| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Biological Chemistry (T.R.-F., R.T., J.O.), The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel; Department of Cell Biology and Biochemistry (S.R.K., D.M.S.), Texas Tech University Health Sciences Center, Lubbock, Texas 79430; and Department of Physiology (K.H.H., D.B.H.), University of Illinois at Chicago, Chicago, Illinois 60612-7342
Address all correspondence and requests for reprints to: Dr. Joseph Orly, Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel. E-mail: orly{at}vms.huji.ac.il
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-hydroxyprogesterone (11). StAR is an indispensable protein in
hormone regulated steroidogenesis. Moreover, it has been recently been
demonstrated that mutations in the gene for the StAR protein are the
cause of the potentially lethal disease, congenital lipoid adrenal
hyperplasia, in which the afflicted individuals are unable to
synthesize steroids to any great extent (12). Such affected infants die
shortly after birth, unless treated with steroid hormone replacement
therapy (11). In response to trophic hormones and cAMP, StAR is
synthesized as a 37-kDa precursor that is rapidly imported into the
mitochondria via its N-terminal leader sequence (13). Typical
mitochondrial uptake of StAR is associated with processing of StAR to
yield a 30-kDa phosphoprotein, the function of which, if any, is still
obscure (8, 9, 10, 14, 15). To test the effect of hormones on StAR levels in the ovary, the present study was designed to follow the expression pattern of StAR through the follicular phase of the ovarian response to gonadotropins in the rat and compare it with the levels of P450scc, the enzyme responsible for the conversion of cholesterol to pregnenolone. Furthermore, assuming that StAR is critical for the steroidogenic activity of the ovary, we were interested in examining the potential correlations between the levels of StAR, P450scc, and other steroidogenic cytochromes with the known plasma levels of ovarian steroids that are found throughout follicular development in the rat. To this end, PMSG/human CG (hCG)-treated prepubertal females served as an interesting experimental model because, at 2426 days of age, the functional cells of the rat ovary are considered naive due to low endogenous plasma gonadotropin levels (16). Yet, such ovaries are developmentally primed for a robust response to gonadotropin administration, resulting in ovulation of multiple follicles. Therefore, we anticipated that the superovulating rat model should enable the study of cell-specific StAR expression in the different cellular compartments of the rat ovary during the process of follicular maturation toward ovulation.
Our previous studies of P450scc expression (17) have shown that the
superovulating rat model proved to be instrumental in shedding light on
the mechanism of ovarian steroidogenesis, which, unlike other
steroid-producing organs, depends on the concerted action of different
cell types responding to more than one trophic hormone (18, 19). Those
cell types are: 1) the intrafollicular granulosa and cumulus cells
endowed with FSH responsiveness at early stages of follicular
development (17, 20, 21); for example, priming with FSH confers
granulosa cell induction of various genes expressed before the LH surge
(22), including cytochrome P450 aromatase (P450arom) catalyzing
estrogen synthesis, and high levels of LH receptors (23, 24); 2) the
follicular theca-interna cells, which constitutively possess LH
receptors, P450scc and androgen producing cytochrome P450 17, 20 lyase
(P45017
; 2426); and 3) the secondary interstitial cells, which
originate from hypertrophied theca interna cells of atretic follicles
(27, 28) and are, therefore, functionally related to theca cells. Both
the interstitial cells and the theca-interna cells produce androgens
but lack the ability to further process those to estrogens. By
contrast, the granulosa cells lack P45017
but can use the
theca-derived androgens as substrate for aromatization to estrogens by
their FSH-inducible P450arom (17, 22).
The present study describes a spatio-temporal expression pattern of
StAR observed in the different ovarian cell types which is novel. The
observed integrated expression pattern of StAR, P450scc, P45017
, and
P450arom suggest a revised model for the cellular organization of
ovarian steroidogenesis during the process of follicular
maturation.
| Materials and Methods |
|---|
|
|
|---|
Immunoreagents
StAR. All Western blot analyses were conducted by use of a
polyclonal rabbit antiserum raised against a peptide fragment (amino
acids 8898) of the 30-kDa mouse StAR protein (13). For
immunofluorescence histochemical studies and immuno-electron
microscopy, we applied a polyclonal rabbit antiserum to the recombinant
mature mouse StAR protein. To this end, the mouse StAR complementary
DNA (cDNA) was digested with SmaI and ligated to
BamHI linkers. The DNA was digested with BamHI,
and the 1273-bp fragment was cloned into the dephosphorylated
BamHI site of GEX2T (Pharmacia, Piscatway, NJ). The linker
sequences (5'-CGCGGATCCGCG-3') were added to maintain the reading frame
and add an alanine residue between the thrombin cleavage site of the
vector and amino acid 46 of StAR. This removes all but two amino acid
residues of the predicted signal peptide resulting in a fusion of the
mature 30-kDa form of StAR with glutathione S-transferase. The protein
was expressed in bacteria and purified by glutathione affinity
chromatography and injected into rabbits. A specific, high titer
antibody was elicited that was suitable for immunohistochemistry.
P450scc. A polyclonal rabbit antiserum to rat P450scc was prepared and previously characterized (29). Other antisera included commercially available lissamine rhodamine-conjugated AffiniPure goat antirabbit IgG (H + L), peroxidase-conjugated AffiniPure goat antimouse IgG (H + L) and 12 nm gold-labeled goat antirabbit IgG (Jackson ImmunoResearch Inc., West Grove, PA).
Animals
Intact, immature female Sprage-Dawley rats (21 days old) were
obtained from Harlan (Jerusalem, Israel) and maintained under 16-h
light, 8-h dark schedule with food and water ad libitum.
Animals were treated in accordance with the NIH Guide for the Care and
Use of Laboratory Animals. All protocols had the approval of the
Institutional Committee on Animal Care and Use, The Alexander Silverman
Institute of Life Sciences, The Hebrew University of Jerusalem.
In vivo treatments before tissue/cell extracts
Twenty-four-day-old rats were injected at 1000 h with sc
administered 15 IU PMSG; 50 h later, simulation of the LH surge
was achieved by hCG (4 IU) administration (sc). Under such conditions,
2030 oocytes ovulate 1214 h after hCG administration (21). At the
indicated time points the animals were killed by cervical dislocation,
the ovaries were removed, trimmed free of fat and stored in liquid
nitrogen until further processing for extraction of proteins or total
RNA. Four rats were used for each of the time points between 036 h
postPMSG administration, whereas two animals were killed to obtain the
ovaries during advanced stages of follicular development. From each
animal, one of the ovaries was processed for protein extraction and
Western blot analysis, whereas the collateral organ was extracted with
RNAzol BTM (Cinna Biotex, Houston, TX), for total RNA
preparation.
RT-PCR analysis
Total RNA was prepared by RNAzol B extraction after
homogenization of the tissue (100300 µl/ovary) by 57 gentle
strokes of Dounce homogenizer (Wheaton, Millville, NJ). Further
procedures were conducted according to the manufacturers
instructions. RNA samples were precipitated in 70% ethanol and stored
at -20 C until use. Dried RNA pellets were dissolved in water
containing 0.1% diethylpyrocarbonate (DEPC), and quantified by
measuring the absorbency at 260 nm. Aliquots containing 50100 ng RNA
were assayed by relative-quantitative RT-PCR procedure as previously
described (30, 31). Briefly, RT was performed for 75 min at 42 C using
500 ng pd(T)1218 primers (Pharmacia no. 277858,
Piscatway, NJ) and 0.25 unit of AMV reverse transcriptase (Promega no.
M510, Madison, WI); for RT-PCR determination of the rat StAR
transcript, it was found to be essential that rat StAR reverse
oligonucleotide B be added during RT. PCR was conducted in the presence
of 2 µCi of [
-32P]-deoxy-ATP (3000 Ci/mmol), all
four dNTPs (200 µM) and 500 ng of the appropriate
oligonucleotide primers (5060 pmol); oligonucleotide primers for the
ribosomal protein L19 served as an internal control. Following the PCR
reaction (20 cycles, annealing temperature of 65 C), tracking dye gel
buffer was added to 2040 µl of the PCR reaction mixture (100 µl)
for further analysis by electrophoresis on 5% polyacrylamide gels
(30). The dried gels were quantified using a Fuji Bio-Imaging analyzer
(BAS-1000, Fuji Photo Film Co., Tokyo 106, Japan). The radioactivity in
each of the PCR bands was normalized to the radioactivity of the
ribosomal protein L19 band that was used as an internal control. Gels
were also exposed to RX medical x-ray film (Fuji Photo Film,
Tokyo 106, Japan) for 216 h at -80 C and developed by a X-Omat
processor.
PCR oligonucleotide primer pairs were designed based on known cDNA
sequences of the various target genes, so that the expected PCR
products would be 246 bp for the rat StAR cDNA (Ref. 32 and our
unpublished sequence); 536 bp for the rat P450scc; 271 bp for the rat
P450arom; 361 bp for rat P45017
, and 194 bp for the rat RPL19.
Forward (A, sense) and reverse (B, antisense) primers were: rat StAR A,
5'-GCAGCAGGCAACCTGGTG and StAR B, 5'-TGATTGTCTTCGGCAGCC; rat P45017
A, 5'-GGGGCAGGCATAGAGACAACT and P45017
B, GCCTGAGCGCTTCTTAGATCC;
other primer sequence for RT-PCR determination of P450scc, P450arom and
L19 messenger RNA (mRNA) were previously published (30).
Western blot analysis
Whole ovary proteins were extracted in RIPA buffer (150
mM NaCl, 50 mM Tris-HCl, pH 7.5, 1% Triton
X-100, 0.5% deoxycholate, 0.1% SDS and 0.1 mM of freshly
added phenylmethylsulfonylfluoride) by homogenization (100 µl/ovary)
in a Dounce homogenizer, as described for extraction of RNA above. For
determination of cell-specific expression of StAR, first, granulosa
cells were expressed by needle pricking as previously described (31),
and the resulting residual tissue was designated as a mixture of
theca-interna and secondary interstitial (theca-interstitial) cells.
Both cell types were further extracted by homogenization in RIPA
buffer. After homogenization, samples were incubated for 30 min on ice,
vortexed, and centrifuged for 5 min at 14,000 x g. The
supernatant was separated and protein concentration was determined by a
modification of the protein assay according to Bradford (33). SDS-PAGE
sample buffer (31 mM Tris-HCl pH 6.8, 1% SDS, 0.05
mM EDTA, 5% glycerol, and 0.003% bromophenol blue) was
added to the samples, and after heating for 5 min at 95 C, samples were
stored at -20 C until use.
Samples were electrophoresed on a 10% mini gel by standard SDS-PAGE procedures (34), along with prestained mol wt markers (Novex MultiMark, Novex, San Diego, CA). Gels were electrophoresed at 30 mA/mm at 4 C using a running buffer that included 12.5 mM Tris base, 96 mM glycine, and 0.01% SDS. The proteins were electrophoretically transferred to Optitran BA-S 85 nitro-cellulose membrane (Schleicher & Schuell, Dassel, Germany) using a semidry electro-transfer apparatus (E&K Scientific Products, Saratoga, CA). Protein transfer was conducted for 45 min at 3 mA/cm2 in a modified buffer consisting of 48 mM Tris-base, 39 mM glycine, 0.04% SDS, and 20% methanol (35). The membrane was blocked by a 30-min incubation in blocking buffer (PBS buffer containing 0.1% Tween 20 and 5% nonfat dry milk), followed by an overnight incubation with anti-StAR (1:5000) and anti P450scc (1:10,000). After three washes for 5 min each with PBS/Tween buffer (as above, without milk), the membranes were incubated for 1 h with peroxidase-conjugated goat antirabbit IgG (1:10,000 dilution). Specific signals were detected by chemiluminescence using the LumiGlo substrate (New England BioLabs, Beverly, MA).
Analysis of chemiluminescence Western blot data
Quantitation of chemiluminescence signals on x-ray films was
performed as follows: chemiluminescence pseudo-autoradiograms were
scanned using a Power Macintosh computer (6200/75, Apple Computer
Corp., Cupertino, CA) scanner (AV 6120, Avision Inc. Hsinchu, Taiwan)
using a green filter, 150 dpi resolution, 256 gray-levels, 10%
brightness, 30% contrast and
= 2. Quantification of scanned images
was performed according to the user manual of the public domain NIH
Image Program (developed at the U.S. National Institutes of Health and
available on the Internet at http://rsb.info.nih.gov/nih-image/).
COS cell expression of recombinant StAR
COS cells (2 x 106 cells/0.8 ml) were
transfected by electroporation using 30 µg pCMV(StAR) DNA (14) as
previously described (31). The electroporated cells were seeded onto 13
mm round glass slides and placed in the wells of a 24-well plate (Nunc,
Denmark). After a 48-h incubation in DMEM:F-12 medium containing 5%
FCS (Biological Industries, Kibbutz Beit-Haemek, Israel), the cell
monolayers were fixed and immunofluorescently stained as described
below.
Primary cell cultures
Granulosa cells were isolated by needle pricking and the
resulting residual tissue, comprised of theca-interstitial cells was
further dissociated into a single cell suspension by collagenase-DNase
treatment as previously described (19). Both granulosa cells and
theca-interstitial cell cultures were plated onto serum-coated round
glass slides prepared for serum free culture as previously described
(31). Serum-free medium (4F medium) consisted of 1:1 (vol/vol) mixture
of DMEM:F-12 nutrient media (36), supplemented with insulin,
transferrin and hydrocortisone (31). Both cell types were grown in
24-well plates (Nunc Copenhagen, Denmark) incubated at 37 C in a
humidified incubator 95% air/5% CO2. Theca-interstitial
cells were treated for 5 h with 50 ng/ml LH, whereas 100 ng/ml FSH
was added to the granulosa cell cultures, followed by further
processing for immunofluorescence staining.
Immunofluorescence staining
The immunofluorescence staining procedure used to visualize
mitochondrial StAR in primary cultures and transiently transfected COS
cells has been described previously (37). Also, immunofluorescence
staining of ovarian cryosections was performed as previously described
(38). Polyclonal rabbit antiserum to recombinant murine StAR (1:50) and
lissamine-rhodamine labeled goat (IgG) antirabbit IgG (1:20) were used
for both of the histochemical and cytochemical studies.
Electron microscopy and analysis of the data
Rat ovaries were trimmed free of fat and small fragments were
fixed in freshly prepared PBS containing 1% glutaraldehyde and 3%
p-formaldehyde. After an overnight incubation at 4 C (29, 39),
preparation of the tissue blocks in LR White resin (London Resin Co.,
Bassingstoke, UK) was performed as recently described (29). Thin
sections were incubated with 1:20 dilution of antirecombinant mouse
StAR, followed by incubation with 1:10 dilution of gold labeled goat
antirabbit IgG, as previously described (39).
The relative partitioning of gold particles observed in the different
submitochondrial compartments (legend of Fig. 6
) was assessed by
counting high power micrographs of mitochondria, as indicated in the
figure legends. Results are expressed as the mean ±
SE. For measurements comparing StAR distribution in the
adrenal and ovary, significance of StAR localization was determined
through the use of the Duncans multiple range test. A value of
P < 0.05 was considered as statistically
significant.
|
| Results |
|---|
|
|
|---|
, and P450arom in whole ovary extracts prepared time
dependently following the administration of PMSG to prepubertal rats.
For the analysis of mRNA, we applied a semiquantitative RT-PCR assay we
have previously characterized to study the effects of protein kinase
inhibitors on expression of the ovarian steroidogenic P450s (30).
Figure 1
|
mRNA. However, following the
gonadotropin administration, P45017
and P450arom transcript levels
provided a third type of time-dependent response to PMSG, comprising a
single peak, synchronously elevated 10 h before hCG
administration. Thereafter, as a result of hCG administration, both
P45017
and P450arom mRNAs precipitously declined and were totally
lost at the time of ovulation (Fig. 1
Figure 2
shows that StAR protein pattern
followed the profile of StAR mRNA, with a biphasic rise in the levels
of StAR protein typically seen in the ovarian homogenates. The peak
levels of StAR protein observed 816 h after PMSG administration
declined, thereafter, to nearly basal level at 36 h. Again,
P450scc levels were markedly different than those of StAR, depicting
three phases of P450scc accumulation in the ovary: no apparent change
in P450scc levels during the first hour after PMSG administration,
followed by a 2.5-fold gradual increase in accumulating P450scc until
hCG administration, and a final immediate rise in the cytochrome levels
responding to hCG. This pattern fully confirmed our earlier
characterization of P450scc protein levels observed during follicular
development (38).
|
|
|
|
Analysis of high power micrographs depicting several cells, which
retained good ultrastructural preservation of their mitochondria,
enabled a quantitative determination of StAR localization in the
different submitochondrial compartments. Based on the high resolution
demonstrated in the insets of panel D, five categories of
StAR localization were determined (legend of Fig. 6D
), and the relative
distribution of StAR was assessed (Fig. 7
). Such analysis revealed that in the
ovarian cells, no more than 8% of StAR antigenic sites were associated
with the outer membranes of the mitochondrion. Inside the organelle, a
total of 77% of the gold particles labeled the matrix, or were
apparently anchored to the matrix side of the cristae membranes.
Finally, some of StAR-associated particles (14%) were also found in
the intermembrane spaces, or were seemingly anchored to the inner face
of the cristae membranes.
|
Synthesis of StAR protein: the acute response
The attenuation of StAR mRNA and protein levels that followed the
initial response of the interstitial cells to PMSG was rather
unexpected and occurred for no immediately apparent reason. Yet, we
could not exclude the possibility that a short half life of the
gonadotropins, or alternatively, desensitization of the LH receptors
may have caused the observed loss of StAR expression in these cells. To
test these possibilities under in vivo conditions, we
administered a premature hCG bolus (4 IU), commencing 24 h after
PMSG administration and followed the mRNA and protein patterns of StAR
and P450scc in the boosted animals; control animals were treated as
usual by a single PMSG dose. The hCG boost demonstrated the capacity of
this hormone to restore StAR protein levels that had been declining
(Fig. 8A
). Nevertheless, this restoration
did not last more than 10 h, after which a subsequent loss of StAR
protein did occur. Interestingly, the hCG boost did not restore high
levels of StAR mRNA, as shown in Fig. 8B
. In this respect, it is also
noteworthy that the hCG boost did not significantly affect the P450scc
protein (Fig. 8A
) or mRNA (not shown).
|
| Discussion |
|---|
|
|
|---|
and P450arom, which
determine the ovarian production of progestins, androgens and
estrogens, respectively (46, 47, 48). Following this rationale, our
previous attempts to reveal the nature of the ovarian functional
cyclicity focused on characterization of P450scc expression patterns
during the process of follicular development (21, 28, 38). In light of
the earlier observation that the catalytic activity of P450scc is
inconsequential without an active delivery of substrate cholesterol to
its site in the mitochondrion (49), we needed to reevaluate our former
studies by following the expression patterns of the StAR protein, a
newly discovered protein, which is implicated in the regulation of
cholesterol uptake by the mitochondria (see reviews, Refs. 5, 50,
51).
StAR expression: the early response
Using the immature rat model, the present study demonstrates
remarkably rapid and dynamic changes in StAR levels during follicular
development. The unique biphasic pattern of StAR response to PMSG/hCG
was corroborated by three experimental approaches, including RT-PCR,
Western blot analyses, and immunohistochemistry. The last of these
methodologies clearly indicated that the immediate response of the
ovarian tissue to the administered hormones was confined to the
interstitial cells in between the follicles, as well as in fewer
islands of theca interna cells. StAR transcripts were readily
observable within 2 h following hormone administration, whereas no
such response could be detected for either of the three cytochrome
P450s we monitored using the same RNA extracts, i.e.
P450scc, P45017
, or P450arom. The rapid rise in StAR expression
provides, therefore, the first in vivo example of the acute
nature of StAR response in the rat ovary. Moreover, the initial burst
of StAR expression, exclusively confined to the interstitial cells and
some of the theca cells, is in agreement with our previous studies,
which showed that in unprimed prepubertal rats, these androgen
producing cells are endowed with both P450scc and a large reservoir of
cholesterol-ester lipids (29, 38). Consequently, the present studies
suggest that StAR expression in the interstitial cells completes the
exsisting protein repertoire (52) needed for steroidogenesis and,
thereby, drives androgen production in this ovarian compartment. In
this respect, StAR expression in the ovarian interstitial cells
probably resembles a similar scenario characterizing the constitutively
active testicular androgen-producing Leydig cells, in which StAR level
is upregulated in response to LH/hCG administration (32). Furthermore,
in light of our results, it is tempting to speculate that in cells of
the adrenal cortex, where proteins of the P450scc machinery are
constitutively expressed at high levels (1, 53), diurnal changes in
ACTH probably regulate StAR-mediated acute activation of
steroidogenesis leading to the typical secretory patterns of cortisol
in man (54).
Does the early rise in StAR expression generate de novo
synthesis of androgens in the PMSG treated animal? Although we have not
addressed this question by direct steroid measurements, positive and
convincing evidence to this effect was reported more than two decades
ago. Parker et al. (55) documented a 10-fold increase in
serum androstenedione and testosterone, which were elevated within
12 h after PMSG administration to prepubertal animals; yet serum
progesterone levels increased only 4-fold during the same time interval
(55). However, based on later studies of steroid metabolism in this rat
model, we now know that these reported androstenedione/testosterone
levels must not have represented total androgen output because
5
-reduction of the aromatizable androgens to androsterone is a
typical feature of the prepubertal rat ovary (25, 28). If so, what are
the physiological consequences related to the early wave of StAR
expression in the interstitial cells? The simple-minded assumption,
that the interstitial cells provide androgens for estrogen production
during this phase of follicular growth, is probably wrong, due to the
fact that P450arom is not yet expressed during this early stage of
follicular growth (Fig. 1
and Ref.22). Instead, we would like to
reinforce a previously proposed notion, that androgens can
synergistically potentiate FSH-induced actions in the granulosa cells
(56, 57, 58, 59). Although the mechanism of such nonsubstrate action of
androgens still remains ill-defined, thorough studies have demonstrated
that aromatizable, as well as nonaromatizable, 5
-reduced androgens
can markedly augment FSH induction of granulosa cell P450scc, P450arom,
LH receptors, and PRL receptors (58, 59). Therefore, it is tempting to
speculate that as a result of the early acute induction of StAR, the
steroidogenically active interstitial tissue may support
folliculogenesis by potentiating the effects of FSH on the functional
maturation of the granulosa cell in leading follicles, be it either
during onset of puberty, or during functional activation of a new
cohort of follicles recruited for ovulation in cycling females.
Richards and Bogovich (60, 61) have previously made a similar
observation in support of this possibility, showing that a sustained
administration of low doses of LH/hCG leads to a fully functional
maturation of immature rat follicles. Therefore, it has been argued
that, in the presence of the normal endogenous FSH secretion, the
response to LH, and not FSH, appears to play the limiting event in the
transition of follicles from the small antral stage to the preovulatory
stage. Our results seem to be consistent with this notion. Furthermore,
we wish to stress the contribution of the nonfollicular interstitial
cells, which, in the face of the limited capacity of the theca-interna
to express P450scc/StAR in the tertiary follicles, could possibly
assume the role of androgen production until completion of the theca
cell differentiation at later stages of follicular development.
Maturation of Graafian follicles is associated with StAR
loss
The high levels of StAR elicited by PMSG administration did not
remain for a long period of time in the mitochondria of the
interstitial cells. Following a substantial decline in StAR mRNA
steady-state level, StAR protein levels decreased as well, with an
apparent half-life of 1012 h, which is significantly shorter than
that previously determined for P450scc (36 h, Ref. 19, 62).
Interestingly, attempts to restore StAR levels by a single boost of hCG
administration transiently increased StAR protein to high levels in the
mitochondria, but this increase was not associated with a marked effect
on StAR mRNA (Fig. 8
). In other words, the hCG boost seemed to trigger
an increase in the translation of StAR from submaximal levels of StAR
mRNA. In this respect, unlike the coupled biphasic waves of StAR mRNA
and protein patterns described herein, the experimental manipulation of
the ovary by the LH/hCG boost has provided in vivo
circumstances to study the potential mode of transcription-independent
induction of StAR protein synthesis. Such a possibility should be
seriously considered as a feasible mode of StAR regulation in the ovary
because many reports have claimed that the acute stimulation of
adrenocorticosterone secretion by ACTH is resistant to inhibitors of
transcription (63, 64).
It is not clear why StAR expression decreased following its initial
burst in the interstitial cells. One possibility may be that
steady-state StAR mRNA levels dropped as previously observed in
stimulated MA-10 cells in culture (65). Therefore, it is possible that
the decrease in StAR mRNA levels occurs as a natural consequence of
StAR stimulation by hormones (65). Alternatively, a direct inhibitory
effect on StAR expression should be considered as well. Such precedents
have been previously reported for agents activating protein kinase C
signaling pathway in cultured human granulosa cells (66), and
luteolytic effects of PGF2
in bovine corpora lutea (67).
However, further studies are needed to determine if a negative mode of
StAR regulation is a viable mechanism manipulating StAR expression
during this stage of follicular development.
Surprisingly, the present study revealed that StAR was not expressed in the granulosa cells before hCG administration. A similar observation was recently made in heifers before ovarian hyperstimulation with eCG (68). This observation was not consistent with the high expression levels of P450scc documented in the granulosa cells of the Graafian follicles by Western blot analyses and immunohistochemical evidence (38). Therefore, if StAR truly determines the rate of steroidogenesis in the ovarian cells, these results imply that, at least in the immature rat undergoing PMSG-induced first ovulation, the de novo synthesis of androgen precursors needed for follicular estradiol production during the early to mid rat proestrus (42, 69), are not necessarily contributed by genuine cells of the follicle but rather by the secondary interstitial cells derived from atretic theca cells (70, 71, 72, 73). We, therefore, wish to stress again the pivotal physiological role of these nonfollicular cells, which should receive more attention for their possible contributions as important, if not major, cellular sites for substrate supply for estrogen production by the Graafian granulosa cells.
Yet, the inverse correlation between the levels of P45017
and
P450arom, both rising concomitantly, with the apparent decline in StAR
levels before the timing of the LH surge, posed an apparent difficulty
in explaining the need for StAR in facilitating the production of
estrogen during the simulated proestrus period. Again, although we have
not determined the levels of the ovarian steroids produced in our
animal model, it should be stressed that the attenuation of StAR levels
depicted in this study is consistent with a precipitous drop in serum
progesterone monitored before the preovulatory LH-surge in both cycling
rats (74) and the PMSG-treated rat model (55). Therefore, the inverse
levels of proestrus progesterone and estrogen levels suggest that a
relatively low rate of de novo steroidogenesis, possibly
determined by StAR, is nevertheless sufficient to allow a maximal rate
of estrogen synthesis, the serum levels of which are known to be two to
three orders of magnitude lower than those of progesterone and
androgens (42, 69, 74).
Orchestrated StAR expression in luteinizing follicles
The fidelity of StAR expression in the follicular cells was
demonstrated once again following simulation of the LH surge by hCG
administration; whereas high level of StAR expression was evident in
the interstitium and theca interna cells of all follicles, in the
granulosa cell compartment, the gonadotropin surge elicited an
expression of StAR that was strictly confined to the periovulatory
follicles. A similar pattern was previously observed under identical
circumstances for granulosa cell expression of P450scc, which was
exclusively confined to preovulatory and periovulatory follicles
(38).
Interestingly, StAR levels peaked within 8 h after hCG
administration, a period that has been previously defined as the
critical time interval needed for the granulosa and the theca interna
cells to pass the point of final commitment toward their terminal
luteinization (22, 75, 76). The physiological role of StAR expression
during this phase of follicular development can no longer relate to
estrogen production, in lieu of the typical concomitant LH-induced loss
of P45017
and P450arom expression (22, 77). Predominant progesterone
production (42, 69, 74) becomes, therefore, the physiologically
important ovarian event, which is tightly coupled to vigorous StAR
expression and a transient expression of progesterone receptors (74, 78).
Finally, our survey concluded with the second decrease in ovarian StAR observed 1214 h after hCG administration. This loss of StAR expression correlates well with the early estrus drop in circulating ovarian steroids (42, 69). As could be expected, StAR expression resumed in the active rat corpus luteum (Ronen-Fuhrman T. et al., unpublished data), as has also been documented in mid-to-late cycle corpora lutea of numerous species, including human (66), bovine (79, 80), mouse (65), and rat (32, 81). We may, therefore, conclude that the dynamic changes in StAR expression in the rat ovary model are consistent with the ovarian steroidogenic output, if the cyclical rate of ovarian steroidogenesis is determined by StAR.
Intramitochondrial localization of StAR
The detailed mechanism by which StAR may facilitate cholesterol
translocation to the mitochondrial inner membrane is still obscure.
However, the observed ultrastructural localization of StAR in the
ovarian mitochondria leads to intriguing, constructive conclusions.
First, our immuno-electron microscopy studies revealed that a few
hours after PMSG administration, over 90% of StAR protein localized
inside the mitochondrion rather than associated with potential contact
sites of the outer membranes, where StAR is expected to function in its
capacity to facilitate cholesterol entry. Moreover, the fate of StAR in
the mitochondria was further demonstrated by the marked difference
observed between the submitochondrial localization of hormone induced
ovarian StAR and the gold labeling of StAR in the adrenal fasciculata
tissue. Nine hours after PMSG induction, 77% of the ovarian StAR
labeling was associated with the matrix milieu, whereas less than 15%
of StAR antigens localized within the intermembrane spaces. By
contrast, nearly 1:1 ratio of StAR labeling was observed in the
adrenal, where over 45% of StAR antigens were spatially localized
within the intermembrane spaces and similar levels of the gold
particles labeled the mitochondrial matrix and the matrix face of the
cristae membranes. The reasons for these tissue-specific differences in
StAR distribution are not clear at present.
Altogether, these observations implied that StAR precursor remains on the mitochondrial surface for a relatively short time before it is processed upon its entry into the mitochondrion via its signal peptide. In light of this observation, it is tempting to assume that the intramitochondrial pool of StAR is biologically inactive and, therefore, cholesterol translocation is expected to depend on hormone induced synthesis of new StAR precursor molecules that are removed from the surface by means of its import and processing to yield the final 30-kDa mature mitochondrial form (5, 6). Therefore, such a model would be in agreement with the long-observed rapid inhibition of adrenal steroidogenesis following cycloheximide administration (49, 63, 82, 83, 84), yet suggests a slightly modified perception of StARs mechanism of action. On a time scale of minutes, StAR is not necessarily a short-lived protein, but is better described as a protein of a short-lived function, the active form of which is rapidly transformed by the mitochondrial import process.
In summary, the present study suggests that, during hormone induced follicular development in the rat, expression of the ovarian StAR is upregulated during two relatively narrow time intervals. The first wave of StAR expression is predominantly occurring in the nonfollicular androgenic interstitial tissue, whereas the second burst of StAR expression responds to the LH surge, generating a concerted appearance of this protein in the granulosa and theca interna compartments of the dominant follicles. Although we have applied an artificial stimulation of follicular development in this animal model, the observed pattern of StAR expression can potentially explain some long-standing enigmatic fluctuations of the ovarian steroid hormone output previously documented during the normal reproductive cycle of the rats. Obviously, a direct corroboration of ovarian StAR patterns during the normal estrous cycle in adult rat, still awaits further studies. Yet, our study supports the notion that, similar to the adrenal and testis, StAR probably plays an obligatory role in supporting the ovarian steroidogenic capacity. Moreover, the spatio-temporal nature of StAR expression further emphasizes the concept that ovarian steroidogenic output is a result of a well orchestrated functional collaboration between the different ovarian cell types.
| Footnotes |
|---|
2 Supported by NIH Grant HD-07271. ![]()
3 Supported by NIH Grant HD 27571. ![]()
Received June 4, 1997.
| References |
|---|
|
|
|---|
reduces steroidogenic acute regulatory (StAR) protein
messenger ribonucleic acid expression in the rat ovary. Endocrine 5:183190[CrossRef]
This article has been cited by other articles:
![]() |
P. R. Manna, M. T. Dyson, and D. M. Stocco Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives Mol. Hum. Reprod., June 1, 2009; 15(6): 321 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Khoury, E. Barbar, Y. Ainmelk, A. Ouellet, and J.-G. LeHoux Gonadal Function, First Cases of Pregnancy, and Child Delivery in a Woman with Lipoid Congenital Adrenal Hyperplasia J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1333 - 1337. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. West-Farrell, M. Xu, M. A. Gomberg, Y. H. Chow, T. K. Woodruff, and L. D. Shea The Mouse Follicle Microenvironment Regulates Antrum Formation and Steroid Production: Alterations in Gene Expression Profiles Biol Reprod, March 1, 2009; 80(3): 432 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Attar, H. Tokunaga, G. Imir, M. B. Yilmaz, D. Redwine, M. Putman, B. Gurates, R. Attar, N. Yaegashi, D. B. Hales, et al. Prostaglandin E2 Via Steroidogenic Factor-1 Coordinately Regulates Transcription of Steroidogenic Genes Necessary for Estrogen Synthesis in Endometriosis J. Clin. Endocrinol. Metab., February 1, 2009; 94(2): 623 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yivgi-Ohana, N. Sher, N. Melamed-Book, S. Eimerl, M. Koler, P. R. Manna, D. M. Stocco, and J. Orly Transcription of Steroidogenic Acute Regulatory Protein in the Rodent Ovary and Placenta: Alternative Modes of Cyclic Adenosine 3', 5'-Monophosphate Dependent and Independent Regulation Endocrinology, February 1, 2009; 150(2): 977 - 989. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Hui and H. A. LaVoie GATA4 Reduction Enhances 3',5'-Cyclic Adenosine 5'-Monophosphate-Stimulated Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid and Progesterone Production in Luteinized Porcine Granulosa Cells Endocrinology, November 1, 2008; 149(11): 5557 - 5567. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Martin, N. Boucher, C. Brousseau, and J. J. Tremblay The Orphan Nuclear Receptor NUR77 Regulates Hormone-Induced StAR Transcription in Leydig Cells through Cooperation with Ca2+/Calmodulin-Dependent Protein Kinase I Mol. Endocrinol., September 1, 2008; 22(9): 2021 - 2037. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zhao, A. De, Z. Hu, J. Li, S. M. Mulders, M. D. Sollewijn Gelpke, E.-K. Duan, and A. J. W. Hsueh Gonadotropin Stimulation of Ovarian Fractalkine Expression and Fractalkine Augmentation of Progesterone Biosynthesis by Luteinizing Granulosa Cells Endocrinology, June 1, 2008; 149(6): 2782 - 2789. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Mouillet, X. Yan, Q. Ou, L. Jin, L. J. Muglia, P. A. Crawford, and Y. Sadovsky DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function Endocrinology, May 1, 2008; 149(5): 2168 - 2175. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T Dyson, J. K Jones, M. P Kowalewski, P. R Manna, M. Alonso, M. E Gottesman, and D. M Stocco Mitochondrial A-Kinase Anchoring Protein 121 Binds Type II Protein Kinase A and Enhances Steroidogenic Acute Regulatory Protein-Mediated Steroidogenesis in MA-10 Mouse Leydig Tumor Cells Biol Reprod, February 1, 2008; 78(2): 267 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Granot, O. Kobiler, N. Melamed-Book, S. Eimerl, A. Bahat, B. Lu, S. Braun, M. R. Maurizi, C. K. Suzuki, A. B. Oppenheim, et al. Turnover of Mitochondrial Steroidogenic Acute Regulatory (StAR) Protein by Lon Protease: The Unexpected Effect of Proteasome Inhibitors Mol. Endocrinol., September 1, 2007; 21(9): 2164 - 2177. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Irusta, F. Parborell, and M. Tesone Inhibition of cytochrome P-450 C17 enzyme by a GnRH agonist in ovarian follicles from gonadotropin-stimulated rats Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1456 - E1464. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sher, N. Yivgi-Ohana, and J. Orly Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A Brown, K. Sayasith, N. Bouchard, J. G Lussier, and J. Sirois Molecular cloning of equine 17{beta}-hydroxysteroid dehydrogenase type 1 and its downregulation during follicular luteinization in vivo J. Mol. Endocrinol., January 1, 2007; 38(1): 67 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Q. Su, M. Nyegaard, M. T. Overgaard, J. Qiao, and L. C. Giudice Participation of Mitogen-Activated Protein Kinase in Luteinizing Hormone-Induced Differential Regulation of Steroidogenesis and Steroidogenic Gene Expression in Mural and Cumulus Granulosa Cells of Mouse Preovulatory Follicles Biol Reprod, December 1, 2006; 75(6): 859 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lazzaro, D. Pepin, N. Pescador, B. D. Murphy, B. C. Vanderhyden, and D. J. Picketts The Imitation Switch Protein SNF2L Regulates Steroidogenic Acute Regulatory Protein Expression during Terminal Differentiation of Ovarian Granulosa Cells Mol. Endocrinol., October 1, 2006; 20(10): 2406 - 2417. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Brown, M. Dore, J. G. Lussier, and J. Sirois Human Chorionic Gonadotropin-Dependent Up-Regulation of Genes Responsible for Estrogen Sulfoconjugation and Export in Granulosa Cells of Luteinizing Preovulatory Follicles Endocrinology, September 1, 2006; 147(9): 4222 - 4233. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. N. Parakh, J. A. Hernandez, J. C. Grammer, J. Weck, M. Hunzicker-Dunn, A. J. Zeleznik, and J. H. Nilson Follicle-stimulating hormone/cAMP regulation of aromatase gene expression requires beta-catenin PNAS, August 15, 2006; 103(33): 12435 - 12440. [Abstract] [Full Text] [PDF] |
||||
![]() |
K A Brown, D Boerboom, N Bouchard, M Dore, J G Lussier, and J Sirois Human chorionic gonadotropin-dependent induction of an equine aldo-keto reductase (AKR1C23) with 20{alpha}-hydroxysteroid dehydrogenase activity during follicular luteinization in vivo. J. Mol. Endocrinol., June 1, 2006; 36(3): 449 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Myllymaki, T. E. Haavisto, L. J. S. Brokken, M. Viluksela, J. Toppari, and J. Paranko In Utero and Lactational Exposure to TCDD; Steroidogenic Outcomes Differ in Male and Female Rat Pups Toxicol. Sci., December 1, 2005; 88(2): 534 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
K P Lai, M H Wong, and C K C Wong Inhibition of CYP450scc expression in dioxin-exposed rat Leydig cells J. Endocrinol., June 1, 2005; 185(3): 519 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Kim, J. C. Havelock, B. R. Carr, and G. R. Attia The Orphan Nuclear Receptor, Liver Receptor Homolog-1, Regulates Cholesterol Side-Chain Cleavage Cytochrome P450 Enzyme in Human Granulosa Cells J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1678 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jo and D. M. Stocco Regulation of Steroidogenesis and Steroidogenic Acute Regulatory Protein in R2C Cells by DAX-1 (Dosage-Sensitive Sex Reversal, Adrenal Hypoplasia Congenita, Critical Region on the X Chromosome, Gene-1) Endocrinology, December 1, 2004; 145(12): 5629 - 5637. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jo, M. C. Gieske, C. E. Payne, S. E. Wheeler-Price, J. B. Gieske, I. V. Ignatius, T. E. Curry Jr., and C. Ko Development and Application of a Rat Ovarian Gene Expression Database Endocrinology, November 1, 2004; 145(11): 5384 - 5396. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. LaVoie, D. Singh, and Y. Y. Hui Concerted Regulation of the Porcine Steroidogenic Acute Regulatory Protein Gene Promoter Activity by Follicle-Stimulating Hormone and Insulin-Like Growth Factor I in Granulosa Cells Involves GATA-4 and CCAAT/Enhancer Binding Protein {beta} Endocrinology, July 1, 2004; 145(7): 3122 - 3134. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Pisarska, J. Bae, C. Klein, and A. J. W. Hsueh Forkhead L2 Is Expressed in the Ovary and Represses the Promoter Activity of the Steroidogenic Acute Regulatory Gene Endocrinology, July 1, 2004; 145(7): 3424 - 3433. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Brown, D. Boerboom, N. Bouchard, M. Dore, J. G. Lussier, and J. Sirois Human Chorionic Gonadotropin-Dependent Regulation of 17{beta}-Hydroxysteroid Dehydrogenase Type 4 in Preovulatory Follicles and Its Potential Role in Follicular Luteinization Endocrinology, April 1, 2004; 145(4): 1906 - 1915. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Raff, J. J. Lee, E. P. Widmaier, M. K. Oaks, and W. C. Engeland Basal and Adrenocorticotropin-Stimulated Corticosterone in the Neonatal Rat Exposed to Hypoxia from Birth: Modulation by Chemical Sympathectomy Endocrinology, January 1, 2004; 145(1): 79 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Granot, R. Geiss-Friedlander, N. Melamed-Book, S. Eimerl, R. Timberg, A. M. Weiss, K. H. Hales, D. B. Hales, D. M. Stocco, and J. Orly Proteolysis of Normal and Mutated Steroidogenic Acute Regulatory Proteins in the Mitochondria: the Fate of Unwanted Proteins Mol. Endocrinol., December 1, 2003; 17(12): 2461 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Liu, W. Z. Liu, Q. L. Li, H. M. Wang, D. Qian, E. Treuter, and C. Zhu Expression and Functional Analysis of Liver Receptor Homologue 1 as a Potential Steroidogenic Factor in Rat Ovary Biol Reprod, August 1, 2003; 69(2): 508 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.L. Espey, T. Ujioka, H. Okamura, and J.S. Richards Metallothionein-1 Messenger RNA Transcription in Steroid-Secreting Cells of the Rat Ovary During the Periovulatory Period Biol Reprod, May 1, 2003; 68(5): 1895 - 1902. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Irusta, F. Parborell, M. Peluffo, P. R. Manna, S. I. Gonzalez-Calvar, R. Calandra, D. M. Stocco, and M. Tesone Steroidogenic Acute Regulatory Protein in Ovarian Follicles of Gonadotropin-Stimulated Rats Is Regulated by a Gonadotropin-Releasing Hormone Agonist Biol Reprod, May 1, 2003; 68(5): 1577 - 1583. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Raff, J. J. Hong, M. K. Oaks, and E. P. Widmaier Adrenocortical responses to ACTH in neonatal rats: effect of hypoxia from birth on corticosterone, StAR, and PBR Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2003; 284(1): R78 - R85. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Espey and J. S. Richards Temporal and Spatial Patterns of Ovarian Gene Transcription Following an Ovulatory Dose of Gonadotropin in the Rat Biol Reprod, December 1, 2002; 67(6): 1662 - 1670. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Eimerl and J. Orly Regulation of Steroidogenic Genes by Insulin-Like Growth Factor-1 and Follicle-Stimulating Hormone: Differential Responses of Cytochrome P450 Side-Chain Cleavage, Steroidogenic Acute Regulatory Protein, and 3{beta}-Hydroxysteroid Dehydrogenase/Isomerase in Rat Granulosa Cells Biol Reprod, September 1, 2002; 67(3): 900 - 910. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ben-Zimra, M. Koler, and J. Orly Transcription of Cholesterol Side-Chain Cleavage Cytochrome P450 in the Placenta: Activating Protein-2 Assumes the Role of Steroidogenic Factor-1 by Binding to an Overlapping Promoter Element Mol. Endocrinol., August 1, 2002; 16(8): 1864 - 1880. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Chiao, W.-L. Cho, and P. S. Wang Inhibition of Testosterone Production by Propylthiouracil in Rat Leydig Cells Biol Reprod, August 1, 2002; 67(2): 416 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Owens, R. A. Keri, and J. H. Nilson Ovulatory Surges of Human CG Prevent Hormone-Induced Granulosa Cell Tumor Formation Leading to the Identification of Tumor-Associated Changes in the Transcriptome Mol. Endocrinol., June 1, 2002; 16(6): 1230 - 1242. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Logan, J. L. Juengel, and K. P. McNatty Onset of Steroidogenic Enzyme Gene Expression During Ovarian Follicular Development in Sheep Biol Reprod, April 1, 2002; 66(4): 906 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fritz, L. Kunz, N. Dimitrijevic, R. Grunert, C. Heiss, and A. Mayerhofer Muscarinic Receptors in Human Luteinized Granulosa Cells: Activation Blocks Gap Junctions and Induces the Transcription Factor Early Growth Response Factor-1 J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1362 - 1367. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I. Park, H.-J. Park, H.-S. Choi, K. Lee, W.-K. Lee, and S.-Y. Chun Gonadotropin Regulation of NGFI-B Messenger Ribonucleic Acid Expression during Ovarian Follicle Development in the Rat Endocrinology, July 1, 2001; 142(7): 3051 - 3059. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Johnson and J. T. Bridgham Regulation of Steroidogenic Acute Regulatory Protein and Luteinizing Hormone Receptor Messenger Ribonucleic Acid in Hen Granulosa Cells Endocrinology, July 1, 2001; 142(7): 3116 - 3124. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-J. Huang and P. Shirley Li Dexamethasone Inhibits Luteinizing Hormone-Induced Synthesis of Steroidogenic Acute Regulatory Protein in Cultured Rat Preovulatory Follicles Biol Reprod, January 1, 2001; 64(1): 163 - 170. [Abstract] [Full Text] |
||||
![]() |
D. Boerboom and J. Sirois Equine P450 Cholesterol Side-Chain Cleavage and 3{beta}-Hydroxysteroid Dehydrogenase/{{Delta}}5-{{Delta}}4 Isomerase: Molecular Cloning and Regulation of Their Messenger Ribonucleic Acids in Equine Follicles During the Ovulatory Process Biol Reprod, January 1, 2001; 64(1): 206 - 215. [Abstract] [Full Text] |
||||
![]() |
E. V. Solovyeva, M. Hayashi, K. Margi, C. Barkats, C. Klein, A. Amsterdam, A. J.W. Hsueh, and A. Tsafriri Growth Differentiation Factor-9 Stimulates Rat Theca-Interstitial Cell Androgen Biosynthesis Biol Reprod, October 1, 2000; 63(4): 1214 - 1218. [Abstract] [Full Text] |
||||
![]() |
C.L. Chaffin, G.A. Dissen, and R.L. Stouffer Hormonal regulation of steroidogenic enzyme expression in granulosa cells during the peri-ovulatory interval in monkeys Mol. Hum. Reprod., January 1, 2000; 6(1): 11 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-G. Lehoux, D. B. Hales, A. Fleury, N. Brière, D. Martel, and L. Ducharme The in Vivo Effects of Adrenocorticotropin and Sodium Restriction on the Formation of Different Species of Steroidogenic Acute Regulatory Protein in Rat Adrenal Endocrinology, November 1, 1999; 140(11): 5154 - 5164. [Abstract] [Full Text] |
||||
![]() |
J. Arensburg, A. H. Payne, and J. Orly Expression of Steroidogenic Genes in Maternal and Extraembryonic Cells During Early Pregnancy in Mice Endocrinology, November 1, 1999; 140(11): 5220 - 5232. [Abstract] [Full Text] |
||||
![]() |
L. K. Christenson, P. F. Johnson, J. M. McAllister, and J. F. Strauss III CCAAT/Enhancer-binding Proteins Regulate Expression of the Human Steroidogenic Acute Regulatory Protein (StAR) Gene J. Biol. Chem., September 10, 1999; 274(37): 26591 - 26598. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Silverman, S. Eimerl, and J. Orly CCAAT Enhancer-binding Protein beta and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells J. Biol. Chem., June 18, 1999; 274(25): 17987 - 17996. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Thompson, J. Powell, K. H. Thomas, and J. A. Whittaker Immunolocalization and Expression of the Steroidogenic Acute Regulatory Protein During the Transitional Stages of Rat Follicular Differentiation J. Histochem. Cytochem., June 1, 1999; 47(6): 769 - 776. [Abstract] [Full Text] |
||||
![]() |
S. Gräs, J. Hannibal, and J. Fahrenkrug Pituitary Adenylate Cyclase-Activating Polypeptide Is an Auto/Paracrine Stimulator of Acute Progesterone Accumulation and Subsequent Luteinization in Cultured Periovulatory Granulosa/Lutein Cells Endocrinology, May 1, 1999; 140(5): 2199 - 2205. [Abstract] [Full Text] |
||||
![]() |
C. L. Chaffin, D. L. Hess, and R. L. Stouffer Dynamics of periovulatory steroidogenesis in the rhesus monkey follicle after ovarian stimulation Hum. Reprod., March 1, 1999; 14(3): 642 - 649. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kerban, D. Boerboom, and J. Sirois Human Chorionic Gonadotropin Induces an Inverse Regulation of Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid in Theca Interna and Granulosa Cells of Equine Preovulatory Follicles Endocrinology, February 1, 1999; 140(2): 667 - 674. [Abstract] [Full Text] |
||||
![]() |
K. M. Ogilvie, K. Held Hales, M. E. Roberts, D. Buchanan Hales, and C. Rivier The Inhibitory Effect of Intracerebroventricularly Injected Interleukin 1฿ on Testosterone Secretion in the Rat: Role of Steroidogenic Acute Regulatory Protein Biol Reprod, February 1, 1999; 60(2): 527 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. LaVoie, J. C. Garmey, and J. D. Veldhuis Mechanisms of Insulin-Like Growth Factor I Augmentation of Follicle-Stimulating Hormone-Induced Porcine Steroidogenic Acute Regulatory Protein Gene Promoter Activity in Granulosa Cells Endocrinology, January 1, 1999; 140(1): 146 - 153. [Abstract] [Full Text] |
||||
![]() |
X. Wang, Z. Liu, S. Eimerl, R. Timberg, A. M. Weiss, J. Orly, and D. M. Stocco Effect of Truncated Forms of the Steroidogenic Acute Regulatory Protein on Intramitochondrial Cholesterol Transfer Endocrinology, September 1, 1998; 139(9): 3903 - 3912. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |