direct repeat 3 (DR3) (1, 2, 3, 9, 10). It has recently been shown that RXR/VDR heterodimer, rather than VDR homodimer, preferentially binds to DR3 sequence, and mediates VD-regulated transcriptional activation (9, 10). Such that, RXRs play important roles in VD signaling. VD acts mainly on its target tissues such as kidney, intestine, and bone for the regulation of calcium homeostasis (11). In the kidney, the expression of VDR in the tubular cells has been well studied (12, 13, 14). Regarding RXRs, we have previously found the predominant expression of RXR{alpha} protein in the kidney nuclear extract using the electrophoretic mobility shift assay (EMSA) (15). However, their localization and the functional significance in the kidney are not fully understood.

In the present study, we first demonstrated using isoform-specific antimouse (m) RXR antibodies we previously reported (16) that all RXR isoforms, predominantly RXR{alpha}, mainly localized to the proximal and the distal tubules, but not to the glomeruli. The serial section staining using anti-VDR antibody showed the colocalization of RXR{alpha} and VDR in those tubular cells. We next transfected a reporter plasmid containing direct repeat 3 (DR3) sequence, to which only RXR/VDR heterodimer can bind by EMSA, into the tubular-cell derived Madin-Darby bovine kidney (MDBK) cells which express both endogenous VDR (17, 18) and RXR. Interestingly, VD and 9cRA, as well as VD and RXR selective agonist LG100153 (19), had an additive effect for the DR3 transactivation. We therefore speculate that the endogenous RXRs colocalize with VDR, and coregulate VD-dependent genes in the tubular cells of the kidney as RXR/VDR heterodimer.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue preparation/immunohistochemical procedure
Adult male Wistar-Imamichi rats (250 g) were sacrificed under inhalation anesthesia with ethyl ether. Their kidneys were removed and were fixed at room temperature in 10% buffered formalin for overnight, and were embedded in paraffin wax. Sections on 4 µm were cut, then were mounted on 3-aminopropyltriethoxy silane coated glass slides, and were subjected to the immunohistochemical procedures. Polyclonal antibodies for RXR{alpha}, ß, {gamma} were raised against synthetic peptides containing the following mouse RXR amino acid residues: RXR{alpha}-(92-109), RXRß-(78-93), and RXR{gamma}-(35-54) as previously described (16). Immunohistochemical preabsorption tests were performed in order to confirm the specificity by preincubating the diluted antibodies with the corresponding antigens at 4 C overnight before the immunohistochemical procedures. Monoclonal (rat) antichicken VDR antibody (Affinity Bioreagents, Neshanic Station, NJ) was diluted in 1% BSA in PBS. The avidin-biotin complex method was performed as reported previously (20). In brief, the deparafinized and rehydrated specimens were incubated in 0.3% hydrogen peroxide in methanol for 30 min and were microwaved at 100 C in citrate buffer (pH 6.0) for the retrieval of antigenicity. Then the specimens were incubated with primary antibodies for 18 h (1:4000 dilution for anti-mRXR{alpha} antiserum, 1:2000 dilution for anti-mRXRß and anti-mRXR{gamma} antisera, and 1:100 dilution for anti-VDR antiserum), and subsequently incubated with biotinylated antirabbit antibody (1:200 dilution, Vector Laboratories, Burlingame, CA) for anti-mRXR antibodies and biotinylated antirat antibody (1:200 dilution, Amersham International, Little Chalfont, UK) for anti-VDR antibody. Then the sections were rinsed and incubated with the avidin-biotin complex (Vector Laboratories). Final colocalization was made by 0.2% 3,3'-diaminobenzidine tetrahydrochloride (DAB) (Wako Pure Chemicals, Osaka, Japan) containing 0.005% hydrogen peroxide. In order to compare the localization of RXRs and VDR, serial sections were used for the immunohistochemical staining.

Preparation of nuclear extracts/Western immunoblot analyses
MDBK cells were grown in monolayer cultures at 37 C, 5% CO2 in DMEM with 10% FCS, 100 U/ml penicillin, and 100 mg/ml streptomycin. When cultured MDBK cells were grown to 60% confluence, media were changed to DMEM with 1% resin and charcoal-treated calf serum (stripped medium) (21) and incubated for 12 h. Then, fresh-stripped medium was added and the cells were incubated for additional 48 h in the absence or presence of either 10-7 M VD (Biomol, Plymouth Meeting, PA), 10-6 M 9cRA, or 3 mM CaCl2 (final CaCl2 concentration including the media was 5 mM) before preparation of nuclear extracts. Nuclear extracts from MDBK cells and rat kidney were prepared as previously described (15, 16). Ten micrograms of cellular nuclear extracts were subjected to SDS-PAGE (9% acrylamide gel). After SDS-PAGE, proteins were transferred to polyvinylidene difluoride (PVDF) (Immobilon P, Millipore) in 20 mM Tris, 150 mM glycine, 3.5 mM SDS, and 20% (vol/vol) methanol for 3 h at 75 mA constant current. Immunoblot analyses were performed as previously described (16, 22). Briefly, the blots were blocked in 5% nonfat dry milk/PBS/0.1% Tween-20 (Bio-Rad, Hercules, CA) at 4 C overnight, and then incubated either with immune or preimmune isoform-specific anti-mRXR antisera diluted 1:1000 for 1 h at room temperature. After incubation with horseradish peroxidase-linked donkey antirabbit Ig (Amersham International) diluted 1:5000 for 1 h at room temperature, antibody/protein complexes on the blots were detected using ECL detection reagents (Amersham International).

Transient transfection studies
DR3 oligonucleotides containing consensus half-sites sequence AGGTCA arranged as a direct repeat containing nucleotide gaps of 3 (AGCTTACTTATTGAGGTCACTGAGGTCAAGTTACG) were subcloned into the reporter vector, PT109 (23), which contains a viral thymidine kinase promoter and the firefly luciferase cDNA as previously described (24). MDBK cells were grown as described above. When cultured MDBK cells were grown to 60% confluence, media were changed to the stripped medium and incubated for 12 h. Then the cells were transiently transfected using DEAE-dextran method. Briefly, 2 µg reporter plasmid [either reporter plasmid PT109 itself (23) or above described DR3-containing PT109 (24)] and 1.2 µg Rous sarcoma virus-ß-galactosidase control plasmid were mixed with 27 µl of 10 mg/ml DEAE-dextran, 0.85 ml DMEM, and 0.85 µl of 100 mM chloroquine per 3.5-cm plate. Three hours after transfection, cells were treated with 10% dimethyl sulfoxide (DMSO), then incubated with the fresh stripped medium for 24 h. The cells then were incubated with either 10-6 M 9cRA, 10-7 M VD (Biomol), or both for additional 48 h. Identical experiment was also performed except that 10-6 M RXR selective agonist LG100153 (named compound 6 g in Ref. 19, kindly provided by Dr. R. A. Heyman, Ligand Pharmaceuticals, San Diego, CA) was used instead of 9cRA. After harvesting, the cell extracts were analyzed for both luciferase (25) and ß-galactosidase (26) activity in order to correct for transfection efficiency.

Preparation of in vitro translated receptors/electrophoretic mobility shift assay (EMSA)
Previously described cDNA clones of mouse RXR{alpha} in pBSK, human RARß in pGEM1 (both are kindly provided by Dr. R. M. Evans, The Salk Institute, San Diego, CA) (5, 27), and human VDR in pSG (kindly provided by Dr. W. Hunziker, Hoffman-La Roche, Basil, Switzerland) (24) were used in these experiments. Unlabeled and [35S]-methionine labeled receptors were produced from rabbit reticulocyte lysates according to the manufacturer’s instructions (Promega, Madison, WI). Unprogrammed reticulocyte lysate also was incubated under the same conditions. [35S]-methionine labeled receptor proteins were quantitated by SDS-PAGE analysis, which showed labeled proteins of expected molecular weights. EMSA using DR3 as a probe was performed as described previously (24).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of RXR proteins in the kidney
We first performed immunohistochemical analyses of rat kidney using anti-mRXR antibodies we have previously generated (16). As seen in Fig. 1BGo, strong immunostaining was observed in nuclei of most cells both in the proximal (examples are indicated by arrows) and the distal (examples are indicated by arrowheads) tubules by anti-mRXR{alpha} antibody, which was completely blocked by peptide preabsorption (Fig. 1CGo). No immunostaining was observed in glomeruli (Fig. 1BGo). Although very faint, but similar distributions of immunostaining were observed using anti-mRXRß and anti-mRXR{gamma} antibodies (data not shown). We next performed Western immunoblot analyses using rat kidney nuclear extract. As seen in Fig. 2Go (lane 1), anti-mRXR{alpha} antiserum specifically detected RXR{alpha} protein at the expected molecular weight (44K) in contrast to its preimmune serum (lane 2), further confirming the specificity of the RXR{alpha} immunostaining. We could not detect either RXRß or RXR{gamma} protein by their respective antiserum by Western immunoblot analyses (data not shown), probably due to their low protein expression levels in rat kidney as observed in immunostaining.



View larger version (190K):
[in this window]
[in a new window]
 
Figure 1. Immunostaining of rat kidney. A, Hematoxylin-eosin staining of rat kidney. B, Immunostaining of rat kidney with anti-mRXR{alpha} antiserum. The antiserum was diluted 1:4000, and then processed immunostaining as described in Materials and Methods. Strong immunostaining was observed in nuclei of most cells in the proximal (examples are indicated by arrows) and the distal (examples are indicated by arrowheads) tubules but not in the glomeruli. C, Peptide reabsorption control of anti-mRXR{alpha} antiserum. D, Immunostaining of the serial section of (B) with anti-VDR antiserum. The antiserum was diluted 1:100, and then processed immunostaining as described in Materials and Methods. Strong immunostaining was observed in nuclei of most cells in the proximal and the distal tubules. The cells immunostained by both anti-mRXR{alpha} and anti-VDR antisera in the proximal (arrows) and the distal (arrowheads) tubules are indicated. Magnification, x300.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Western immunoblot analyses using rat kidney nuclear extract. Immunoblot analyses were performed as described in Materials and Methods. Anti-mRXR{alpha} antiserum (lane 1) specifically detected RXR{alpha} protein (indicated by an arrow) at the expected molecular weight (44K) in contrast to its preimmune serum (lane 2).

 
In order to see if RXR{alpha} colocalizes with VDR in the tubular cells, we next performed immunostaining of the serial section of Fig. 1BGo using anti-VDR antibody. As seen in Fig. 1DGo, strong immunostaining was observed in nuclei of most cells both in the proximal and the distal tubules by anti-VDR antibody. Comparison between Fig. 1Go, B and D, revealed the cells immunostained by both anti-mRXR{alpha} antibody and anti-VDR antibody in the proximal (indicated by arrows in Fig. 1Go, B and D) and the distal (indicated by arrowheads in Fig. 1Go, B and D) tubules, indicating the colocalization of RXR{alpha} and VDR in those tubular cells.

Expression of endogenous RXR protein in MDBK cells
In order to study the functional significance of these receptors in the tubular cells, we next performed transient transfection studies. Among several tubular cell derived cell lines, we chose MDBK cells for the studies since they were well known to express endogenous VDR (17, 18). Additionally, the cells also express endogenous calbindin D-28K protein which is regulated by VD (17, 18), suggesting that they preserve intact VD signaling pathway. In order to see the expression of endogenous RXR protein in the cells, we next performed Western immunoblot analyses using MDBK nuclear extracts. As observed in lane 1 of Fig. 3Go, anti-mRXR{gamma} antiserum specifically detected RXR{gamma} protein at the expected molecular weight (50K), which was not detected by its preimmune serum (Fig. 3Go, lane 5). We could not detect either RXR{alpha} or RXRß protein by their respective antiserum, probably either due to their low protein expression levels or species differences (the antisera were raised against mouse RXRs, and MDBK cells were derived from bovine kidney cell). These data at least suggest that MDBK cells express endogenous RXR protein in addition to VDR. In order to see the regulation of RXR{gamma} protein expression, we treated MDBK cells with either 10-7 M VD, 10-6 M 9cRA, or 3 mM CaCl2 (final CaCl2 concentration including the media was 5 mM), and compared the expression level with the untreated state (Fig. 3Go, lane 1). As seen in Fig. 3Go, either VD (lane 2), 9cRA (lane 3), or high CaCl2 concentration (lane 4) did not affect the RXR{gamma} protein expression level.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Western immunoblot analyses using MDBK nuclear extracts. Anti-mRXR{gamma} antiserum (lane 1) specifically detected RXR{gamma} protein (indicated by an arrow) at the expected molecular weight (50K) in contrast to its preimmune serum (lane 5). When cells were treated with either 10-7 M VD (lane 2), 10-6 M 9cRA (lane 3), or 3 mM CaCl2 (final CaCl2 concentration including the media was 5 mM) (lane 4), RXR{gamma} protein expression levels were not affected. Lanes 6, 7, 8: preimmune serum controls of lanes 2, 3, 4, respectively. *, Nonspecific protein detected by both immune and preimmune antisera.

 
Function of endogenous RXR and VDR in MDBK cells
We then performed transient transfection studies using MDBK cells. When we transfected PT109 itself, incubation with 10-7 M VD, 10-6 M 9cRA, or both had no effect (Fig. 4AGo, lanes 1–4). In contrast, when we transfected DR3-containing PT109, incubation with 10-7 M VD alone induced a 5.4-fold increase (Fig. 4AGo, lane 6) and 10-6 M 9cRA alone induced a 6.9-fold increase (Fig. 4AGo, lane 7) in luciferase activity. Interestingly, incubation with VD plus 9cRA showed an additive effect, and induced a 13.8-fold increase in luciferase activity (Fig. 4AGo, lane 8). Because 9cRA is known to bind and activate RARs equally well as RXRs (7), we next used RXR selective agonist LG100153 (19) instead of 9cRA in order to make sure that endogenous RXR was activated. As seen in Fig. 4BGo, 10-6 M LG100153 alone induced a similar increase (2.6-fold, lane 7) as 10-7 M VD alone did (3.0-fold, lane 6), and VD plus LG100153 also showed an additive effect (5.6-fold, lane 8) in luciferase activity. These data suggest that endogenous RXRs and VDR can co-regulate DR3 sequence in MDBK cells.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Effect of VD and 9cRA or RXR selective agonist LG100153 on DR3 transactivation. Two micrograms reporter plasmid (either PT109 or DR3-containing PT109 (DR3-PT109), and 1.2 µg Rous sarcoma virus-ß-galactosidase control plasmid were transfected into MDBK cells as described in Materials and Methods. After 48 h incubation with (A) either 10-7 M VD (Vitamin D), 10-6 M 9cRA, or both or (B) either 10-7 M VD, 10-6 M LG100153, or both, luciferase activities were measured. Luciferase activity was normalized to ß-galactosidase activity, and then expressed as a percentage of control value (the luciferase activity transfected with DR3-PT109 in the absence of ligand as 100% basal transcription), in terms of the mean ± SD from triplicate (A) or two triplicate (B) samples.

 
RXR/VDR heterodimer formation on DR3
In order to confirm which receptor complexes can bind to the DR3 sequence we used for the transfection studies, we next performed EMSA using in vitro translated RXR, VDR, and RAR. As seen in Fig. 5Go, only RXR/VDR heterodimer (lane 6), but not other combinations among RXR, VDR, and RAR (lanes 1–5, 7) could bind to the DR3 sequence. These data further support the idea that the ligand effect observed in the transfection studies were mediated by endogenous RXR/VDR heterodimer bound to the DR3 sequence.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. RXR/VDR heterodimer formation on DR3. Combinations of unprogrammed reticulocyte lysate and in vitro translated RXR{alpha}, RARß, and VDR (2 µl each) were incubated with labeled DR3 probe. As seen in lane 6, only RXR/VDR heterodimer, but not other homodimers or heterodimers (lanes 1–5 and 7), could bind to the DR3 sequence. VDR/RXR: RXR/VDR heterodimer.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we first demonstrated that all RXR isoforms, predominantly RXR{alpha}, localized to the proximal and the distal tubules of the kidney using isoform-specific anti-mRXR antibodies that we generated and confirmed their isoform specificities by Western immunoblot analyses, supershifts using EMSA, immunoprecipitations, and immunostainings (16). The serial section staining using anti-VDR antibody demonstrated the colocalization of RXR{alpha} and VDR in the tubular cells. Interestingly, in contrast to the previous report describing the restricted expression of VDR in the distal tubules in rat kidney (12), we could observe nuclear staining of VDR both in the proximal and the distal tubules although the same anti-(chicken) VDR antibody was used. The expression of VDR in the proximal tubules in rat kidney was previously demonstrated by [3H]-labeled VD uptake (13). Additionally, Kumar et al. (14) previously demonstrated the immunostaining of VDR both in the proximal and the distal tubules in human kidney using anti-human VDR antibody. As we have used microwave retrieval method in order to increase the antigenicity for immunostaining (20), we think that the difference of VDR localization comparing with the previous report (12) was simply due to the difference of threshold level of immunostaining for detecting VDR in the proximal tubules. We believe that this is the first description of the co-localization of VDR and RXR in the VD target cells.

Although it has recently been well recognized that VDR and RXR can heterodimerize and transactivate DR3 type VDRE from in vitro studies (9, 10), it is not fully understood whether endogenous VDR and RXR in VD target cells can also work together for DR3 transactivation. Because the tubular cells in the kidney is one of the important target tissues of VD, and we have demonstrated the colocalization of VDR and RXR there, we considered that the tubular cells might be a good system for the functional analyses of endogenous VDR and RXR. Because it is technically difficult to obtain pure tubular cells for primary culture to perform the transfection studies, we decided to use clonal cell lines instead. There are several renal cell lines, such as MDBK cells, Madin Darby canine kidney (MDCK) cells, LLC-PK1 (pig kidney) cells, and OK (opposum kidney) cells, which are frequently used and well characterized (17). Among these cell lines, MDBK cells are well known to express endogenous VDR (17, 18). Additionally, the cells preserve several characteristics of the distal tubules including the expression of endogenous calbindin D-28K protein which is regulated by VD (17, 18). As we have observed the expression of endogenous RXR protein in MDBK cells, we speculate that the cells preserve intact VD signaling pathway mediated by endogenous VDR and RXR. We therefore chose MDBK cells for the transfection studies. Interestingly, 9cRA alone induced a almost similar increase in luciferase activity as VD alone did, and VD plus 9cRA showed an additive effect. Because 9cRA is known to bind and activate RARs equally well as RXRs (7), we also used RXR selective agonist LG100153 in order to make sure that endogenous RXR was activated. As expected, LG100153 induced a similar increase as 9cRA did both in the absence or presence of VD. Because EMSA demonstrated that only RXR/VDR heterodimer, but not other combinations among RXR, VDR, and RAR, could bind to the DR3 sequence we used, we consider that the DR3 transactivation induced by VD and 9cRA or LG100153 in MDBK cells was mediated by RXR/VDR heterodimer formed by endogenous receptors. The exact mechanisms of VD mediated calcium reabsorption in the distal tubules are still unclear. It has recently been reported that at least calbindin D-28K and 9K are involved in this process (28, 29). Because DR3 like sequences are observed in the promoter region of both of these genes (18, 30), we speculate that VD mediated calcium reabsorption in the distal tubules may be mediated at least in part by transactivation of DR3-containing calcium regulating genes, including calbindins, by endogenous RXR/VDR heterodimer complexes.


    Acknowledgments
 
We thank Dr. Kazuhisa Takeuchi (Tohoku University School of Medicine), and Drs. Paul M. Yen, William W. Chin (Harvard Medical School) for helpful suggestions and comments. We also thank Dr. Richard A. Heyman (Ligand Pharmaceuticals, San Diego, CA) for providing RXR selective agonist LG100153.

Received April 7, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Yu VC, Delsert C, Andersen B, Holloway JM, Devary OV, Naar AM, Kim SY, Boutin J-M, Glass CK, Rosenfeld MG 1991 RXRß: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67:1251–1266[CrossRef][Medline]
  2. Leid M, Kastner P, Lyons R, Nakshatri H, Saunders M, Zacharewski T, Chen J-Y, Staub A, Garnier J-M, Mader S, Chambon P 1992 Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently. Cell 68:377–395[CrossRef][Medline]
  3. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM 1992 Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signaling. Nature 355:446–449[CrossRef][Medline]
  4. Marks MS, Hallenbeck PL, Nagata T, Segars JH, Appella E, Nikodem VM, Ozato K 1992 H-2RIIBP (RXRß) heterodimerization provides a mechanism for combinatorial diversity in the regulation of retinoic acid and thyroid hormone responsive genes. EMBO J 11:1419–1435[Medline]
  5. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  6. Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, Thaller C 1992 9-Cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 68:397–406[CrossRef][Medline]
  7. Allenby G, Bocquel M-T, Saunders M, Kazmer S, Speck J, Rosenberger M, Lovey A, Kastner P, Grippo JF, Chambon P, Levin AA 1993 Retinoic acid receptors and retinoid X receptors: interactions with endogenous retinoic acids. Proc Natl Acad Sci USA 90:30–34[Abstract/Free Full Text]
  8. Zhang X-k, Lehmann J, Hoffmann B, Dawson MI, Cameron J, Graupner G, Hermann T, Tran P, Pfahl M 1992 Homodimer formation of retinoid X receptor induced by 9-cis retinoic acid. Nature 358:587–591[CrossRef][Medline]
  9. Carlberg C, Bendik I, Wyss A, Meier E, Sturzenbecker LJ, Grippo JF, Hunziker W 1993 Two nuclear signalling pathways for vitamin D. Nature 361:657–660[CrossRef][Medline]
  10. Whitfield GK, Hsieh J-C, Jurutka PW, Selznick SH, Haussler CA, Macdonald PN, Haussler MR 1995 Genomic action of 1,25-dihydroxyvitamin D3. J Nutri 125:1690S–1694S
  11. Norman AW 1995 Pleiotropic actions of 1{alpha},25-dihydroxyvitamin D3: an overview. J Nutri 125:1687S–1689S
  12. Liu L, Ng M, Iacopino AM, Dunn ST, Hughes MR, Bourdeau JE 1994 Vitamin D receptor gene expression in mammalian kidney. J Am Soc Nephrol 5:1251–1258[Abstract]
  13. Kawashima H, Kurokawa K 1982 Localization of receptors for 1,25-deoxyvitamin D3 along the rat nephron. J Biol Chem 257:13428–13432[Free Full Text]
  14. Kumar R, Schaefer J, Grande JP, Roche PC 1994 Immunolocalization of calcitriol receptor, 24-hydroxylasee cytochrome P-450, and calbindin D28k in human kidney. Am J Physiol 266:F477–F485
  15. Sugawara A, Yen PM, Darling DS, Chin WW 1993 Characterization and tissue expression of multiple triiodothyronine (T3) receptor-auxiliary proteins (TRAPs), and their relationship to the retinoid X receptors (RXRs). Endocrinology 133:965–971[Abstract]
  16. Sugawara A, Yen PM, Qi Y, Lechan RM, Chin WW 1995 Isoform-specific retinoid-X receptor (RXR) antibodies detect differential expression of RXR proteins in the pituitary gland. Endocrinology 136:1766–1774[Abstract]
  17. Gagnon AM, Simboli-Campbell M, Welsh JE 1994 Induction of calbindin D-28K in Madin-Darby bovine kidney cells by 1,25(OH)2D3. Kidney Int 45:95–102[Medline]
  18. Takeda T, Arakawa M, Kuwano R 1994 Organization and expression of the mouse spot35/calbindin-D 28K gene: identification of the vitamin D-responsive promoter region. Biochem Biophys Res Commun 204:889–897[CrossRef][Medline]
  19. Boehm MF, Zhang L, Badea BA, White SK, Mais DE, Berger E, Suto CM, Goldman ME, Heyman RA 1994 Synthesis and structure-activity relationships of novel retinoid X receptor-selective retinoids. J Med Chem 37:2930–2941[CrossRef][Medline]
  20. Sanno N, Sugawara A, Teramoto A, Abe Y, Yen PM, Chin WW, Osamura RY 1997 Immunohistochemical expression of retinoid X receptor isoforms in human pituitaries and pituitary adenomas. Neuroendocrinology 65:299–306[Medline]
  21. Sugawara A, Yen PM, Chin WW 1994 9-cis retinoic acid regulation of rat growth hormone gene expression: potential roles of multiple nuclear hormone receptors. Endocrinology 135:1956–1962[Abstract]
  22. Takahashi N, Takeuchi K, Abe T, Sugawara A, Abe K 1996 Immunolocalization of rat thromboxane receptor in the kidney. Endocrinology 137:5170–5173[Abstract]
  23. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–458[Medline]
  24. Yen PM, Liu Y, Sugawara A, Chin WW 1996 Vitamin D receptors repress basal transcription and exert dominant negative activity on triiodothyronine-mediated transcriptional activity. J Biol Chem 271:10910–10916[Abstract/Free Full Text]
  25. deWet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  26. Edlund T, Walker MD, Barr PJ, Rutter WJ 1985 Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements. Science 230:912–916[Abstract/Free Full Text]
  27. Yen PM, Sugawara A, Chin WW 1992 Triiodothyronine (T3) differentially affects T3-receptor/retinoic acid receptor and T3-receptor/retinoid X receptor heterodimer binding to DNA. J Biol Chem 267:23248–23252[Abstract/Free Full Text]
  28. Bouhtiauy I, Lajeunesse D, Christakos S, Brunette MG 1994 Two vitamin D3-dependent calcium binding proteins increase calcium reabsorption by different mechanisms. I. Effect of CaBP 28K. Kidney Int 45:461–468[Medline]
  29. Bouhtiauy I, Lajeunesse D, Christakos S, Brunette MG 1994 Two vitamin D3-dependent calcium binding proteins increase calcium reabsorption by different mechanisms II. Effect of CaBP 9K. Kidney Int 45:469–474[Medline]
  30. Darwish HM, DeLuca HF 1992 Identification of a 1,25-deoxyvitamin D3-response element in the 5'-flanking region of the rat calbindin D-9k gene. Proc Natl Acad Sci USA 89:603–607[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
J. Adams, E. Kiss, A. B.V. Arroyo, M. Bonrouhi, Q. Sun, Z. Li, N. Gretz, A. Schnitger, C. C. Zouboulis, M. Wiesel, et al.
13-cis Retinoic Acid Inhibits Development and Progression of Chronic Allograft Nephropathy
Am. J. Pathol., July 1, 2005; 167(1): 285 - 298.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Liebler, B. Uberschar, H. Kubert, S. Brems, A. Schnitger, M. Tsukada, C. C. Zouboulis, E. Ritz, and J. Wagner
The renal retinoid system: time-dependent activation in experimental glomerulonephritis
Am J Physiol Renal Physiol, March 1, 2004; 286(3): F458 - F465.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
A. Sugawara, K. Takeuchi, A. Uruno, Y. Ikeda, S. Arima, M. Kudo, K. Sato, Y. Taniyama, and S. Ito
Transcriptional Suppression of Type 1 Angiotensin II Receptor Gene Expression by Peroxisome Proliferator-Activated Receptor-{{gamma}} in Vascular Smooth Muscle Cells
Endocrinology, July 1, 2001; 142(7): 3125 - 3134.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
V. Haxsen, S. Adam-Stitah, E. Ritz, and J. Wagner
Retinoids Inhibit the Actions of Angiotensin II on Vascular Smooth Muscle Cells
Circ. Res., March 30, 2001; 88(6): 637 - 644.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Wagner
Potential role of retinoids in the therapy of renal disease
Nephrol. Dial. Transplant., March 1, 2001; 16(3): 441 - 444.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Li, V. Desai-Yajnik, E. Lo, M. Schapira, R. Abagyan, and H. H. Samuels
NRIF3 Is a Novel Coactivator Mediating Functional Specificity of Nuclear Hormone Receptors
Mol. Cell. Biol., October 1, 1999; 19(10): 7191 - 7202.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Imaizumi, H. Suzuki, M. Yoshinari, A. Sato, T. Saito, A. Sugawara, S. Tsuchiya, Y. Hatae, T. Fujimoto, A. Kakizuka, et al.
Mutations in the E-Domain of RARalpha Portion of the PML/RARalpha Chimeric Gene May Confer Clinical Resistance to All-trans Retinoic Acid in Acute Promyelocytic Leukemia
Blood, July 15, 1998; 92(2): 374 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Prufer, A. Racz, G. C. Lin, and J. Barsony
Dimerization with Retinoid X Receptors Promotes Nuclear Localization and Subnuclear Targeting of Vitamin D Receptors
J. Biol. Chem., December 22, 2000; 275(52): 41114 - 41123.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
I. Lehrke, M. Schaier, K. Schade, C. Morath, R. Waldherr, E. Ritz, and J. Wagner
Retinoid receptor-specific agonists alleviate experimental glomerulonephritis
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F741 - F751.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugawara, A.
Right arrow Articles by Abe, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugawara, A.
Right arrow Articles by Abe, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals