help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balkan, W.
Right arrow Articles by Roos, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balkan, W.
Right arrow Articles by Roos, B. A.
Endocrinology Vol. 139, No. 1 252-259
Copyright © 1998 by The Endocrine Society

ARTICLES

Expression of Rat Thyrotropin-Releasing Hormone (TRH) Gene in TRH-Producing Tissues of Transgenic Mice Requires Sequences Located in Exon 11

Wayne Balkan, Marie A. Tavianini, Peter J. Gkonos and Bernard A. Roos

Geriatric Research, Education, and Clinical Center, Veterans Affairs Medical Center; and Departments of Medicine (W.B., M.A.T., P.J.G., B.A.R.) and Neurology (B.A.R.), University of Miami School of Medicine, Miami, Florida 33125

Address all correspondence and requests for reprints to: Wayne Balkan, Geriatric Research, Education, and Clinical Center (11 GRC), Miami Veterans Affairs Medical Center, 1201 Northwest 16th Street, Miami, Florida 33125. E-mail: wbalkan{at}mednet.med.miami.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRH, an amidated tripeptide secreted by certain hypothalamic neurons, is a principal regulator of TSH secretion and thyroid hormone release. TRH is also produced by other neurons in the central nervous system, where it appears to function as a neuromodulator or neurotransmitter, and by certain endocrine cells, where it may act as an autocrine or paracrine factor. The genomic organization of the rat TRH (rTRH) gene is well understood; however, the domains of the rTRH gene that regulate expression are less well characterized. We observed that the region between -47 and +6 of the rTRH gene (relative to the transcription start site at +1) was active in CA-77 cells, a medullary thyroid carcinoma cell line model of TRH production, but was not active in transgenic mice. Inclusion of most of exon 1 (84 out of 103 bp; -47 to +84) increased promoter activity in CA-77 cells and was active in transgenic mice, principally in tissues that normally express the TRH gene. Further lengthening of the 5' end to -243, -547, or -776 retained this expression in TRH-producing tissues in transgenic mice, while further increasing activity in CA-77 cells. These results suggest that cis element(s) located within exon 1 are necessary for the expression of the rTRH gene in vivo.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE hypothalamic peptide hormone TRH (pGlu-His-proNH2) is processed from a larger proTRH molecule (1, 2). TRH produced in the paraventricular nucleus of the hypothalamus regulates TSH secretion from the anterior pituitary (3) and is, therefore, an integral component for maintaining thyroid hormone homeostasis. TRH-containing neurons are also found in other regions of the hypothalamus (4) and in many areas of the central nervous system (CNS) including, but not limited to, cells of the olfactory bulb, the reticular nucleus of the thalamus, and the motor nucleus of the vagus (5). In other CNS regions, TRH appears to function both as a neurotransmitter and as a neuromodulator (3, 4). Processing of proTRH in certain regions of the CNS also results in the formation of TRH-related peptides (6).

Authentic TRH is also found in cells of certain endocrine tissues, including pituitary (7), testis (8), thyroidal C (9, 10), heart (11), prostate (12), ovary (12), placenta (13), and pancreas (12). Similar to somatostatin (14) and corticotropin-releasing hormone (15), two peptides initially discovered in the hypothalamus but later found in other locations, TRH produced in endocrine tissues is thought to function in an autocrine or a paracrine manner.

The human (2) and rat (1) TRH genes each consist of three exons. Exon 1 is not translated. Exons 2 and 3 encode the entire preproTRH sequence, with all copies of the TRH sequence located within exon 3. The molecular mechanisms controlling the specific sites and extent of TRH gene expression are poorly understood. However, studies of other peptide hormones, notably GH and PRL in anterior pituitary cells (16), and calcitonin (17) and somatostatin (18, 19) in thyroidal C cells, have identified a growing number of tissue-specific transcription factors in eukaryotic cells. Most of these transcription factors bind to DNA elements that can enhance or silence transcription in a manner relatively independent of orientation and location within the gene. This scenario contrasts with the initiation of transcription involving TATA and other sequences located near the RNA transcription start site, whose function depends on relatively strict orientation and placement within the proximal 5' region of a gene (20). The 5' region of the rat TRH gene contains TATA and GC box sequences (1, 21) found in the promoter region of numerous other genes, as well as consensus sequences for cAMP response element (CRE) and thyroid hormone response element (22). Similar to somatostatin (23) and calcitonin (24), these cis elements may help to regulate the levels of TRH gene expression (22).

Reported experiments designed to define the regulatory elements in the TRH gene have been limited to cell culture studies, primarily using CA-77 cells, a TRH-secreting medullary thyroid carcinoma cell line (21, 22, 25). Previous studies have shown that the region between -113 and -47 is necessary for increased expression of the rat TRH (rTRH) gene in CA-77 cells (22). Located in this region are two cis elements that are homologous to the consensus CRE/thyroid hormone response elements and thought to be at least partially responsible for this increased activity in CA-77 cells (22). However, our data indicate that although these upstream elements may modulate the levels of TRH gene expression in vitro, they are not responsible for directing expression of the rTRH gene to TRH-producing tissues in vivo.

Our results indicate that sequences located between +6 and +84 of the first exon of the rTRH gene are crucial for generating reporter gene activity in transgenic mice but have a less-important role in CA-77 cells. A truncated rTRH promoter region containing only the DNA between -47 and +6 (53 bp) ligated to the reporter gene luciferase was inactive in transgenic mice in contrast to its low (but significant) level of activity in CA-77 cells. A longer region of the rTRH gene, containing the 84 bp (of 103 bp) of exon 1 (-47/+84) was active in transgenic mice, primarily in TRH-containing tissues. This region was also active in CA-77 cells; however, both the -47/+6 and the -47/+84 promoter regions were much less active in CA-77 cells than three progressively longer segments (-776/+84; -547/+84; -243/+84). These results indicate that sequences within the first exon appear to be necessary for TRH gene expression in TRH-containing tissues in vivo, and that the expression of TRH in transgenic mice and in CA-77 cells appears to be regulated by a complex interaction of cis elements.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cloning of rat TRH 5' flanking and 5' untranslated regions
Clones containing the rat TRH 5' flanking and untranslated regions (exon 1) were isolated from a rat genomic library composed of a Sau3AI partial digest of Sprague-Dawley rat liver DNA cloned into EMBL3 (Clontech, Palo Alto, CA). The 32P-labeled HindIII-PstI fragment of the plasmid pSL2 (1) (a gift of Dr. S. L. Lee, Tufts University and New England Medical Center) was used to screen the genomic library (26). Four clones were isolated, each containing the hybridizing region within an approximately 6-kb EcoRI-BamHI fragment, and cloned into the plasmid pGEM7zf(+) (Promega, Madison, WI). By restriction digests and partial sequencing by the dideoxy-chain termination method (Sequenase Kit, United States Biochemical, Cleveland, OH) (27), all four clones appeared identical. Both DNA strands of one clone were sequenced further, and all data reported was based on this clone.

DNA constructs
The DNA constructs for both transfection and transgenes were made in the pNASSß vector (Clontech), in which the bacterial LacZ coding region was replaced by the complementary DNA (cDNA) for firefly luciferase (28) to generate the vector, pNASS-Luc. Each of the rTRH 5' flanking regions was filled in with Klenow (Boehringer Mannheim, Indianapolis, IN) and blunt-end ligated into the filled-in XhoI site in the polylinker upstream of the SV40 intron. This ligation results in the loss of the PstI site. For transgenic mice, these constructs were linearized by digestion with NdeI and PstI, which cut 269 bp upstream of the 5' flanking region and immediately downstream of the SV40 polyadenylation site, respectively.

For cell culture and transgenic mouse studies, five progressively shorter promoter regions were cut out of the 6-kb rTRH clone and ligated into the pNASS-Luc vector. The promoter region was cut with PvuII, HindIII, AatII and NarI, at -776, -547, -243, and -47 (relative to the transcription start site at +1), respectively, and with either PstI, which cuts at +84, or SalI, which cuts at +6.

Cell culture and transfection
CA-77 (medullary thyroid carcinoma) cells were grown as described (9, 29, 30). Briefly, cells were passaged in medium composed of 1:1 (vol/vol) DMEM/F10 (Gibco-BRL, Gaithersburg, MD) plus 10% FBS (Hyclone, Provo, UT). Within 24 h this medium was changed to DMEM/F10 plus 10 µg/ml insulin, 5 µg/ml transferrin, 3 x 10-8 M selenium (ITS) (all from Sigma Chemical Co., St. Louis, MO). For transfection, cells were passaged into 6-well plates at 600,000 cells/well in medium DMEM/F10/ITS. Cells were transfected using 10 µl lipofectamine (Gibco-BRL) plus 1 µg rTRH-luciferase and 0.2 µg cytomegalovirus (CMV)-ß-galactosidase plasmid (Invitrogen, San Diego, CA), per manufacturer’s directions.

Forty-eight hours after transfection, cells were washed with PBS and lysed in lysis buffer (31). Cell extracts were assayed for luciferase activity as described by Braiser et al. (31). Briefly, cells were lysed in a glycylglycine- and Triton X-100–containing buffer and centrifuged to remove cellular debris. An aliquot of the supernatant was assayed for luciferase activity after the addition of a buffer containing 0.2 mM luciferin and 2 mM ATP (Sigma). Luciferase activities were quantified using a BioOrbit Model 1251 luminometer (Pharmacia, Gaithersburg, MD). ß-galactosidase activity was determined as described (27). Data were calculated as arbitrary light units/ß-galactosidase activity and reported as fold increase over cells transfected with both the pNASS-Luc and CMV-ß-galactosidase plasmids. All transfections were done in triplicate.

LNCaP cells, a prostate cancer cell line, were grown in DMEM (Gibco-BRL) supplemented with 10% FBS (Hyclone). For transfection, cells were split 1:10 into 6-well plates. Cells were transfected using lipofectamine with the rTRH-luciferase and CMV-ß-galactosidase plasmids as above but in DMEM alone. This medium was replaced with DMEM plus 10% FBS after 5 h. As positive control, cells were transfected with a plasmid containing a mouse mammary tumor virus enhancer upstream of the luciferase cDNA and exposed to 5 x 10-8 M of the synthetic androgen mobolerone (R1881) (Amersham, Arlington Heights, IL) or vehicle (ethanol).

Transgenic mice
All animal studies were conducted in accordance with the principles and procedures outlined in Guidelines for Care and Use of Experimental Animals. Transgenic mice were generated by standard techniques (32). Fertilized eggs were obtained from either FVB/N x FVB/N or C57/Bl/6JxSJL F1 x C57Bl/6JxSJL F1 matings (both strains from Jackson Labs., Bar Harbor, ME). The strain of mouse did not appear to affect expression of the transgene. Genomic DNA obtained from tail biopsies was isolated as described by Hogan et al. (32). DNA (20 µg) from founder mice was analyzed by Southern blot onto Nytran membranes (Schleicher and Scheull, Keene, NH) (26) and for some of the mice also by PCR (see below). Mice derived from these founders were analyzed by slot blot using the Minifold II apparatus (Schleicher and Scheull) and Nytran membrane and/or by PCR. Blots were probed with a 32P-deoxycytidine triphosphate-labeled EcoRI to XbaI fragment (590 bp) and/or an EcoRI (1251 bp) fragment of the luciferase cDNA. Hybridizations were carried out in a Techne HB-1 hybridization oven (Techne, Princeton, NJ) at 42 C in 50% formamide, 6x SSC, 0.05 M NaPO4, 5x Denhardt’s, 0.1% SDS, and 100 µg/ml calf thymus DNA. Blots were washed sequentially with 1x SSC/0.1% SDS at room temperature and 0.1x SSC/0.1% SDS at 60 C (26). For PCR analysis, the oligodeoxynucleotides used were: 5'-AAGCCTCAGCCCCTCCTCG-3' and 5'-TATGTTTTTGGCGTCTTGGAT-3', which were homologous to the sequence between bp -25 and -5 of the rTRH gene and bp 304 and 324 of the firefly luciferase cDNA (28), respectively. PCR was carried out by an adaptation of the procedure described by Drews et al. (33).

At least six transgenic mouse lines were generated with each of the rTRH promoter constructs (transgenes). All animals were fed (Purina Lab Chow, Purina, St. Louis, MO) and watered ad libitum and kept on a 12 h light/12 h dark schedule.

Dissections
Mice between the ages of 8 and 52 weeks were dissected. Mice were killed by CO2 inhalation. Tissues were removed, blotted on paper towels, immediately frozen on dry ice, and stored at -80 C until analyzed. The tissues taken were: hypothalamus, olfactory bulb, hindbrain (primarily cerebellum and medulla obtained by making a razor blade cut posterior to the hypothalamic sulcus after removal of the hypothalamus), pituitary, liver, pancreas, kidney, spleen, skeletal muscle (quadriceps femoris), testis, ventral prostate, ovary, atrium, ventricle, and lung. Mouse tissues were sonicated in the lysis buffer (31) and analyzed as described above. Protein levels were determined as described by Bradford (34) using the Bio-Rad reagent (Bio-Rad, Hercules, CA), and the final value for luciferase activity was expressed as arbitrary light units per milligrams protein. The level of detection for these assays was 0.03 light units/mg protein. Values for tissues that were below the level of detection were assigned this 0.03 value.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Constructs
The DNA constructs and transgenes that were used are shown in Fig. 1Go. Progressively shorter regions of the 5' flanking region (truncated promoter regions) of the rTRH gene were ligated to the firefly luciferase cDNA (28) (Fig. 1Go). The four longest constructs were composed of either 776, 547, 243, or 47 bp of the 5' flanking region plus the first 84 of 103 bp of (the untranslated) exon 1, respectively. The shortest segment contained 47 bp of the 5' flanking region plus only 6 bp of exon 1. The progressively shorter reporter constructs/transgenes were designated: -776/+84rTRH, -547/+84rTRH, -243/+84rTRH, -47/+84rTRH, and -47/+6rTRH, respectively.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 1. Schematic diagram of rTRH 5' flanking-5' untranslated regions-luciferase transgenes. Five transgenes generated were -776/+84rTRH, -547/+84rTRH, -243/+84rTRH, -47/+84rTRH, and -47/+6rTRH. 3' end of four longest transgenes was +84. Positions of restriction sites and restriction enzymes used to generate truncated 5' flanking regions are shown relative to transcription start site at +1 (arrowhead).

 
Further sequencing of 5' portion of rTRH gene
The sequence of less than 500 bp of the 5' flanking region of the rTRH gene has been reported previously (1, 21). We sequenced an additional 402 bp upstream (total of 900 bp: -784/+103 (all of exon 1) plus 13 bp of intron 1 of the rTRH gene (Fig. 2Go) to extend these reports. This additional sequence could also help to identify cis elements further upstream that might influence the expression of the rTRH gene and help to establish the basis for future deletion and mutagenesis studies. Our sequence up to -406 (519 bp) was virtually identical to previous reports (1, 21), with a few minor differences: 1) four cases of a single base pair present in the previous sequence (at -396, -369, -343, -188) but not in our sequence (see Fig. 2Go); 2) three examples of a single base pair addition in our sequence (-381, -316, -242), one of which (-316) was reported previously (21); and 3) a 1-bp substitution (C->A) at -373. Upstream of -406 our sequence agrees with Lee et al. (21), except for an A not present in our sequence (after -497 in our sequence) and an 8-bp region located between -432 and -425 present in our sequence (Fig. 2Go). These minor differences probably resulted from sequencing different clones or alleles.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 2. Sequence of rat TRH promoter region from -784 to intron 1. Double-stranded sequencing of insert was performed by dideoxy-mediated chain-termination method (27). Nucleotide at +1 represents start site for RNA transcription (1). Numbers above sequence are relative to transcription start site (+1). Proximal and distal repeats (underlined) represent 27-bp and 26-bp repeated sequences, respectively (see text). Sequence CCAGG at -770 (neur.enh) is identical to a consensus neuronal enhancer element (35). GC box/SP1 consensus sequences are indicated at -119 and -643 (double underlined) (36). ANP-CArG-like represents sequence (underlined) with homology to CArG element from ANP gene (37). Sites for restriction enzymes used for making rTRH promoter constructs are indicated. Asterisks (*, **) represent limit of two sequences reported by Lee et al. (1, 21). GenBank accession number: AF024518

 
In addition to the cis elements previously identified (1, 21, 22), we found sequences that resemble other known enhancer elements (Fig. 2Go): 1) the sequence GGGCGGG, located at -693 is a GC box and contains the hexanucleotide (GGGCGG) that interacts with the SP1 transcription factor (35); 2) the sequence CCAGG at -770 that is identical to a neuronal-specific enhancer (36); and 3) the sequence CCTTTATTTTG (beginning at -351) that bears a striking similarity to the 10-bp atrial natriuretic peptide (ANP) CArG element, CCTTATTTGG (37), a sequence that confers cardiac-specific expression. In addition, there are two long repeats—one of 26 bp and one of 27 bp—beginning at -755 and -582, respectively. At -755, the 26-bp sequence TTTCCACAGAAGCCAGTTTTGTTCTT (Fig. 2Go, distal 26-bp repeat; underlined nucleotides are identical in both sequences) contains 20 nucleotides that are identical to the second sequence (beginning at -582), TTCTCACAGGTCCCCATTTTTGTTCTT (Fig. 2Go, proximal 27-bp repeat). These homologous sequences comprise two components, the virtually identical 3'-most 13 nucleotides CAG/TTTTTGTTCTT, and the more degenerate 5' 13 or 14 nucleotides containing a common TTYYCACAG (where Y = C or T). Within the 3' component is a consensus glucocorticoid response element half-site (TGTTCT) (38). It is unknown whether these cis elements participate in the glucocorticoid stimulation of the TRH gene observed in hypothalamic cell cultures (39), CA-77 cells (40), and anterior pituitary cells (41, 42) in vitro.

Cell culture studies
CA-77 cells, a rat medullary thyroid carcinoma cell line, secrete TRH (9, 30) and represent a model for studying regulation of TRH gene expression (21, 22, 40). Using these cells, we confirmed previous results (21, 22) that cells transfected with the -776/+84rTRH, -547/+84rTRH, and -243/+84rTRH constructs generated significantly more luciferase activity than cells transfected with the -47/+84rTRH or the vector alone (Fig. 3Go). However, there are no reports concerning the activity of the -47/+6rTRH region. Cells transfected with the -47/+84rTRH and -47/+6rTRH constructs exhibited 4- to 6-fold and 2- to 3-fold increased levels of luciferase over baseline, respectively. These increases were significant compared with the vector alone, although less than the 12- to 18-fold increase observed with the three longer rTRH promoter constructs. Similar results were obtained when cells were grown as described by Russo et al. (29), so that they attained either a more neuronal or endocrine phenotype (data not shown). The data with CA-77 cells suggests that elements upstream of -47 are generally stimulatory, although the presence of individual repressive elements cannot be ruled out by this study. To test whether or not the increased (over baseline) activity of the shortest (-47/+6rTRH) region could be attributed to nonspecific expression due to DNA elements such as a TATA box, the prostate cancer cell line LNCaP, a cell line that does not appear to produce TRH (our unpublished observation), was transfected with all five rTRH-luciferase constructs. No luciferase activity was observed with any of the constructs.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 3. All rTRH promoter fragments generate luciferase activity in CA-77 cells. CA-77 cells exhibiting a neuroendocrine phenotype were transfected, in triplicate, with each of five rTRH-luciferase DNA constructs or luciferase vector alone (vector). Values are expressed as mean ± SEM from a representative experiment. *, Significantly less than all longer constructs in similarly grown CA-77 cells (P < 0.01; Student’s t test).

 
Expression of rTRH-luciferase transgenes in transgenic mice
-47/+84rTRH and -47/+6rTRH transgenic mice.The activity of the -47/+84rTRH and -47/+6rTRH in CA-77 cells prompted us to examine whether these promoter regions could also direct expression to TRH(+) (TRH-containing) tissues in transgenic mice. Transgenic mouse lines were generated by conventional means (32) with 18/57 and 8/35 pups transgenic for the -47/+84rTRH and -47/+6rTRH, respectively. We determined the luciferase activity in many TRH(+) tissues: hypothalamus, olfactory bulb, hindbrain, pituitary, pancreas, atrium, ventricle, ovary, and testis and TRH(-) (non-TRH-expressing) tissues: skeletal muscle, liver, kidney, spleen, and lung. The amount of luciferase activity observed in these transgenic mice was unrelated to either the transgene copy number or the age of the animals (8–52 weeks old).

Two of the 18 transgenic mice containing the -47/+84rTRH transgene neither exhibited luciferase in any tissues nor passed the transgene onto their offspring, suggesting that these mice were mosaic for the transgene. Comparisons of the luciferase activities found in TRH(+) hypothalamus and olfactory bulb and TRH(-) liver of the remaining 16 lines of transgenic mice are illustrated in Fig. 4DGo. Two (lines 2383 and 2386) of the 16 lines of mice contained little or no luciferase activity in any tissue except for testis. The remaining 14 lines of mice had luciferase in most TRH(+) tissues. Two of these lines (2406 and 2583) had very low levels (<1 light unit/mg protein) in hypothalamus (Fig. 4DGo), although in other TRH(+) tissues the levels were higher. The remaining 12 lines of mice had hypothalamic levels ranging from 1557 to 2.5 light units/mg protein (Fig. 4DGo). In 11/16 lines, luciferase activity in the olfactory bulb was generally greater than in the hypothalamus (Figs. 4DGo and 5DGo). Prostatic and pancreatic levels were extremely low or undetectable, and in about half of the lines, no luciferase activity was observed in either the atrium or ventricle. In general, TRH(-) tissues exhibited low or undetectable expression. Of the TRH(-) tissues, skeletal muscle consistently contained the highest levels of luciferase and was positive in 10/16 lines. The luciferase activities from all of the tissues studied from line 613 are shown in Fig. 5DGo.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 4. Comparison of luciferase activity in hypothalamus, olfactory bulb, and liver in all lines of transgenic mice. Luciferase activity (mean ± SEM) in light units per milligrams protein found in hypothalamus (open bars), olfactory bulb (solid bars), and liver (hatched bars) in each line of transgenic mice. Lines are arranged in order of decreasing hypothalamic luciferase activity within a given transgene group. A, -776/+84rTRH. B, -547/+84rTRH. C, -243/+84rTRH. D, -47/+84rTRH. E, 47/+6rTRH.

 


View larger version (24K):
[in this window]
[in a new window]
  		Figure 5. Luciferase activity in representative transgenic mouse lines. Mean luciferase activity ± SEM is shown in light units per milligrams protein for all tissues examined in a representative line from transgenic mice containing each of five rTRH-luciferase transgenes. Hy, Hypothalamus; Ol, olfactory bulb; Br, hindbrain; Pi, pituitary; Li, liver; Pa, pancreas; Sk, skeletal muscle; At, atrium; Ve, ventricle; Lu, lung; Ki, kidney; Sp, spleen; Ov, ovary; Te, testis; Pr, ventral prostate. A, -776/+84rTRH line 1562. B, -547/+84rTRH line 1480. C, -243/+84rTRH line 1492. D, -47/+84rTRH line 616. E, -47/+6rTRH line 2389.

 
In contrast to the -47/+84rTRH transgenic mice and the results in CA-77 cells transfected with the -47/+6rTRH construct (Fig. 3Go), 7/8 lines of transgenic mice containing the -47/+6rTRH transgene failed to produce luciferase activity in any of the tissues examined, except for low levels in some testes (three lines: 2389, 2368, 3318) and ovaries (one line: 2389) (Figs. 4EGo and 5EGo). When measurable, luciferase activity in testis was very low (Fig. 5EGo), unlike the higher levels seen in this tissue with the four longer transgenes (Fig. 5Go, A–D). Figure 5EGo illustrates the levels of luciferase activity of representative line 2389. Only the eighth line of these transgenic mice (line 3319) exhibited luciferase activity in nonreproductive tissues (Fig. 4DGo). This activity was seen in all tissues, suggesting that expression of this transgene was due to a position effect, i.e. its activity was influenced by its site of integration into the mouse’s genome (43) and was not solely under the control of the transgene.

These data indicate that transgenes containing 84 bp of exon 1 and 47 bp or more of the 5' flanking sequence possessed sufficient information for expression of the rat TRH gene primarily in TRH(+) tissues in transgenic mice. Removal of 78 bp of exon 1, leaving the 53-bp region between -47 and +6, greatly diminishes but does not eliminate activity in CA-77 cells, but virtually eliminates this activity in transgenic mice. This inability to promote expression of a reporter gene in transgenic mice indicates that cis elements located in exon 1, between +6 and +84, play a crucial role for expression of the rTRH gene in transgenic mice.

-776/+84rTRH, -547/+84rTRH, and -243/+84rTRH transgenic mice. Because the activity of the -47/+84rTRH transgene was often low or undetectable in some TRH(+) tissues, we wanted to determine whether increasing the amount of the 5' flanking sequence influences the activity of the transgene, similar to the increase observed in CA-77 cells (21, 22) (Fig. 3Go). With the -776/+84rTRH, -547/+84rTRH, and -243/+84rTRH transgene, 7/25, 6/31, 9/49 pups were transgenic, respectively. For the longest transgene (-776/+84rTRH), all TRH(+) tissues exhibited luciferase activity, except that ovary, pancreas, and prostate, which have low levels of endogenous TRH (12), contained little or no measurable luciferase. Olfactory bulb levels were consistently higher than hypothalamus (Figs. 4AGo and 5AGo). Testis always displayed the highest levels of luciferase activity, which were 40- to more than 1000-fold greater than in hypothalamus (Fig. 5AGo and data not shown), despite endogenous TRH levels in the testis being much lower than in the hypothalamus (8). Luciferase activity in TRH(-) tissues was either below the level of detection or was low relative to TRH(+) tissues (Fig. 5AGo and data not shown). The highest levels of luciferase in a TRH(-) tissue were seen in skeletal muscle in most transgenic mouse lines (Fig. 5AGo and data not shown); however, these levels were always lower than in TRH(+) tissues.

The next longest transgene, -547/+84rTRH, also exhibited luciferase activity in all TRH(+) tissues, and the levels in ovary, pancreas, and prostate were easily detectable, although still low, in virtually all lines (Figs. 4BGo and 5BGo). Generally, olfactory bulb levels approximated those found in hypothalamus. Testicular luciferase was high in four lines, but quite low in the other two. More of the TRH(-) tissues consistently displayed luciferase activity, with skeletal muscle once again containing the highest amount of luciferase.

Transgenic mice with the -243/+84rTRH transgene were more similar to the -776/+84rTRH than the -547/+84rTRH line with respect to the tissue distribution of luciferase. Olfactory bulb levels were either higher or equivalent to hypothalamus. Testis in all lines contained very high levels of luciferase. Again, expression in TRH(-) tissues was very low or below detection (Figs. 4CGo and 5CGo). The influence of individual cis elements, whether repressive or stimulatory, is difficult to ascertain in these transgenic mice, because the levels of luciferase activity varied between lines. However, the variations among these transgenes suggest that an interaction of cis elements in the 5' flanking region (Fig. 2Go) modulates the levels of expression of the rTRH gene.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Expression of the TRH gene is limited to specific regions in the CNS, notably in the hypothalamus and olfactory bulb (3, 5), and outside of the CNS to certain organs (3, 8, 9, 10, 11). To understand better the regulation of TRH gene expression, we examined the activity of progressively shorter regions of the rTRH promoter region in CA-77 cells, a TRH-producing, medullary thyroid carcinoma cell line, and in vivo in transgenic mice. Our results confirmed that in CA-77 cells the activity of the region between -47 and +84 was greater than baseline (vector alone), and that this activity was significantly lower than in cells transfected with longer promoter segments (-776/+84rTRH, -547/+84rTRH, and -243/+84rTRH) (21, 22; Fig. 3Go). We showed that removal of 78 bp of the first exon significantly reduced, but did not eliminate, expression in CA-77 cells (Fig. 3Go). These results suggest that proximal and distal cis elements interact to regulate the activity of the rTRH gene in CA-77 cells.

That a short region of the promoter is active in CA-77 cells has a precedent: the expression of somatostatin, another neuropeptide initially found in the hypothalamus and later seen elsewhere. CA-77 cells secrete somatostatin in addition to TRH (23). Expression of the somatostatin gene in CA-77 cells also requires only a short region of the promoter, between -50 and +50. Removal of a CRE located between -50 and -40 of the somatostatin gene eliminates this expression (44). In contrast, removal of a region of the rTRH gene containing CREs reduces but does not eliminate activity in CA-77 cells (21, 22) (Figs. 2Go and 3Go), indicating that some expression from the rTRH gene is independent of these CREs. Because removing most of the exon 1 (-47/+6rTRH) decreases but does not eliminate expression in CA-77 cells (Fig. 3Go), cis elements must be located between -47 and +6. Other than the TATA box, no elements that have been implicated in mediating the regulation of the rat (1, 21, 22) (Fig. 2Go) or human (25) TRH genes were observed (Fig. 2Go).

When the five regions of the rTRH gene were examined in transgenic mice, we observed that the four longest ones generated luciferase activity primarily in TRH(+) tissues (Figs. 4Go, A–D and 5, A–D). The low levels of luciferase found in tissues such as ovary, pancreas, and prostate were consistent with the endogenous levels of authentic TRH found normally in these tissues (12). In contrast to the results obtained with the four longest regions and with results in CA-77 cells, the -47/+6rTRH transgene was virtually inactive in transgenic mice (Figs. 4EGo and 5EGo). The exonic region between +6 and +84 must therefore contain DNA sequences that are necessary for activity in transgenic mice.

Although there are increasing examples of intragenic regulatory elements, in most cases these elements are located within introns rather than exons. Only two examples of exonic elements that regulate tissue-specific activity in transgenic mice have been reported. These elements were found in the human keratin (45) and the murine Hoxd-11 genes (46). In both of these studies, downstream exons were implicated as containing the cis elements. These two studies, in addition to our report, illustrate that regulatory sequences within exons are active in vivo.

We observed that including contiguous segments of the rTRH gene upstream of -47 produced luciferase activity in TRH(+) tissues more consistently. This activity appears to mimic more accurately the tissue distribution of TRH and may be related to the variety of cis elements located within the proximal 784 bp of the rTRH flanking sequence, many of which have been discussed previously (1, 21). A neuronal enhancer element CCAGG (36), located at -770 (Fig. 2Go), may be involved in the expression of TRH in the CNS. An 11-bp sequence CCTTTATTTTG, beginning at -351 of the rTRH 5' flanking region, is homologous to the 10-bp ANP CArG element (37). This element may participate in the expression of TRH in the heart, where atrial and ventricular TRH expression is differentially regulated both at the transcriptional and translational level (8). The seven E-box consensus sequences (47) (at -779, -707, -623, -373, -297, -290, -214; Fig. 2Go) may be involved in the expression of luciferase in skeletal muscle, a TRH(-) tissue, although skeletal muscle expression was seen with the -47/+84rTRH transgene, which contains no E-box elements. The E-box consensus sequence, CANNTG, is found in the regulatory regions of most muscle-specific genes and appears to be required for the correct expression of muscle-specific genes during development (47). E-box-like elements also enhance the expression of calcitonin in thyroidal C cells (48). The function of the proximal and distal repeats (Fig. 2Go) is also unclear. Each repeat contains a half-site glucocorticoid response element but no other obvious homologies to known cis elements. The precise role of all of these elements in regulating expression of the rTRH gene in vivo is unknown, because even in their absence, luciferase activity was observed in TRH(+) tissue (Figs. 4Go, A–D and 5, A–D). They may, however, exert an important influence within the context of the endogenous gene. Although it appears clear that the region between +6 and +84 of the rTRH gene is important for regulating the activity of the rTRH gene in transgenic mice, the presence of these other regulatory elements suggests that the control of rTRH gene expression is complex. The interaction of upstream and downstream elements in the rTRH gene is likely to be the mechanism for regulating TRH gene expression in vivo.


   Acknowledgments
 
We thank the staff of the Transgenic Facilities at the Duke University Cancer Center and the University of Miami School of Medicine for their assistance in the production and maintenance of transgenic mouse lines and Dr. Malcolm Low, Vollum Institute, for critical reading of the manuscript. Expert technical assistance was provided by Ms. Monika Genehr. The firefly luciferase gene was generously provided by Dr. Ronald Emeson, Vanderbilt University.


   Footnotes
 
1 This work was supported in part by the Department of Veterans Affairs. Part of this work was conducted during the tenure of an Initial Investigatorship Award (to W.B.) from the American Heart Association, Florida Affiliate, Inc. Back

Received August 4, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lee SL, Stewart K, Goodman RH 1988 Structure of the gene encoding rat thyrotropin-releasing hormone. J Biol Chem 263:16604–16609[Abstract/Free Full Text]
  2. Yamada M, Radovick S, Wondisfore FE, Nakayama Y, Weintraub BD, Wilber JF 1990 Cloning and structure of human genomic DNA and hypothalamic cDNA encoding human preprothyrotropin-releasing hormone. Mol Endocrinol 4:551–556[Abstract]
  3. Jackson IMD 1982 Thyrotropin-releasing hormone. N Engl J Med 306:145–155[Medline]
  4. Lechan RM, Jackson IMD 1982 Immunohistochemical localization of thyrotropin-releasing hormone in the rat hypothalamus and pituitary. Endocrinology 111:55–65[Abstract]
  5. Segerson TJ, Hoefler H, Childers H, Wolfe HJ, Wu P, Jackson IMD, Lechan RM 1987 Localization of thyrotropin-releasing hormone prohormone messenger ribonucleic acid in rat brain by in situ hybridization. Endocrinology 121:98–107[Abstract]
  6. Bulant M, Beauvillain JC, Delfour A, Vaudry H, Nicolas P 1990 Processing of thyrotropin-releasing hormone (TRH) prohormone in the rat olfactory bulb generates novel TRH-related peptides. Endocrinology 127:1978–1985[Abstract]
  7. Bruhn TO, Rondeel JMM, Bolduc T, Jackson IMD 1994 Thyrotropin-releasing hormone (TRH) gene expression in the anterior pituitary. I. Presence of pro-TRH messenger ribonucleic acid and pro-TRH-derived peptide in a subpopulation of somatotrophs. Endocrinology 134:815–820[Abstract]
  8. Feng P, Gu J, Kim UJ, Carnell NE, Wilber JF 1993 Identification, localization and developmental studies of rat preprothyrotropin-releasing hormone mRNA in the testis. Neuropeptides 24:63–69[CrossRef][Medline]
  9. Sevarino KA, Wu P, Jackson IMD, Roos BA, Mandel G, Goodman RH 1988 Biosynthesis of thyrotropin-releasing hormone by a rat medullary thyroid carcinoma cell line. J Biol Chem 263:620–623[Abstract/Free Full Text]
  10. Gkonos PJ, Tavianini MA, Liu C-c, Roos BA 1989 Thyrotropin-releasing hormone gene expression in normal thyroid. Mol Endocrinol 3:2101–2109[Abstract]
  11. Carnell NE, Feng P, Kim UJ, Wilber JF 1992 Preprothyrotropin-releasing hormone mRNA and TRH are present in the rat heart. Neuropeptides 22:209–212[CrossRef][Medline]
  12. Klootwijk W, de Boer RD, Sleddens-Linkels E, Cockle SM, de Herder WW, Bauer K, Visser TJ, de Greef WJ 1997 Urinary excretion of the TRH-like peptide pyroglutamyl-glutamyl-prolineamide in rats. J Endocrinol 153:411–421[Abstract]
  13. Shambaugh G III, Hubek M, Wilber JF 1979 Thyrotropin-releasing hormone activity in the human placenta. J Clin Endocrinol Metab 48:483–486[Abstract]
  14. Patel YC, Reichlin S 1978 Somatostatin in hypothalamus, extrahypothalamic brain and peripheral tissues of the rat. Endocrinology 102:523–530[Medline]
  15. Thompson RC, Seasholtz AF, Herbert E 1987 Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1:363–370[Abstract]
  16. Mangalam HA, Albert VR, Ingraham HA, Kapilogg M, Wilson L, Nelson C, Elsholtz H, Rosenfeld MG 1989 A pituitary POU domain protein, Pit-1, activates both growth hormone and prolactin promoters transcriptionally. Genes Dev 3:946–958[Abstract/Free Full Text]
  17. Tverberg LA, Russo AF 1993 Regulation of calcitonin/calcitonin gene-related peptide gene by cell-specific synergy between helix-loop-helix and octamer-binding transcription factors. J Biol Chem 268:15965–15973[Abstract/Free Full Text]
  18. Montminy MR, Bilezikian LM 1987 Binding of a nuclear protein to the cyclic-AMP-response element within the rat somatostatin gene. Nature 328:175–178[CrossRef][Medline]
  19. Andrisani OM, Zhu ZN, Pot DA, Dixon JE 1989 In vitro transcription directed from the somatostatin promoter is dependent upon a purified 43-kDa DNA-binding protein. Proc Natl Acad Sci USA 86:2181–2185[Abstract/Free Full Text]
  20. Maniatis T, Goodbourn S, Fisher JA 1987 Regulation of inducible and tissue-specific gene expression. Science 236:1237–1245[Abstract/Free Full Text]
  21. Lee SL, Sevarino K, Roos BA, Goodman RH 1989 Characterization and expression of the gene encoding rat thyrotropin-releasing hormone (TRH). Ann NY Acad Sci 553:14–28[Medline]
  22. Jackson IMD, Lechan RM, Lee SL 1990 TRH prohormone: biosynthesis, anatomic distribution and processing. Frontiers Neuroendocrinol 13:267–312
  23. Andrisani OM, Dixon JE 1990 Somatostatin gene regulation. Annu Rev Physiol 52:793–806[CrossRef][Medline]
  24. de Bustros A, Ball DW, Peters R, Compton D, Nelkin BD 1992 Regulation of human calcitonin gene transcription by cyclic AMP. Biochim Biophys Acta 189:1157–1164
  25. Hollenberg AN, Monden T, Flynn TR, Boers M-E, Cohen O, Wondisford FE 1995 The human thyrotropin-releasing hormone gene is regulated by thyroid hormone through two distinct classes of negative thyroid hormone response elements. Mol Endocrinol 9:540–550[Abstract]
  26. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 9.4–9.58
  27. Sanger F, Niklen S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  28. deWet JR, Wood KV, DeLuca M, Helinski DR, Subrami S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  29. Russo AF, Lanigan TM, Sullivan BE 1992 Neuronal properties of a thyroid-C-cell line: partial repression by dexamethasone and retinoic acid. Mol Endocrinol 6:207–218[Abstract]
  30. Muszynski M, Birnbaum RS, Roos BA 1983 Glucocorticoids stimulate the production of preprocalcitonin-derived secretory peptides by a rat medullary thyroid carcinoma cell line. J Biol Chem 258:11678–11683[Abstract/Free Full Text]
  31. Braiser AR, Tate JE, Habener JF 1989 Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. BioTechniques 7:1116–1122[Medline]
  32. Hogan B, Costantini F, Lacy E 1986 Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 153–181
  33. Drews R, Drohan WN, Lubon H 1994 Transgene detection in mouse tail digests. BioTechniques 17:866–867[Medline]
  34. Bradford M 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  35. Kadonaga JT, Jones KA, Tijan R 1986 Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biol Sci 11:20–23
  36. Maue RA, Kraner SD, Goodman RH, Mandel G 1990 Neuron-specific expression of the rat brain type II sodium channel gene is directed by upstream regulatory elements. Neuron 4:223–231[CrossRef][Medline]
  37. Argentin S, Ardati A, Tremblay S, Lihrmann I, Robitaille L, Drouin J, Nemer M 1994 Developmental and stage-specific regulation of atrial natriuretic factor gene transcription in cardiac cells. Mol Cell Biol 14:777–790[Abstract/Free Full Text]
  38. Burnstein KL, Cidlowski JA 1989 Regulation of gene expression by glucocorticoids. Annu Rev Physiol 51:683–699[CrossRef][Medline]
  39. Luo L-G, Bruhn TO, Jackson IMD 1995 Glucocorticoids stimulate thyrotropin-releasing hormone gene expression in cultured hypothalamic neurons. Endocrinology 136:4640–4650[Abstract]
  40. Tavianini MA, Gkonos PJ, Lampe TH, Roos BA 1989 Dexamethasone stimulates thyrotropin-releasing hormone production in a C cell line. Mol Endocrinol 3:605–610[Abstract]
  41. Bruhn TO, Rondeel JMM, Bolduc T, Jackson IMD 1994 Thyrotropin-releasing hormone (TRH) gene expression in the anterior pituitary. III. Stimulation by thyroid hormone: potentiation by glucocorticoids. Endocrinology 134:826–830[Abstract]
  42. Bruhn TO, Bolduc T, Rondeel JMM, Jackson IMD 1994 Thyrotropin-releasing hormone (TRH) gene expression in the anterior pituitary. II. Stimulation by glucocorticoids. Endocrinology 134:821–825[Abstract]
  43. Palmiter RD, Brinster RL 1986 Germ-line transformation of mice. Annu Rev Genet 20:465–499[CrossRef][Medline]
  44. Dixon JE, Zhu A, Andrisani O 1990 Efforts directed at understanding cell-specific somatostatin gene expression. Metabolism [Suppl 2] 39:17–19
  45. Neznanov NS, Oshima RG 1993 cis regulation of the keratin 18 gene in transgenic mice. Mol Cell Biol 13:1815–1823[Abstract/Free Full Text]
  46. Gérard M, Douboule D, Zákány J 1993 Structure and activity of regulatory elements involved in the activation of the Hoxd-11 gene during late gastrulation. EMBO J 9:3539–3550[Medline]
  47. Tapscott SJ, Weintraub H 1992 MyoD and the regulation of myogenesis by helix-loop-helix proteins. J Clin Invest 87:1133–1138
  48. Peleg S, Abruzzese RV, Cote GJ, Gagel RF 1990 Transcription of the human calcitonin gene is mediated by a C cell-specific enhancer containing E-box-like elements. Mol Endocrinol 4:1750–1757[Abstract]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
A Cote-Velez, L Perez-Martinez, M Y Diaz-Gallardo, C Perez-Monter, A Carreon-Rodriguez, J-L Charli, and P Joseph-Bravo
Dexamethasone represses cAMP rapid upregulation of TRH gene transcription: identification of a composite glucocorticoid response element and a cAMP response element in TRH promoter
J. Mol. Endocrinol., February 1, 2005; 34(1): 177 - 197.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Clin. Nutr.Home page
H. J Teede, F. S Dalais, and B. P McGrath
Dietary soy containing phytoestrogens does not have detectable estrogenic effects on hepatic protein synthesis in postmenopausal women
Am. J. Clinical Nutrition, March 1, 2004; 79(3): 396 - 401.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
H. Guissouma, S. M. Dupre, N. Becker, E. Jeannin, I. Seugnet, B. Desvergne, and B. A. Demeneix
Feedback on Hypothalamic TRH Transcription Is Dependent on Thyroid Hormone Receptor N Terminus
Mol. Endocrinol., July 1, 2002; 16(7): 1652 - 1666.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
N. Becker, I. Seugnet, H. Guissouma, S. M. Dupre, and B. A. Demeneix
Nuclear Corepressor and Silencing Mediator of Retinoic and Thyroid Hormone Receptors Corepressor Expression Is Incompatible with T3-Dependent TRH Regulation
Endocrinology, December 1, 2001; 142(12): 5321 - 5331.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
E. A. Nillni and K. A. Sevarino
The Biology of pro-Thyrotropin-Releasing Hormone-Derived Peptides
Endocr. Rev., October 1, 1999; 20(5): 599 - 648.
[Abstract] [Full Text]

Home page
 FASEB J.Home page
H. Guissouma, M. T. Ghorbel, I. Seugnet, T. Ouatas, and B. A. Demeneix
Physiological regulation of hypothalamic TRH transcription in vivo is T3 receptor isoform specific
FASEB J, December 1, 1998; 12(15): 1755 - 1764.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balkan, W.
Right arrow Articles by Roos, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balkan, W.
Right arrow Articles by Roos, B. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals