| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Tupper Research Institute and Department of Medicine, Division of Endocrinology, Diabetes, Metabolism and Molecular Medicine (G.L., R.M.L.), New England Medical Center; Thyroid Division, Department of Medicine, Brigham and Womens Hospital and Harvard Medical School (H.M.T., S-W.K., D.S., T.B., P.R.L.); and Department of Neuroscience, Tufts University School of Medicine (R.M.L.), Boston, Massachusetts 02111
Address all correspondence and requests for reprints to: Ronald M. Lechan, Division of Endocrinology, Box 268, New England Medical Center, 750 Washington Street, Boston, Massachusetts 02111.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
With the recent molecular characterization of the rat and human D2 (7, 8), new probes for the anatomical and physiological study of D2 in the brain have become available. By Northern blot hybridization, Croteau et al. (7) reported the presence of D2 messenger RNA (mRNA) in several regions of the rat and human brain, although they did not analyze the hypothalamus. We used D2 mRNA probes, therefore, to identify the specific locations of D2 transcripts in the rat hypothalamus and pituitary gland by in situ hybridization histochemistry, Northern blots, and quantitative competitive PCR.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In situ hybridization histochemistry
For in situ hybridization histochemistry, five
animals in each of the hypothyroid and control groups were weighed,
overdosed with pentobarbital, and perfused through the ascending aorta
with 0.01 M PBS, pH 7.2, containing 15,000 U/liter heparin
sulfate for 30–60 sec, followed by 4% paraformaldehyde in PBS for 15
min. Venous blood was collected from the inferior vena cava for
measurement of T4 and T3. Brains were removed,
postfixed by immersion in the same fixative for 6 h, and placed in
20% sucrose in PBS at 4 C overnight. Coronal tissue sections (18 µm)
through the forebrain and pituitary gland were obtained on a cryostat
(Reichert-Jung 2800 Frigocut-E, Leica, Deerfield, IL) and adhered to
Superfrost Plus glass slides (Fisher Scientific Co., Pittsburgh, PA).
The sections were desiccated overnight by heating at 42 C and stored at
-80 C until prepared for in situ hybridization
histochemistry.
The hybridization protocol was based on methods previously reported from our laboratories (9, 10). Tissue sections were hybridized with a single stranded [35S]uridine triphosphate-labeled complementary RNA probe generated from a linearized 1.4-kilobase (kb) rat D2 (rD2) complementary DNA (cDNA) in Bluescript SK vector (pBS-SK) kindly provided by Drs. St. Germain and Galton (7). The plasmid was linearized with BamHI (at position 421) and transcribed with T7 polymerase. As a control, we linearized the same plasmid with XhoI and transcribed sense RNA with T3 polymerase. The rat D2 antisense probe contained the entire 788 nt coding region and approximately 160 nt 5' untranslated region. The same sequences were included in the sense RNA. Hybridization was performed under plastic coverslips in buffer containing 50% formamide, a 2-fold concentration of standard sodium citrate (2x SSC), 10% dextran sulfate, 0.25% BSA, 0.25% Ficoll 400, 0.25% polyvinylpyrolidone 360, 250 mM Tris (pH 7.5), 0.5% sodium pyrophosphate, 0.5% SDS, 250 mg/ml denatured salmon sperm DNA, and 6 x 105 cpm of the radiolabeled probe for 16 h at 55 C. Slides were dipped into Kodak NTB2 autoradiography emulsion (Eastman Kodak, Rochester, NY), and the autoradiograms developed after 6 days of exposure at 4 C. After being cleared in graded solutions of ethanol and Histosol (National Diagnostics, Atlanta, GA), the sections were coverslipped in Histomount (National Diagnostics) and the autoradiograms visualized and photographed under dark-field illumination with a Zeiss photomicroscope III (Carl Zeiss Inc., Thornwood, NY) or Olympus BX60 (Olympus America Inc., Lake Success, NY) binocular microscope.
Northern analysis
Seven euthyroid animals were deeply anesthesized by
pentobarbital and decapitated. Trunk blood was collected for RIA of
T3 and T4. The brain was rapidly removed from
the calvarium, and the region of the basal hypothalamus containing the
ARC-ME was removed by gross dissection under a binocular microscope
using iridectomy scissors and then snap frozen. Landmarks for
dissection included the anterior, posterior, and lateral boundaries of
the ME. The pituitary was removed from the sella turcica by disrupting
the diaphragma with a 30-gauge needle and similarly frozen. RNA was
isolated according to the single-step RNA isolation method of
Chomczynski (11), using TriZoL (Gibco, Gaithersburg, MD). Thirty
micrograms of total RNA was electrophoresed through 1% agarose/1.85%
formaldehyde/2 µg ethidium bromide/1 x
3-(N-morpholino)-propanesulfonic acid gel at room temperature. RNA was
transferred by capillary action with 10x SSC according to the
manufacturer’s recommendations (Genescreen Plus, NEN Life Sciences,
Boston, MA), and completion of transfer was verified by the presence of
all of the 0.24–9.5-kb RNA molecular weight marker bands (BRL,
Gaithersburg, MD) as well as the 28S and 18S ribosomal RNA. RNA was
fixed to the nylon membrane by UV cross-linking with the Stratalinker
(Stratagene, La Jolla, CA).
Northerns were hybridized for D2 mRNA under high stringency conditions (40% formamide/2x Denhardt’s reagent/0.64 M NaCl/40 mM PO4, pH 5.6/0.8 mM EDTA pH 7.4/7% dextran sulfate/1.6% SDS/80 µg/ml denatured sonicated thymus DNA at 42 C). D2 probed Genescreen Plus filters were washed sequentially three times with 2x SSC/0.1% SDS at RT, once with 2x SSC/0.1% SDS at 42 C, and once with 0.5x SSC/0.1% SDS at 42 C. Blots were autoradiographed for 1 week with an intensifying screen at -80 C.
A cDNA probe was made by random priming of template DNA with
[
32P]deoxycytidine triphosphate. A 0.95-kb fragment of
rD2 in pBS-SK containing small portions of the 5' and 3' flanking
regions and 788 nt of coding region (kindly provided by D. St. Germain
and V.A. Galton) (7) was gel purified for the D2 template. Quantitation
of hybrization signals was done with a scanning densitometer and
Molecular Dynamics software v.3.1 (Sunnyvale, CA).
Quantitative RT-PCR
For quantitative RT-PCR, two groups of animals were studied. In
one experiment, six animals in each of three groups (control,
hypothyroid, and hyperthyroid) were weighed, overdosed with
pentobarbital or anesthetized with CO2, and decapitated
with a rodent guillotine. Trunk blood was obtained for RIA of
T4 and T3, and the brain rapidly removed from
the calvarium for dissection. A region of the hypothalamus that
included the entire ME, stalk, and ARC was dissected from the base of
the brain with iridectomy scissors as described above (ARC-ME). Tissue
fragments from two animals were pooled in a sterile Eppendorf tube and
snap frozen. The remainder of the hypothalamus (referred to as residual
hypothalamus or RH) was removed with iridectomy scissors as a cone
using the optic chiasm as the anterior boundary, medial mammillary body
as the posterior boundary, and lateral edge of the hypothalamus at the
border of the pyriform lobes as the lateral boundaries and immediately
frozen with liquid nitrogen in a piece of aluminum foil.
To obtain tissue fragments of the hypothalamus that corresponded more closely to the distribution of D2 mRNA seen by in situ hybridization histochemistry, a separate experiment was performed in which the forebrains of three euthyroid and three hypothyroid animals were snap frozen in hexanes with dry ice and sectioned coronally with stainless steel razor blades on a specially designed template to obtain three regions of the hypothalamus, each approximately 1.5 mm thick; the preoptic region, a midregion of the hypothalamus defined by the rostral-caudal extent of the optic chiasm, and a caudal region containing the full rostral-caudal extent of the ME. The sections were transferred to glass slides and kept frozen on a slab of dry ice. The caudal region of the hypothalamus was further dissected with a microscalpel to obtain a fragment of tissue containing the entire ME and stalk, the region of the third ventricle extending from the rostral border of the ME to the infundibular recess, ARC, dorsomedial nucleus, and medial portions of the ventromedial nucleus using the fornix as lateral boundaries, and the top of the third ventricle as a dorsal boundary (ARC-ME). For comparison with the ARC-ME region, other portions of the hypothalamus were sampled by punching the tissue with 1.0-mm hollow needles; the paraventricular nucleus (PVN), from the midregion of the hypothalamus at the dorsal limits of the third ventricle and the lateral hypothalamus (LH), from the mid- and caudal regions of the hypothalamus. Punches from the CC were also obtained. The tissue fragments from each animal were expelled into Eppendorf tubes and snap frozen. Pituitary glands from the three euthyroid and three hypothyroid rats were removed from the sella turcica, the AP dissected free from the neural lobe/intermediate lobe (NL), and frozen individually.
RNA was isolated from the AP, NL, and each of the microdissected regions of the brain in the eu-, hypo-, and hyperthyroid rats using TriZoL reagent. Tissues from two identically treated animals were pooled for each sample in the first study, and in the second, isolated fragments from individual rats were used as described above. RNA from AP and the remainder of the hypothalamus from which the ARC-ME had been removed was adjusted to 1 µg/µl in RNase-free water (diethylprocarbonate-H2O). For the RNA isolation from NL, ARC-ME, PVN, and CC, 5 µg transfer RNA carrier was added to the TriZoL, and total RNA was isolated. The total RNA was dissolved in 10 µl diethylprocarbonate-H2O. For the 20-µl RT reaction, 1 µl RNA was mixed with 0.25 µM of either rD2-specific antisense primer (nt 1381–1358) or rat cyclophilin (rCyc)-specific antisense primer (nt 557–534), 0.5 mM deoxynucleotide triphosphates, 0.6 U/µl RNasin (Promega, Madison, WI), 10 mM deoxynucleotide triphosphate, and 10 U/µl Moloney Murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) and incubated 90 min at 37 C. Then, the reaction mixture was heated to 95 C for 5 min.
For the competitive PCR, the rat D2 partial cDNA clone 5–1 in pBS-SK (see above) was used to prepare a mutant D2 plasmid (7). This clone contains a portion of the 5' untranslated region and the entire coding region, which are located in the extreme 5' portion of the mRNA based on homology with the human D2 gene (our unpublished observations). To construct a mutant rD2 plasmid, a 156-bp fragment between two BsaAI restriction sites (nt 688–843) within the coding region was deleted and the plasmid re-ligated. The sense primer for the PCR (D2-S) was nt 545 GAGTGCACAGGAGACTGACTG 645 and the antisense primer (D2-A) was nt 1350 CTTCTCCAGCCAACTTCGGAC 1330 from the EcoRI 5' cloning site. To construct a rCyc mutant plasmid, a cDNA clone of the rat mRNA encoding Cyc (p1B15) (12) was used in which a 126-bp fragment between two NcoI restriction sites (nt 339–464) within the coding region was deleted and the plasmid re-ligated. The sense primer (Cyc-S) was 7 AGACGCCGCTGTCTCTTTTCG 27, and the antisense primer (Cyc-A) was 527 CCACAGTCGGAGATGGTGATC 507 from the transcription start site of the clone p1B15.
For quantitation of the RT product, competitive PCR was performed as
previously reported (13) with minor modifications. For the D2
amplification in a 40-µl PCR reaction, 4 µl RT product was mixed
with 2 mM MgSO4, 10 mM KCl, 20
mM Tris-HCl (pH 8.8), 10 mM
(NH4)2SO4, 0.1% Triton X-100, 1.4
µM sense and antisense primers (D2-S and D2-A), 100
nM deoxynucleotide triphosphates, 75 nCi/µl
P32-[]deoxycytidine triphosphate, 0.3125–2.5 pg
mutant rD2 containing plasmid (mrD2), and 12.5 mU/µl Vent DNA
polymerase (New England Biolabs, Beverly, MA). Subsequently, 30–35
cycles of PCR amplification were carried out with denaturation at 95 C
for 1 min, annealing at 61 C for 1 min, and extension at 76 C for 1.5
min after an initial 5 min denaturation at 95 C using a PTC-100
Programmable Thermal Controller (MJ Research, Watertown, MA). For the
calibration, a standard curve was plotted by performing PCR with serial
dilutions of the wild-type D2 or Cyc plasmid. These diluted plasmids
were amplified at the same time as the experimental samples. After the
D2 amplification, the D2 PCR product was kept at -20 C.
Subsequently, Cyc cDNA was amplified for the same samples. For the amplification of Cyc, Cyc-S and Cyc-A primers, and mutant rCyc plasmid were used for performing 21 cycles of PCR. After amplification of both the D2 and Cyc, 20 µl D2 and 20 µl Cyc PCR product were mixed with 10 µl 6x gel loading buffer. Forty microliters from each mix was loaded on a 4% polyacrylamide gel and run at 150 V for 1–2 h. The gel was dried and exposed to a phosphoimager for 10–20 h. The ratio of wild-type to mutant bands was then determined for standards and unknowns. For quantitation, the relative D2 density ratio was plotted against the serially diluted concentrations of the standard D2 plasmids. The curve was virtually linear but was fit to a second-order polynomial equation. This was used to determine the quantity of D2 cDNA present in the RT reaction. The same process was performed to quantitate Cyc mRNA. The ratio of D2 to Cyc mRNA was then calculated. Dilutions of the RT product gave wt/mt density ratios parallel to the standard curve for both D2 and Cyc. Reproducibility was measured by quantitating D2 in the same mRNA sample from AP in duplicate PCR runs from three different RT reactions. The estimated mean D2 content for this pituitary was 0.63 ± 0.058 (SD) pg (n = 6).
Hormone measurements
Plasma T4 and T3 concentrations were
measured by RIA in the NIH General Clinical Research Center core
laboratory of the Brigham and Women’s Hospital.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
By in situ hybridization histochemistry, silver grains
representing D2 mRNA appeared to be distributed widely but in low
abundance throughout the forebrain and were only marginally greater
than background hybridization as judged by the appearance of control
sections using the D2 sense probe. With the exception of the
hypothalamus and pituitary gland, no apparent differences in intensity
or distribution of hybridization signal were noted in the hypothyroid
animals. Within the hypothalamus, hybridization was distinct, highly
concentrated between the rostral pole of the ME and the infundibular
recess, and more apparent in hypothyroid animals (Figs. 1
and 2). In this region, silver grains
were localized over ependymal cells in the floor of the third
ventricle, especially in its lateral portions, and extended onto its
infralateral walls (Figs. 1, B-F and 2). Hybridization ceased abruptly
approximately one half to two thirds up the third ventricular wall
(Fig. 1, B-E) and was absent from the roof of the infundibular recess
(Fig. 1F). Hybridization above background was conspicuously absent from
other regions of the third ventricle rostral to the anterior pole of
the ME including the supraoptic recess, as well as from the cerebral
aqueduct and lateral ventricles (Fig. 1A).
|
|
, E
and F and 2). Numerous instances of longitudinally oriented blood
vessels and their branches completely outlined by silver grains were
found throughout the ARC but were most apparent in the most caudal
portions of the nucleus (Figs. 1, E and F and 2, C and D). Sections
counterstained with hematoxylin and eosin confirmed the association of
silver grains with blood vessels in the ARC and suggested its location
beneath the endothelial layer (Fig. 3). Hybridization
was also present in high density at the base of the brain at the
infero-medial border of the ARC, where it formed a band at the lateral
margins of the ME (Figs. 1, B-E and 2) overlying a cell-clear zone
above the tuberoinfundibular sulci (Fig. 3). D2 mRNA also was seen in
the substance of the ME and stalk adjacent to the portal capillaries
(Fig. 1, B-E). No hybridization was seen in other circumventricular
organs in the forebrain including the organum vasculosum of the lamina
terminalis (OVLT), subfornical organ (SFO), and choroid plexus (Fig. 4A). In addition, little or no hybridization was seen in
other hypothalamic nuclei including the PVN, where silver grains above
background were conspicuously absent (Fig. 4B).
|
|
). A marked increase
in the extent of hybridization in the AP including the number of
identifiable cells and hybridization density per cell was seen in the
hypothyroid animals (Fig. 5B). Weak hybridization was occasionally
found focally in the pars tuberalis in hypothyroid animals (Fig. 1D),
although no hybridization was identified in the intermediate lobe in
any animal group. The neural lobe accumulated silver grains in a small,
triangular region in its most dorsolateral portions in hypothyroid
animals (Fig. 5B), but was otherwise without hybridization. No
hybridization was seen in the hypothalamus or pituitary when sense
probe to D2 was used (Figs. 5C and 6).
|
|
). Using a competitive PCR technique, a
marked increase in D2 mRNA was observed in the AP of hypothyroid rats
(Fig. 8). In addition, the D2/Cyc mRNA ratios were
higher in ARC-ME than in AP from euthyroid rats (Fig. 8 and Table 1). However, in contrast to the marked increase in D2
mRNA in AP in hypothyroid rats, there was only a 1.3-fold increase of
the D2/Cyc mRNA ratio in the ARC-ME (Table 1). D2 expression in ARC-ME
and pituitary were at least 5-fold higher than in NL or in the RH from
which the ARC-ME had been removed (Table 1). We repeated the PCR
analysis in another group of three hypothyroid and euthyroid rats to
confirm these results. There was a similar modest increase in the
D2/Cyc mRNA ratio in ARC-ME from 0.08 ± 0.021 to 0.13 ±
0.007 (mean ± SD, Table 2) in
hypothyroid rats. D2 mRNA expression in LH and CC in these rats was
less than 20% that in ARC-ME, and D2 mRNA was not detectable in the
PVN (Table 2).
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Tanycytes reside in the floor and lateral walls of the third ventricle and are distinguished from the more common mural ependymal cells by extending long, basal, cytoplasmic processes or tails into the adjacent neuropil of the medial hypothalamus and ME where they are intimately associated with capillaries and axon terminals (14, 15, 16). Similar to the distribution of D2 mRNA observed in our study in the floor and walls of the third ventricle, tanycytes tend to concentrate heavily within the lateral one third of the ependymal lining in the floor of the third ventricle, particularly in caudal portions of the ME, and are most numerous in the infralateral walls of the third ventricle (15). The abrupt termination of hybridization signal for D2 mRNA within the dorsal limits of the tuberal portion of the third ventricle and absence of hybridization from the roof of the infundibular recess is likely due to the paucity of tanycytes in this region (17). Nevertheless, the absence of hybridization in other regions of the third ventricle rostral to the ME and in other circumventricular organs lining the third ventricle including the SFO and OVLT where tanycytes are also present (14), indicate that the D2 tanycytes comprise a subpopulation of these specialized glial cells. This observation would be in keeping with the recognition that tanycytes are not a homogeneous population of cells but rather are made up of multiple different cell types based on their morphological features (14, 15, 16), immunostaining or histochemical characteristics (18, 19, 20), and response to physiological stimuli (21, 22, 23).
Although we cannot exclude the possibility that cellular components of blood vessels in the ARC express D2 transcripts, the appearance of silver grains in the autoradiograms as cuffs around ARC blood vessels is typical for tanycyte end processes. Tanycytes located in the lateral walls of the third ventricle frequently direct their distal processes toward capillary walls of blood vessels where they form loops, end feet, and networks around these vessels (14, 15, 16). The presence of organelles crowded throughout the cytoplasmic extensions of tanycytes including ribosomes, cisternae, and mitochondria (15) would explain the appearance of D2 mRNA in this location despite being at considerable distance from its cell body in the third ventricular wall. In a similar fashion, D2 mRNA present in the ME and overlying the tuberoinfundibular sulci at the lateral margins of the ME is also likely derived from tanycytes located in the floor and immediately adjacent infralateral walls of the third ventricle. These tanycytes direct cytoplasmic extensions either directly into the substance of the ME or send arching processes from the infralateral walls of the third ventricle through the ARC to end in flattened processes, juxtaposed to the basement membrane of the portal capillaries, or near the pial wall lateral to the ME (14, 15, 16).
Despite excellent morphological descriptions of tanycytes, their physiological roles are still poorly understood. Although originally believed to serve as part of the blood-brain barrier, preventing material in the perivascular spaces in the ME from leaking into the adjacent ARC or the cerebrospinal fluid (CSF) and to restrict movement of blood-borne molecules traversing the ARC from entering the ME (24, 25), it is now believed that tanycytes have much more complicated functions and likely have an active role in endocrine regulation (26). For example, tanycytes show morphological changes during the estrous cycle in the rat that include alterations in the spatial relationship between its end feet processes and LHRH axon terminals in the ME (23, 27). It has been proposed that by encasing LHRH axon terminals in the external zone of the ME, tanycyte end processes are able to restrict access of LHRH to the fenestrated capillaries of the portal capillary system for conveyance to AP gonadotrophs (27). Tanycytes may also be involved in degrading LHRH secreted from axon terminals (27a).
The fact that tanycytes are in direct contact with the CSF and have large, villous-like specializations on their apical surface that project into the third ventricular cavity (15), indicate that these cells may be capable of extracting substances from the CSF by an absorptive process. Indeed, horseradish peroxidase and ferritin injected into the CSF are taken up by tanycytes (28, 29, 30). Similar observations have been made for [3H]dopamine (31). In addition, protrusions at the apical surface of tanycytes can at times be seen to be connected to the surface of these cells by a narrow pedicle, suggesting that tanycytes release substances into the CSF (17). Thus, tanycytes may be capable of creating a cytoplasmic conduit between the CSF and the vascular system allowing the movement of substances from one compartment to the other.
On the basis of the above, we propose that the high concentrations of D2 in tanycytes lining the floor and infralateral walls of the third ventricle serve an important function by providing T3 to the CNS extracellular compartments after the uptake of T4 from the CSF. The CSF contains both free T4 and T3 in concentrations that are equal to or exceed that in the bloodstream (32, 33, 34, 35). There is evidence that the choroid plexus has an important role in the delivery of T4 to the CSF mediated by transthyretin, a T4 binding protein synthesized by choroid epithelium in abundance and secreted into the ventricles to comprise approximately 20% of the total CSF protein content (36, 37, 38, 39). However, T4 does not undergo deiodination in the choroid epithelium (40) consistent with the absence of D2 mRNA in this tissue in our study. This indicates that after T4 enters the CSF from the choroid plexus, its conversion to T3 depends on the presence of D2 at another locus in the brain. Because tanycytes envelop blood vessels in the ARC and ME, they may also be capable of extracting T4 from the systemic circulation, providing an alternative source of T3 in the CSF.
The delivery of CSF T3 to the extracellular compartment in
the brain may be an important mechanism to provide adequate thyroid
hormone to regions of the brain where there is little endogenous D2
activity. One of these regions is the hypothalamic PVN, which is devoid
of D2 mRNA (Fig. 4 and Table 2). The PVN contains hypophysiotropic TRH
neurons of the hypothalamic tuberoinfundibular system (41) and thereby
is an essential locus for feedback regulation by thyroid hormone to
control the biosynthesis of TRH under varying physiologic states.
Previous studies demonstrated that feedback regulation of TRH gene
expression in paraventricular neurons is dependent on circulating
levels of both T4 and T3, because approximately
1.6 times the euthyroid levels of T3 are required to
restore mRNA levels back to normal in these neurons in hypothyroid
animals receiving only T3 replacement (9). Because these
neurons do not express D2 mRNA, they are probably incapable of
converting T4 to T3 intracellularly. Thus, we
have proposed that monodeiodination of T4 to T3
must occur at a separate locus within the brain and then be transported
to the PVN (9, 42). The results of the present study suggest that
tanycytes may provide the additional T3 required for
regulation of TRH biosynthesis.
Although D2 mRNA in the ARC-ME region was modestly elevated in
hypothyroid animals by quantitative reverse transcription PCR, the
change in the D2/Cyc mRNA ratio was not statistically significant.
Nevertheless, by in situ hybridization histochemistry,
differences between the two groups were apparent particularly in the
wall of the third ventricle and surrounding blood vessels in the ARC.
This data might suggest that D2 mRNA in this region is at least partly
regulated by thyroid hormone, consistent with previous studies showing
the presence of thyroid hormone receptors in glial cells as well as
neurons in the CNS (43), although the presence of thyroid hormone
receptors in tanycytes has not been studied. Because D2 mRNA was also
highly concentrated in a region dorsal to the tuberoinfundibular sulci,
similarly in euthyroid and hypothyroid groups, inclusion of this area
in the samples for PCR analysis may have diminished the ability to
detect changes in D2 mRNA in hypothyroid animals by this technique.
There was a marked contrast, however, between the modest or absent
increase in the ARC-ME region and CC and the 11-fold increase in D2
mRNA in the AP of hypothyroid rats. The earlier studies showed that
there were comparable 4-fold increases in D2 activity in both the
ARC-ME and AP, but the final D2 activities per milligram protein were
4-fold higher in AP than in the ARC-ME (6). These results are
consistent with those reported recently in which D2 mRNA increased much
more in pituitary than in CNS, suggesting that a significant component
of the up-regulation of D2 activity in the CNS and tanycytes is
posttranslational (7, 44). The changes in the in situ D2
mRNA expression pattern in pituitary suggest focal increases in groups
of cells with high D2 mRNA expression rather than a generalized
increase in D2 mRNA in all cells (Fig. 5). This raises the possibility
that there is an increase in the number of cells with high D2 mRNA
expression in the AP in hypothyroidism, perhaps in thyrotrophs
per se (45).
In conclusion, we demonstrated that D2 mRNA is highly concentrated in the hypothalamus in a distribution suggesting expression in tanycytes. Given their close proximity to the CSF and links to the vascular system in the ARC-ME through cytoplasmic extensions, we hypothesize that these cells may play an important role in the conversion of T4 to T3 and delivery of T3 locally to the CSF and the hypothalamus. By volume transmission (46), T3 would have access to extracellular spaces in the brain where it could mediate actions directly on cells involved in the regulation of TSH secretion. The marked increase in the expression of D2 mRNA in the AP compared with the hypothalamus in hypothyroid animals suggests tissue-specific transcriptional regulation by thyroid hormone.
|
Footnotes |
|---|
2 Drs. Tu and Kim are equal first authors of this paper.
Received March 7, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  E. Sanchez, P. S. Singru, C. Fekete, and R. M. Lechan Induction of Type 2 Iodothyronine Deiodinase in the Mediobasal Hypothalamus by Bacterial Lipopolysaccharide: Role of Corticosterone Endocrinology, May 1, 2008; 149(5): 2484 - 2493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fekete, B. C. G. Freitas, A. Zeold, G. Wittmann, A. Kadar, Z. Liposits, M. A. Christoffolete, P. Singru, R. M. Lechan, A. C. Bianco, et al. Expression Patterns of WSB-1 and USP-33 Underlie Cell-Specific Posttranslational Control of Type 2 Deiodinase in the Rat Brain Endocrinology, October 1, 2007; 148(10): 4865 - 4874. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yasuo, T. Yoshimura, S. Ebihara, and H.-W. Korf Temporal Dynamics of Type 2 Deiodinase Expression after Melatonin Injections in Syrian Hamsters Endocrinology, September 1, 2007; 148(9): 4385 - 4392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Wajner, M. dos Santos Wagner, R. C N Melo, G. G Parreira, H. Chiarini-Garcia, A. C Bianco, C. Fekete, E. Sanchez, R. M Lechan, and A. L. Maia Type 2 iodothyronine deiodinase is highly expressed in germ cells of adult rat testis J. Endocrinol., July 1, 2007; 194(1): 47 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yasuo, M. Watanabe, M. Iigo, T. J. Nakamura, T. Watanabe, T. Takagi, H. Ono, S. Ebihara, and T. Yoshimura Differential response of type 2 deiodinase gene expression to photoperiod between photoperiodic Fischer 344 and nonphotoperiodic Wistar rats Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2007; 292(3): R1315 - R1319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. G. Revel, M. Saboureau, P. Pevet, J. D. Mikkelsen, and V. Simonneaux Melatonin Regulates Type 2 Deiodinase Gene Expression in the Syrian Hamster Endocrinology, October 1, 2006; 147(10): 4680 - 4687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Zeold, M. Doleschall, M. C. Haffner, L. P. Capelo, J. Menyhert, Z. Liposits, W. S. da Silva, A. C. Bianco, I. Kacskovics, C. Fekete, et al. Characterization of the Nuclear Factor-{kappa}B Responsiveness of the Human dio2 Gene Endocrinology, September 1, 2006; 147(9): 4419 - 4429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Alkemade, E. C Friesema, G. G Kuiper, W. M Wiersinga, D. F Swaab, T. J Visser, and E. Fliers Novel neuroanatomical pathways for thyroid hormone action in the human anterior pituitary. Eur. J. Endocrinol., March 1, 2006; 154(3): 491 - 500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. del Barco Barrantes, A. Montero-Pedrazuela, A. Guadano-Ferraz, M.-J. Obregon, R. Martinez de Mena, V. Gailus-Durner, H. Fuchs, T. J. Franz, S. Kalaydjiev, M. Klempt, et al. Generation and Characterization of dickkopf3 Mutant Mice. Mol. Cell. Biol., March 1, 2006; 26(6): 2317 - 2326. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont Selenium, the Thyroid, and the Endocrine System Endocr. Rev., December 1, 2005; 26(7): 944 - 984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y Chan, M. H Andrews, R. Lingas, C. J McCabe, J. A Franklyn, M. D Kilby, and S. G Matthews Maternal nutrient deprivation induces sex-specific changes in thyroid hormone receptor and deiodinase expression in the fetal guinea pig brain J. Physiol., July 15, 2005; 566(2): 467 - 480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Alkemade, E. C. Friesema, U. A. Unmehopa, B. O. Fabriek, G. G. Kuiper, J. L. Leonard, W. M. Wiersinga, D. F. Swaab, T. J. Visser, and E. Fliers Neuroanatomical Pathways for Thyroid Hormone Feedback in the Human Hypothalamus J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4322 - 4334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Coppola, R. Meli, and S. Diano Inverse Shift in Circulating Corticosterone and Leptin Levels Elevates Hypothalamic Deiodinase Type 2 in Fasted Rats Endocrinology, June 1, 2005; 146(6): 2827 - 2833. [Abstract] [Full Text] [PDF]
|
|
|
, Denotes roof
of third ventricle in B-E. DMN, dorsomedial nucleus. Original
magnification x40.
