help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huo, B.
Right arrow Articles by Nikodem, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huo, B.
Right arrow Articles by Nikodem, V. M.
Endocrinology Vol. 138, No. 8 3283-3289
Copyright © 1997 by The Endocrine Society

ARTICLES

Identification of a Nuclear Protein from Rat Developing Brain as Heterodimerization Partner with Thyroid Hormone Receptor-ß

Bin Huo1, Beatrice Dozin1,2 and Vera M. Nikodem

Genetics and Biochemistry Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Dr. Vera M. Nikodem, Building 10, Room 8N317, Genetics and Biochemistry Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892. E-mail: veran{at}bldg.10.niddk.nih.gov


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid hormone receptors (TR) are ligand-activated transcription factors that modulate the expression of certain target genes in a developmental and tissue-specific manner. These specificities are determined by the tissue distribution of the TR isoforms {alpha}1 and ß1, the structure of the thyroid hormone response element (TRE) bound by the receptor, and heterodimerization partners. Among these, retinoid X receptors (RXR) have been recognized as the principal partners for TR. The present work reports the identification of a novel nuclear protein from 19-day-old embryonic rat brain that displays a distinct interaction pattern with TR isoforms at the level of the TRE of two genes known to be differentially expressed and regulated by thyroid hormone (T3): the ubiquitous malic enzyme and the brain-specific myelin basic protein. Electrophoretic gel mobility shift assays demonstrate that only TRß1 forms a specific complex with the rat brain nuclear factor on the myelin basic protein-TRE, but not on the malic enzyme-TRE. Thus, the interaction is selectively determined by both the receptor isoform and the structure of the TRE. The expression of this brain nuclear factor is restricted to the perinatal period, when myelination is sensitive to T3. Gel supershift assays with RXR-specific antibodies indicate that this factor is not one of the known RXR isoforms. However, it is most likely a new member of the RXR subfamily because it could be supershifted with an antibody raised against the highly conserved DNA-binding domain of RXRs.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONE (T3) is distinguished by the extent and diversity of effects it exerts on growth, development, and cell differentiation (1, 2). The primary site of initiation of T3 action resides in the nucleus, where the interaction of the hormone with specific nuclear receptors can either enhance or repress the rate of transcription of particular responsive genes (3, 4, 5). This transcriptional response is presumably triggered by the binding of the hormone-receptor complex to a defined sequence within the promoter of the target genes termed the thyroid hormone response element (TRE) (6, 7). The transcriptional response to the hormonal stimulus can be tissue specific and/or linked to well defined stages of development. How this spatial and temporal specificity is determined remains a central question.

The following complexities of the structural features and functional properties of both the TRs and TRE permit great flexibility in these regards. 1) TRs, cellular homologs of the v-erb-A oncogene (8, 9), are encoded by two distinct genes with subsequent alternative splicing of their primary transcripts (10, 11, 12). 2) TR isoforms show a tissue-specific distribution, particularly evident during embryogenesis (13, 14), and they are differentially modulated by the hormone itself (15). 3) the promoter activity of a given responsive gene can be differentially modulated by T3 depending on the TR isoform (16, 17, 18, 19). 4) The sequence and organization of the TREs within target genes appear to be different. These TREs consist of two half-sites of six nucleotides and each half-site has variable degrees of degeneracy from a consensus sequence reported to be AGGTCA (20), but in both the myelin basic protein (MBP) and malic enzyme (ME), TRE is, in fact, AGGACA. Furthermore, these half-sites can be oriented as a direct repeat or as an inverted palindrome (21, 22). 5) TR can bind to TRE as a homodimer (23, 24), or it can heterodimerize with nuclear auxiliary proteins [thyroid hormone receptor auxiliary proteins (TRAPs)], stabilize the binding of the receptor to the TRE and modulate the T3-dependent transcriptional activity. Among TRAPs, retinoid X receptors (RXRs) have been extensively studied. Three different RXR isoforms ({alpha}, ß, and {gamma}) have been well characterized (25), and recently, new RXR subtypes ({delta} and {epsilon}) in a zebra fish complementary DNA library have also been reported (26). In addition, a few other uncharacterized nuclear proteins complexing with TRs were identified in several tissues and cell lines (27, 28, 29).

Therefore, the tissue specificity of T3-dependent regulation of gene expression may be governed by the distribution of the TR isoforms, the structure of the TRE, and/or the availability of other proteins for heterodimerization. As the heterodimerization partners of TR described to date are rather ubiquitously expressed, in the present study we searched for additional tissue-specific nuclear proteins that could differentially dimerize with the TR isoforms and interact specifically with structurally distinct TREs within genes known to be modulated by T3. We focused on the gene encoding MBP and the cytosolic ME, whose expression and regulation by T3 have been well documented. MBP is a major component of myelin and is synthesized in the central and peripheral nervous systems. The transcriptional activity of this gene is regulated by T3 at a well defined stage of early neurological development and appears to fall under preferential control of the TRß1 isoform (16). ME is a lipogenic enzyme constitutively expressed in every tissue. However, its transcriptional control by T3 occurs in only a few tissues (liver, kidney, and heart) (30, 31) and appears to be mediated preferentially by the TR{alpha}1 isoform (16). Herein, we demonstrate that TRß1 interacts on MBP-TRE with a brain nuclear factor whose transient expression is limited to the perinatal stage of cerebral maturation. The interaction is receptor and TRE specific, as this factor does not interact with TR{alpha}1, and the specific complex is not formed on ME-TRE. Furthermore, similar interactions with liver nuclear extracts were not observed. Further characterization using supershift assays revealed that it is most likely another RXR isoform, as it could be detected by the antibody recognizing the highly conserved DNA-binding domain of all known RXR isoforms, but it failed to be supershifted by RXR{alpha}-, RXRß-, and RXR{gamma}-specific antibodies. The distinct timing of expression of the brain nuclear partner for TR suggests a new mechanism for the developmental regulation of MBP expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Recombinant plasmids, DNA probes, and receptors
The DNA fragments used in electrophorectic mobility shift assay (EMSA) contained the 18-bp ME-TRE and MBP-TRE sequences previously shown by transient transfection experiments to mediate responsiveness to T3 induction [ME-TRE18 fragment, -280 to -262: TGGGGTTAGGGGAGGACA (32); MBP-TRE18 fragment, -184 to -167: ACCTCGGCTGAGGACACG (16)]. These sequences, originally cloned into the SphI/BamHI sites of the reporter vector pBLCAT2 (33) were retrieved by HindIII/EcoRI digestion to generate a 61-bp fragment in which the ME-TRE and the MBP-TRE were flanked by identical unrelated vector sequences. The fragments were then labeled with [32P]deoxy-ATP and [32P]deoxy-TTP by fill-in reaction with Klenow DNA polymerase and purified by electrophoresis on 7% polyacrylamide gels. Some experiments involving the MBP-TRE sequence were performed with MBP-TRE (196 to 164: CAGAACAATGGGACCTCGGCTGAGGACACGGGG) (15) without significant differences from the results obtained with the MBP-TRE18 fragment. Generation of plasmids SP72 rat TR{alpha}1 and TRß1 has been described previously (34), and receptors were synthesized using the in vitro transcription/translation TNT reticulocyte kit from Promega (Madison, WI). Mouse RXR{alpha}, RXRß, and RXR{gamma} expression plasmids were gifts from Dr. Kako Ozato.

Preparation of tissue nuclear extracts
Brain and liver were dissected from euthyroid Sprague-Dawley rats (Taconic Farms) at the following developmental stages: 19-day-old embryo; 3, 5, 7, 9, 13, 17, and 20 days after birth; and 2 months old. Nuclear extracts were prepared as described by Murray and Towle (29). The protein concentration of the extracts was determined by colorimetry (Bio-Rad Laboratories, Richmond, CA).

EMSA
Binding reactions were carried out in 20 µl by mixing the following materials: 1 µl nuclear extract diluted to a protein concentration of 2 mg/ml in a buffer containing 25 mM HEPES (pH 7.6), 40 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol; 4 µl binding buffer [100 mM HEPES (pH 7.9), 5 mM dithiothreitol, 10 mM MgCl2, 50% glycerol, and 0.5 mg/ml BSA]; 2 µl (1 mg/ml) poly(dI-dC) as nonspecific competitor; and 5 µl in vitro transcribed/translated receptor or unprogrammed lysate; reactions were adjusted with water to 19 µl. Then, 1 µl 32P-labeled double stranded oligonucleotide probe (10,000 cpm/reaction) was added to the binding reaction and incubated on ice for 30 min, followed by EMSA on 5% polyacrylamide gel. For antibody supershift assay, various antibodies were used according to the provider’s instructions. One microliter of antibody diluted in water (1:40) against the DNA-binding domain of RXR (35, 36) was incubated with the binding reaction mixture in the absence of probe on ice for 60 min, and then the labeled probe was added, and incubation was continued for another 30 min. For the antibodies specific for RXR isoforms (37, 38), 1 µl antibody was added to the binding reaction mixture simultaneously with the labeled probe and incubated on ice for 120 min before electrophoresis. Electrophoresis was carried out at room temperature in 0.5 x TBE buffer. Gels were then dried and autoradiographed at -70 C with intensifying screens. For reverse EMSA, unlabeled DNA fragments were used as probes, and the receptor-DNA complexes were labeled by incubation of TR with 0.04 µCi (10-11 M) [125I]T3 alone or in the presence of nonradioactive T3 (10-7 M). The reverse mobility assays were run on 4–20% linear polyacrylamide gradient gels. These gels were then extensively washed with trichloroacetic acid, acetic acid, and methanol as described previously (39) to elute most of the unbound radioactive T3.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Brain, but not liver or testis, contains a developmentally regulated nuclear protein that interacts specifically with TRß1
The contribution of T3 to the optimal transcription of the nervous system-specific MBP gene occurs during a limited period of postnatal life (40) and appears to preferentially involve the ß1-isoform of TR (16). Hence, by using EMSA, we analyzed the interaction of TRß1 and MBP-TRE with nuclear proteins from the developing rat brain. The binding analysis of TRß1 alone with MBP-TRE revealed the presence of a single retarded band corresponding presumably to a homodimer of the receptor bound to this response element (Fig. 1AGo, lane 1). However, when embryonic brain nuclear extract was added to the receptor, radiolabeled MBP-TRE, a new complex of lower electrophoretic mobility was formed (Fig. 1AGo, lane 2), indicating an interaction of TRß1 with a component present in the extract. In the presence of T3, the complex formed with TRß1 alone dissociated, whereas the complex of slower mobility formed between the TRß1 and nuclear extract remained present (Fig. 1BGo, compare lanes 2 and 3). Thus, TRß1 alone interacts with MBP-TRE as a homodimer, and a heterodimer is formed upon addition of brain embryonic nuclear extract. This heterodimeric complex was already detectable when brain nuclear extract from a 19-day-old embryo was used (Fig. 1AGo, lane 2). The complex was detected with brain nuclear extracts prepared from days 3 and 5 of postnatal life (lanes 3 and 4, respectively), but was nearly absent when brain nuclear extracts from 20-day-old and 2-month-old rats were used (lanes 5 and 6). Additional experiments performed with nuclear extracts prepared from intermediate stages (7–17 days) showed that this putative partner of TRß1 starts disappearing between days 13–15 and is virtually absent by postnatal day 17 (data not shown). The formation of this complex is TR dependent, because no binding of the brain nuclear proteins, even in large excess, was observed on MBP-TRE in the absence of the TR (lanes 7 and 8). Moreover, in the presence of TRß1, the complex was formed in proportion to the amount of nuclear extract used, whereas the band corresponding to TR alone progressively disappeared (data not shown).



View larger version (54K):
[in this window]
[in a new window]
  		Figure 1. Interaction of brain nuclear proteins and TRß1 with MBP-TRE. The EMSA was performed with 32P-labeled MBP-TRE and in vitro synthesized TRß1 either alone (A, lane 1; B, lane 1) or in the presence of brain nuclear extract (BNE) prepared from the following developmental stages: 19-day embryo (EM), (A, lane 2; B, lanes 2 and 3); 3-, 5-, and 20-day-old newborn (A, lanes 3, 4, and 5, respectively); and 2-month-old rat (AD; A, lane 6). In lanes 7 and 8 are shown increasing amounts of brain nuclear proteins alone (2.5 and 5.7 µg, respectively) from a 3-day-old rat. T3 (10-7 M) was added to the incubation reaction (B, lane 3). P, MBP-TRE free probe. The star indicates TRß1 bound to MBP-TRE; the filled upper arrow denotes the brain-TRß1 complex; the open arrow indicates nonspecific bands generated from the reticulocyte lysate. Complexes were resolved on a 5% polyacrylamide gel.

 
In the developing brain, in addition to TRß1, TR{alpha}1 is present, although its level during brain maturation does not appear to increase, unlike that of TRß1 (14). Thus, we also investigated TR{alpha}1 interaction with MBP-TRE alone and in the presence of brain embryonic and adult nuclear extracts. As shown in Fig. 2AGo, TR{alpha}1 alone bound to MBP-TRE (lane 1); however, no additional complexes were observed in the presence of any brain nuclear extracts (lanes 2 and 3).



View larger version (67K):
[in this window]
[in a new window]
  		Figure 2. Specific interaction of TRs with brain and liver nuclear extracts on MBP and ME-TREs using EMSA. A, TR isoform specificity. In vitro prepared TR{alpha}1 was used alone (lane 1) or together with 2.6 µg brain nuclear proteins from a 19-day-old embryo (EM; lane 2) or a 2-month-old rat (AD; lane 3) with 32P-labeled MBP-TRE. The complexes were resolved on a 4–20% polyacrylamide gradient gel. B, Interaction of liver nuclear proteins with TRß1 and MBP-TRE. Lane 1, TRß1 alone; lanes 2, 3, and 4, 2 µg liver nuclear extracts (LNE) prepared from 3-day-old (3 d), 20-day-old (20 d), and 2-month-old (AD) rats were combined with in vitro synthesized TRß1 and 32P-labeled MBP-TRE. Complexes were resolved on a 5% polyacrylamide gel. C, Interaction of TRß1 and BNE with ME-TRE. EMSAs were performed with 32P-labeled ME-TRE and TRß1, either alone (lane 1) or combined with 2.6 µg brain nuclear proteins from a 19-day-old embryo (EM) or a 2-month-old rat (AD; lanes 2 and 3, respectively). Complexes were resolved on a 4–20% polyacrylamide gradient gel. P, Free MBP or ME-TRE probe. The star denotes the TRß1 bound to 32P-labeled MBP or ME-TRE in the absence or presence of brain nuclear proteins; the open arrow refers to nonspecific bands seen with the reticulocyte lysate alone.

 
Interestingly, when brain nuclear extract was replaced by nuclear extract from rat liver prepared from several developmental stages (postnatal days 3 and 20 and adult; Fig 2BGo, lanes 2–4), only one retarded band corresponding to the complex TRß1/MBP-TRE was observed. In addition, testis nuclear proteins failed to interact with TRß1 on MBP-TRE (data not shown).

Interaction of TRß1 with embryonic brain nuclear protein is TRE specific
Next, we examined whether the structure of TRE determines the capability of TRß1 to heterodimerize with embryonic brain nuclear protein. It has been documented that hormone response elements that are structurally quite different can also mediate similar hormone responsiveness, such as those conferring control by T3: for example, the rat ME-TRE, in which the half-sites are arranged as a direct repeat separated by four nucleotides, and MBP-TRE, which contains an inverted repeat. As shown in Fig. 2CGo, TRß1 can bind to ME-TRE (lane 1), but no new complex was observed upon inclusion of either embryonic or adult brain nuclear extract (lanes 2 and 3). Therefore, it appears that the structure of the MBP-TRE is important in determining the formation of the brain nuclear factor-TRß1 complex.

Finally, we investigated whether the interaction of TRß1 with brain nuclear factor affects T3 binding to the receptor. As thyroid hormone receptors are classified as ligand-activated transcription factors, it was important to assess whether TRß1, when complexed with the brain nuclear protein, retained T3 binding. Reverse mobility assays were performed in which [125I]T3 was used as the labeled source in the presence of unlabeled MBP-TRE. The complexes formed were then resolved on polyacrylamide gradient gels. Under these conditions, as shown in Fig. 3Go, the complex formed between TRß1 and brain nuclear factor on unlabeled MBP-TRE bound [125I]T3 (lane 3), and the binding was of high specificity, as the bands disappeared in the presence of an excess amount of competitor (lane 4).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 3. Binding of [125I]T3 to the complexed TRß1 with MBP-TRE. The position of TRß1 containing complexes was identified using the 32P-labeled MBP-TRE as described in Materials and Methods. Lane 1, TRß1 alone; lane 2, in the presence of 1.8 µg BNE. Reverse EMSAs were performed by incubating together unlabeled MBP-TRE, TRß1, 10-11 M [125I]T3, and 1.8 µg BNE from a 5-day-old rat (lane 3). Lane 4, Same as lane 3, except that unlabeled T3 (10-7 M) was included as a competitor. Complexes were resolved on a 4–20% gradient gel. The arrow indicates the TRß1/BNE complexed with MBP-TRE; the star denotes TRß1/MBP-TRE complex; the arrowhead shows the migration of free [125I]T3.

 
The brain nuclear partner of TRß1 is not one of the known isoforms of RXR
It is well established that the RXR isoforms {alpha}, ß, and {gamma} are the principal heterodimerization partners of many members of the steroid/thyroid receptor superfamily, such as TR, retinoic acid, and vitamin D receptors, etc. (41) Moreover, the members of the RXR family, although ubiquitously expressed in the adult tissues, display unique tissue-specific distribution patterns during embryogenesis (25). In particular, RXR{gamma} is the isoform predominantly expressed in the nervous system of mouse embryo at perinatal stages (25). Thus, the possibility exists that the brain nuclear protein we identified could be one of the known RXR isoforms. Antibody supershift assays were used to address this issue. A single antibody generated against the highly conserved DNA-binding domain of RXR{alpha}, -ß, and -{gamma} (35, 36) supershifted the heterodimeric complex containing brain nuclear protein and TRß1 formed on MBP-TRE (Fig 4AGo). The control experiments confirmed that the heterodimerization complexes formed between TRß1 and each of the known RXR isoform on MBP-TRE were all supershifted using this antibody (data not shown). Hence, these results suggested that either the putative heterodimerization partner present in embryonic brain nuclear extract is one of the three known RXR isoforms, or it may represent a novel RXR isoform characterized by the highly conserved DNA-binding domain. To investigate further, three RXR isoform-specific antibodies generated against the amino-terminal region, which is the most dissimilar among individual RXR isoforms (37, 38), were tested in antibody supershift assays. As shown in Fig. 4BGo, none of the RXR isoform-specific antibodies supershifted TRß1-brain nuclear extract complex (lanes 9, 10, and 11). However, in the control experiment, heterodimeric complexes formed with TRß1 and RXR{alpha}, RXRß, and RXR{gamma} were identified by respective antibodies (Fig. 4BGo, lanes 3, 5, and 7, respectively). Thus, our results suggest that the nuclear protein present in embryonic and early postnatal brains that forms a complex with TRß1 on MBP-TRE contains a RXR-related TRß1 heterodimerization partner, but excludes the known RXR{alpha}, -ß, and -{gamma} isoforms. These data suggest that this novel TRß1 heterodimerization partner plays an important role in T3 action during early brain development.



View larger version (46K):
[in this window]
[in a new window]
  		Figure 4. Characterization of a brain nuclear protein in TRß1 MBP-TRE complex with RXR antibodies. A, Mouse monoclonal antibody raised against DNA-binding domain of the RXR family. In vitro synthesized TRß1 was incubated with 32P-labeled MBP-TRE alone (lane 1) or with 2 µg of embryonic BNE (lane 2). One microliter of RXR antibody was incubated with TRß1 and embryonic BNE (lane 3) as described in Materials and Methods. B, RXR isoform-specific antibodies. In vitro synthesized TRß1 (lane 1) was incubated with in vitro prepared RXR{alpha} (lane 2), RXRß (lane 4), and RXR{gamma} (lane 6). Then, 1 µl of specific antibodies against RXR{alpha} (lane 3), RXRß (lane 5), and RXR{gamma} (lane 7) was added to the reaction mixture along with 10,000 cpm 32P-labeled MBP-TRE as described in Materials and Methods. Lanes 8–11 contain TRß1 complexed with 2 µg embryonic brain nuclear extract (BNE) and 1 µl of antibodies specific for RXR{alpha} (lane 9), RXRß (lane 10), and RXR{gamma} (lane 11). After 2-h incubation with antibodies on ice, the samples were subjected to electrophoresis on a 5% polyacrylamide gel as described in Materials and Methods. P, MBP-TRE free probe. The star indicates the TRß1-TRE complex; the filled arrow marks the TRß1 heterodimers formed between either RXRs or a brain nuclear extract. The arrowhead denotes the supershifted complexes, and the open arrow designates a nonspecific band.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The members of the steroid/thyroid nuclear receptor superfamily are important biological effectors that can initiate or reprogram transcriptional activity in response to hormonal stimuli. Some members of this superfamily share the ability to heterodimerize with the RXR isoforms that are considered to be primary dimerization partners (41, 42). This cross-talk among hormonal pathways provides a means of achieving the diversity and specificity necessary in the regulation of the numerous hormone-responsive genes. This concept may have to be extended with respect to thyroid hormones, as TRs have also been shown to possibly heterodimerize with several other nuclear proteins (TRAPs) whose structures and functions await further characterization (27, 28, 29). Recently, several transcriptional corepressors and coactivators for thyroid and steroid hormone receptor superfamily have been identified (43, 44, 45). These proteins represent a new class of cofactors important in mediating hormone dependent trans-activation or repression.

We observed that TRß1 forms a specific complex with MBP-TRE with a developmentally regulated brain nuclear factor. This interaction is selective, as the nuclear factor is expressed in early stages of brain development and is absent in liver and testis, as assessed by EMSA. In addition, formation of heterodimeric complexes is dictated by the TR isoform and TRE structure. Our results show that a new complex can be detected only in the presence of TRß1 and MBP-TRE. Thus, it is likely that this nuclear accessory protein may contribute to the tissue- and development-specific regulation of MBP gene by T3. It has been well documented that the expression of TR genes is tissue specific. A systematic quantitation of receptor isoform messenger RNA (mRNA) suggests that in the rat, the brain has the highest level of TRß1 mRNA, followed in descending order by the liver, kidney, and heart (14). Interestingly, in the neonatal rat brain, the level of TRß1 mRNA is practically undetectable until embryonic day 19. At this time, the levels of TR{alpha} isoforms are already close to their adult maximum. The rise in the level of TRß1 commences on embryonic day 19 and reaches its maximal level by postnatal day 10. The temporal association of these events raises the possibility that the surge in TRß1 is prerequisite to the developmental effects of thyroid hormone.

Of interest is the pattern of heterodimerization of TRß1 with the brain nuclear factor on MBP-TRE. The expression of this factor appears to be not only developmentally regulated, but also restricted to the first few weeks of postnatal life, when overall brain maturation is directly dependent on T3 (46, 47). It is remarkable that during this period, which coincides with oligodendrocyte differentiation and axon myelination (47), the level of TRß1 mRNA rises 40-fold together with the level of T3 (14), and that the rate of MBP gene transcription is controlled by thyroid hormones (40). This concomitance of events suggests that the brain nuclear partner of TRß1 might be involved in the developmental regulation of MBP gene expression by T3 and supports the hypothesis previously proposed by Strait et al. (18) that TRß1 may play a major role in brain development.

Although the nature of the brain nuclear factor remains to be elucidated, the antibody supershift assays employing RXR common and isoform-specific antibodies indicate that this factor is not one of the known RXR isoforms, namely RXR{alpha}, RXRß, or RXR{gamma}; however, it appears to be a new member of the RXR subfamily. The heterodimerization of TR with RXRs has been extensively characterized, yet other proteins might have the ability to heterodimerize with TR in target tissues in a specific developmentally regulated manner. The tissue distribution of three well characterized RXR isoforms has been well documented (25). Northern blot analyses of whole embryo mRNA revealed that all three RXRs are expressed from at least day 10.5 postconception to parturition. As in the adult, RXR{alpha} and RXRß mRNAs are abundant, whereas RXR{gamma} mRNA is present at a much lower level. In situ hybridization using 16.5-day-old mouse embryo has shown that RXR{alpha} transcript is found predominantly in the epithelia of the digestive system, skin, and liver. Its expression is constitutively low in the central nervous system and skeleton (25). In contrast, RXRß is expressed in all tissues. Interestingly, the RXR{gamma} transcript is the most restricted, with a lower expression in the embryo and adult. Pituitary has been shown to be the prominent tissue in which RXR{gamma} is expressed. Although the brain nuclear factor could be RXR related, our gel supershift studies appear to exclude the possibility that the brain nuclear factor that we identified is one of the known RXR isoforms.

The physiological relevance of the heterodimeric complexes remains unclear. The TR heterodimerization partners may promote the high affinity binding of TR to its cognate response element and modulate trans-activation of the target gene. The stabilization of TR binding to DNA may, therefore, provide an additional level of control of the transcriptional response to T3. We speculate that the embryonic brain nuclear factor may act as an auxiliary protein to modulate target gene expression by T3 during brain development, and it may either act as a repressing factor to prevent premature expression of specific genes or as an activator to stimulate transiently the expression of developmentally regulated genes. Yet to be accomplished is the cloning of the gene for this factor, which should help to determine its importance during brain development.


   Acknowledgments
 
We thank Dr. Pierre Chambon for providing antibody against RXR DNA- binding domain, Dr. William W. Chin for providing RXR isoform-specific antibodies, and Dr. K. Ozato for providing RXR expression plasimds. We also thank Dr. J. E. Rall and J. Robbins for manuscript review.


   Footnotes
 
1 B.H. and B.D. contributed equally to the work Back

2 Present address: Istituto Nazionale per la, Ricerca sul Cancro, Viale Benedetto XV, n-10, 16132 Genova, Italy. Back

Received October 24, 1996.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Baulieu EE, Kelly PA (eds) 1990 Hormones: From Molecules to Diseases. Hermann, Paris
  2. Tata JR 1984 The action of growth and developmental hormones. In: Goldberger RF, Yamamoto KR (eds) Biological Regulation and Development. Plenum Press, New York, pp 1–58
  3. Chin WW 1991 Nuclear thyroid hormone receptors. In: Parker M (ed) Nuclear Hormone Receptors. Academic Press, London, pp 79–102
  4. Glass CK, Holloway JM 1990 Regulation of gene expression by the thyroid hormone receptor. Biochim Biophys Acta 1032:157–176[Medline]
  5. Nikodem VM, Petty KJ, Mitsuhashi T, Desvergne B 1990 Structure and mechanism of action of thyroid hormone receptors. In: Greer MA (ed) The Thyroid Gland. Raven Press, New York, pp 307–321
  6. Forman BM, Samuels HH 1990 Interactions among a subfamily of nuclear hormone receptors: the regulatory zipper model. Mol Endocrinol 4:1293–1301[Abstract/Free Full Text]
  7. Glass CK, Franco R, Weinberger C, Albert V, Evans RM, Rosenfeld MG 1987 A c-erb-A binding site in the rat growth hormone gene mediates transactivation by thyroid hormone. Nature 329:738–741[CrossRef][Medline]
  8. Sap J, Munoz A, Damm K, Goldberg Y, Ghysdael J, Lutz A, Beug H, Vernstrom B 1985 The c-erb-A protein is a high-affinity receptor for thyroid hormone. Nature 324:635–640
  9. Weinberger C, Thompson CC, Ong ES, Lebo R, Gruol DJ, Evans RM 1986 The c-erb-A gene encodes a thyroid hormone receptor. Nature 324:641–646[CrossRef][Medline]
  10. Hodin RA, Lazar MA, Wintman BI, Darling DS, Koenig RJ, Larsen PR, Moore DD, Chin WW 1989 Identification of a thyroid hormone receptor that is pituitary-specific. Science 244:76–79[Abstract/Free Full Text]
  11. Izumo S, Mahdavi V 1988 Thyroid hormone receptor {alpha} isoforms generated by alternative splicing differentially activate myosin heavy chain gene transcription. Nature 334:539–542[CrossRef][Medline]
  12. Mitsuhashi T, Tennyson GE, Nikodem VM 1988 Alternative splicing generates message encoding rat c-erb-A proteins that do not bind thyroid hormone. Proc Natl Acad Sci USA 85:5804–5808[Abstract/Free Full Text]
  13. Forrest D, Sjoberg M, Vernstrom B 1990 Contrasting developmental and tissue-specific expression of {alpha} and ß thyroid hormone receptor genes. EMBO J 9:1519–1528[Medline]
  14. Strait KA, Schwartz HL, Perez-Castillo A, Oppenheimer JH 1990 Relationship of c-erb-A mRNA content to tissue triiodothyronine nuclear binding capacity and function in developing and adult rats. J Biol Chem 265:10514–10521[Abstract/Free Full Text]
  15. Hodin RA, Lazar MA, Chin WW 1990 Differential and tissue-specific regulation of multiple rat c-erb-A messenger RNA species by thyroid hormone. J Clin Invest 85:101–105
  16. Farsetti A, Desvergne B, Hallenbeck P, Robbins J, Nikodem VM 1992 Characterization of myelin basic protein thyroid hormone response element and its function in the context of native and heterologous promoter. J Biol Chem 267:15784–15788[Abstract/Free Full Text]
  17. Lezoualc’h F, Hassan AHS, Giraud P, Loeffer P, Lee SL, Demeneix BA 1992 Assignment of the ß-thyroid hormone receptor to 3,5,3'-triiodothyronine-dependent inhibition of transcription from the thyrotropin releasing hormone promoter in chick hypothalamic neurons. Mol Endocrinol 6:1797–1804[Abstract/Free Full Text]
  18. Strait KA, Zou L, Oppenheimer JH 1992 ß1-Isoform specific regulation of a triiodothyronine induced gene during cerebellar development. Mol Endocrinol 6:1874–1880[Abstract/Free Full Text]
  19. Thompson CC, Evans RM 1989 Transactivation by thyroid hormone receptors: functional parallels with the steroid hormone receptors. Proc Natl Acad Sci USA 86:3494–3498[Abstract/Free Full Text]
  20. Brent GA, Harney JW, Chen Y, Warne RL, Moore DD, Larsen PR 1989 Mutations of the rat growth hormone promoter which increase and decrease responses to thyroid hormone response element. Mol Endocrinol 3:1996–2004[Abstract/Free Full Text]
  21. Naar AM, Boutin JM, Lipkin SM, Yu VC, Holloway JM, Glass CK, Rosenfeld MG 1991 The orientation and spacing of core DNA-binding motifs dictate selective transcriptional responses to three nuclear receptors. Cell 65:1267–1279[CrossRef][Medline]
  22. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  23. Holloway JM, Glass CK, Adler S, Nelson CA, Rosenfeld MG 1990 The C-terminal interaction domain of the ability of the DNA site to dictate positive or negative transcriptional activity. Proc Natl Acad Sci USA 87:8160–8164[Abstract/Free Full Text]
  24. Lazar MA, Berrodin TJ, Harding HP 1991 Differential DNA binding by monomeric, homodimeric and potentially heterodimeric forms of the thyroid hormone receptor. Mol Cell Biol 11:5005–5015[Abstract/Free Full Text]
  25. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou ZY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of the RXR genes that mediate the action of 9-cis retinoic acid. Gene Dev 6:329–344[Abstract/Free Full Text]
  26. Jones BB, Ohno CK, Allenby G, Boffa MB, Levin AA, Grippo JF, Petkovich M 1995 New retinoid X receptor subtypes in zebra fish (Danio rerio) differentially modulate transcription and do not bind 9-cis retinoic acid. Mol Cell Biol 15:5226–5234[Abstract]
  27. Beebe JS, Darlign DS, Chin WW 1991 3,5,3'-Triiodothyronine receptor auxiliary protein (TRAP) enhances receptor binding by interactions within the thyroid hormone response element. Mol Endocrinol 5:85–93[Abstract/Free Full Text]
  28. Burnside J, Darling DS, Chin WW 1990 A nuclear factor that enhances binding of thyroid hormone receptors to thyroid hormone response elements. J Biol Chem 265:2500–2504[Abstract/Free Full Text]
  29. Murray MB, Towle HC 1989 Identification of nuclear factors that enhance binding of the thyroid hormone receptor to a thyroid hormone response element. Mol Endocrinol 3:1434–1442[Abstract/Free Full Text]
  30. Dozin B, Magnuson MA, Nikodem VM 1985 Tissue-specific regulation of two functional malic enzyme mRNA by triiodothyronine. Biochemistry 24:5581–5586[CrossRef][Medline]
  31. Dozin B, Magnuson MA, Nikodem VM 1986 Thyroid hormone regulation of malic enzyme synthesis: dual tissue-specific control. J Biol Chem 261:10290–10292[Abstract/Free Full Text]
  32. Desvergne B, Petty KJ, Nikodem VM 1991 Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element. J Biol Chem 266:1008–1013[Abstract/Free Full Text]
  33. Luckow B, Schutz G 1987 CAT construction with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
  34. Petty KJ, Desvergne B, Mitsuhashi T, Nikodem VM 1990 Identification of a thyroid hormone response element in the malic enzyme gene. J Biol Chem 265:7395–7340[Abstract/Free Full Text]
  35. Rochette-Egly C, Lutz Y, Saunders M, Scheuer I, Gaub MP, Chambon P 1991 Retinoic acid receptor {gamma}: specific immunodetection and phosphorylation. J Cell Biol 115:535–545[Abstract/Free Full Text]
  36. Fisher GJ, Talwar HS, Xiao JH, Datta SC, Reddy, AP, Caub MP, Rochette-Egly C, Chambon, P, Voorhees JJ 1994 Immunological identification and functional quantitation of retinoic acid and retinoid X receptor proteins in human skin. J Biol Chem 269:20629–20635[Abstract/Free Full Text]
  37. Sugawara A, Yen PM, Qi Y, Lechan RM, Chin WW 1995 Isoform-specific retinoid-X receptor (RXR) antibodies detect differential expression of RXR proteins in the pituitary gland. Endocrinology 136:1766–1774[Abstract]
  38. Spanjaard RA, Sugawara A, Ikeda M, and Chin WW 1995 Evidence that retinoid X receptors mediate retinoid-dependent transcriptional activation of the retinoic acid receptor ß gene in S91 melanoma cells. J Biol Chem 270:17429–17436[Abstract/Free Full Text]
  39. Dozin B, Cahnmann HJ, Nikodem VM 1985 Identification of thyroid hormone receptors in rat liver nuclei by photoaffinity labeling with L-thyroxine and triiodo-L-thyronine. Biochemistry 24:5197–5202[CrossRef][Medline]
  40. Farsetti A, Mitsuhashi T, Desvergne B, Robbins J, Nikodem VM 1991 Molecular basis of thyroid hormone regulation of myelin basic protein gene expression in rodent brain. J Biol Chem 266:23226–23232[Abstract/Free Full Text]
  41. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM 1992 Retinoic X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signaling. Nature 355:446–449[CrossRef][Medline]
  42. Bugge TH, Pohl J, Lonnoy O, Stunnenberg HG 1992 RXR{alpha}, a promiscuous partner of retinoic acid and thyroid hormone receptors. EMBO J 11:1409–1418[Medline]
  43. Horlen AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–403[CrossRef][Medline]
  44. Chen JD, Evan RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  45. Onate SA, Tsai SY, Tsi MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the thyroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  46. Legrand J 1967 Variations as a function of age of the response of the cerebellum to the morphogenetic action of the thyroid in rats. Microsc Morphol Exp 56:291–307
  47. Schwartz HL 1983 Effect of thyroid hormone on growth and development. In: Oppenheimer JH, Samuels HH (eds) Molecular Basis of Thyroid Hormone Action. Academic Press, New York, pp 413–444



This article has been cited by other articles:


Home page
 DevelopmentHome page
R Josephson, T Muller, J Pickel, S Okabe, K Reynolds, P. Turner, A Zimmer, and R. McKay
POU transcription factors control expression of CNS stem cell-specific genes
Development, January 8, 1998; 125(16): 3087 - 3100.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huo, B.
Right arrow Articles by Nikodem, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huo, B.
Right arrow Articles by Nikodem, V. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals