help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itahana, K.
Right arrow Articles by Takeya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itahana, K.
Right arrow Articles by Takeya, T.
Endocrinology Vol. 139, No. 1 320-329
Copyright © 1998 by The Endocrine Society


ARTICLES

Isolation and Characterization of a Novel Connexin Gene, Cx-60, in Porcine Ovarian Follicles1

Koji Itahana2, Toshiaki Tanaka, Yoko Morikazu3, Saori Komatu, Norihiro Ishida and Tatsuo Takeya

Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara 630–01, Japan

Address all correspondence and requests for reprints to: Dr. Tatsuo Takeya, Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara 630–01, Japan. E-mail: ttakeya{at}bs.aist-nara ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A new member of the connexin family was isolated from the porcine ovary. The amino acid sequence deduced from the nucleotide sequence of genomic as well as complementary DNA clones predicted the reading frame encoding the 60-kDa protein product, indicating the largest molecular mass among the connexin family genes analyzed to date; we named this gene Cx-60 based on its predicted molecular mass. The features of its primary structure were compared with those of other connexin genes, and the characteristics of its expression profile were examined in mammalian ovarian follicles. Cx-60 shares significant similarities with other connexins in the transmembrane and extracellular domains, but showed a highly unique primary structure in the cytoplasmic and carboxyl-terminal domains. The Cx-60 gene was unique in that its messenger RNA was detected in both the theca interna compartment and cumulus cells in the ovary; of other tissues, Cx-60 expression was relatively evident in the colon, thymus, and spleen. Cx-60, in contrast to Cx-43, was expressed constitutively upon gonadotropin stimulation when examined in hypophysectomized rats. Taken together, these results indicate that at least the connexin genes Cx-60, Cx-43, Cx-32, Cx-30.3, and Cx-26 are expressed in porcine ovarian follicles with differing expression profiles, including cell specificity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CONNEXINS oligomerize within the plasma membrane to compose special structures, known as connexons, that form intercellular channels, called gap junction channels (GJC), between adjacent cells, providing a direct pathway for the diffusion of small molecules (for review, see Refs. 1–5). GJC-mediated intercellular communications have been implicated in many cellular functions. For example, GJC allow potential propagation by passage of current-carrying ions in electrically excitable tissues, including cardiac and smooth muscle, and in electronic synapses of the nervous system. The physiological significance of such communication has been directly demonstrated by the analyses of Cx-43 knock-out mice in which cardiac abnormalities were observed (6, 7) and by the elucidation of an inherited human disease, Charcot-Marie-Tooth disease (CMT) (8), which is a genetically heterogeneous group of neuropathies resulting in progressive degeneration of peripheral nerves. One form of CMT, called CMTX, has been shown to be closely linked with genetic abnormalities in Cx-32 (3, 9, 10, 11, 12). Metabolic cooperation of cells through gap junctions is also believed to play an important role in maintaining homeostasis in avascular systems such as lens and ovarian follicles. In the ovarian follicles, intercellular communications between oocytes and the somatic cell components (e.g. cumulus, granulosa, and thecal cells) through GJC are thought to be involved in folliculogenesis and oogenesis (13).

At present, 12 different genes encoding the respective members of the connexin family have been identified and reported in rodents (4, 5). They consist of both highly conserved and divergent regions; the amino-terminal domains and four membrane-spanning regions are highly conserved, whereas the length and the primary structure of the two intracellular domains, named cytoplasmic and carboxyl-terminal domains, respectively, vary greatly in individual connexins. The molecular diversity seen in each connexin may reflect the functional and regulatory complexities of GJC described above, although details of the structure-function relationships in those two domains are mostly unknown.

It is known that some connexins are expressed rather ubiquitously, whereas other connexins are expressed in limited tissues or cell types, and occasionally, multiple connexins are expressed in a single cell (4). The complexity of such expression profiles makes it difficult to determine the physiological roles of connexins. To establish the role(s) of an individual connexin and how connexins share roles with each other, one feasible approach might be to take a tissue or an organ consisting of several cell types as a source and examine the connexin genes expressed there. We recently identified the expression of multiple connexin genes (Cx-43, -32, -30.3, and -26) in the porcine ovarian follicle (14). These genes showed respective expression profiles in terms of follicular compartments as well as in the estrous cycle. In the present study, we identified a new member of the connexin family expressed in the ovarian follicles and characterized the gene structure as well as its expression profile.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals, tissues, and cells
Pig tissues including ovaries were obtained at a local slaughterhouse (15). Ovarian follicles (~1–7 mm in diameter), granulosa cells, and cumulus-oocyte complexes were prepared as previously described (14). Female Wistar rats (4–10 weeks old) were hypophysectomized and shipped a week later by Japan SLC (Shizuoka, Japan). The rats were injected ip with 10 IU PMSG (Sigma Chemical Co., St. Louis, MO), followed by an ip injection of 10 IU hCG (U.S. Biochemical Corp., Cleveland, OH) 48 h after the first injection, when the additional effect of hCG was examined. In control experiments, PBS was injected instead of the respective hormones. The rats were killed 8 h after the injection of hCG, and the respective ovaries were removed from each rat and kept frozen until sectioning.

RNA extraction, RT, and PCR cloning
Total RNA was extracted from tissues by the acid guanidinium-phenol chloroform procedure (16), and possibly contaminated genomic DNA was removed by digestion with deoxyribonuclease (DNase) free of ribonuclease (RNase; RQ1 DNase; Promega, Madison, WI). Ten micrograms of total RNA were reverse transcribed into complementary DNA (cDNA) by Superscript II (Life Technologies, Grand Island, NY) with oligo-(deoxythymidine)12–18 primer for RT-PCR according to the supplier’s instructions. The conditions for PCR cloning with a pair of degenerated oligonucleotides were described previously (Fig. 1AGo) (14). The products were finally subcloned in pT7Blue-T cloning vector (Novagen, Madison, WI) and subjected to DNA sequence analysis using an ABI3700 or ABI310 system (Perkin Elmer, Foster City, CA). To extend the cDNA clones thus obtained toward both the 5'- and 3'-ends, we prepared two kinds of gene-specific primers (GSP-1 and -2 in Fig. 1BGo) for a rapid amplification of cDNA ends (RACE) reaction (Marathon cDNA Amplification Kit, Clontech Laboratory, Palo Alto, CA).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. PCR cloning of Cx-60. A, Domains of the connexins are defined according to Bennett et al. (1) and are indicated as follows: amino-terminus (N), cytoplasmic loop (Cy), carboxyl-terminus (C), membrane-spanning (M1–M4), and extracellular loop (E1, E2). The locations of the two primers (primers F and R) used for RT-PCR and nucleotide sequences of each primer are shown below. B, Strategies of 5'- and 3'-RACEs. Two kinds of GSPs were prepared based on the nucleotide sequences identified in the amplified product in A, and their sequences are shown at the bottom: one, GSP-1, was in the forward direction and was used for 3'-RACE; the other, GSP-2, was in the reverse direction and was used for 5'-RACE. AP-1 (adapter primer; Marathon cDNA amplification kit, Clontech) was used for both reactions. Striped region, Region amplified by RT-PCR in A; solid region, adapter site.

 
In situ hybridization and probes
Procedures for the in situ hybridization were essentially based on those described by Ausubel et al. (16), and ovarian sections (8 µm thick) for in situ hybridization were prepared essentially as described previously (14). A DNA fragment containing the region downstream of TM4 of Cx-60 (Fig. 2Go) was subcloned into RNA transcription vector pBluescript II SK+, and a complementary RNA (cRNA) probe on the antisense was prepared by in vitro transcription on the linearized constructs using SP6 RNA polymerase in the presence of digoxigenin-UTP. After the RNA polymerase reactions, DNA templates were hydrolyzed with RQ1 DNase. cRNA probes for other connexin genes were prepared based on the respective constructs, as described in the previous study (14).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. Deduced amino acid sequence of Cx-60. The putative amino acid sequence of the Cx-60 protein, derived from the DNA sequence analyses of cDNA and genomic clones, is shown. The predicted four transmembrane domains (TM1 through TM4) are underlined. Amino acid residues conserved in the connexin family through the species are indicated with asterisks. The sequence spaced by two arrows indicates the region amplified by RT-PCR as described in Fig. 1Go. Amino acids are numbered in the right margin.

 
Sections were stained by a digoxigenin detection kit (Boehringer Mannheim, Indianapolis, IN) according to the supplier’s instructions. RNase treatment was performed with RNase A (200 µg/ml) for 20 min at room temperature before fixation.

Cx-60 messenger RNA (mRNA) levels in tissues; Northern blotting and RT-PCR
Northern blotting with total RNA samples (20 µg) from the respective tissues was carried out as described previously (14, 17). The probes used for filter hybridizations were derived from the respective cDNA clones obtained in this and a previous study (14), and they were labeled with [32P]deoxy-CTP.

The expression of Cx-60 was examined by RT-PCR with total RNA samples (10 µg) from the respective tissues under the conditions described in the previous report, in which a linear amplification was achieved (14); briefly, 35 cycles of 94 C were performed for 30 sec, 60 C for 1 min, and 72 C for 2 min, followed by a final extension for 5 min at 72 C. For quantitative analysis, a pair of primers specific to Cx-60 (GCACTTTATAGACTCAGGGCCTTTG and AGCAGACATCCTTTCAGAGGGAC) was prepared to produce a 176-bp fragment, and the products were separated by gel electrophoresis using 3.5% NuSieve GTG agarose (FMC, Rockland, ME); the intensities of the products were measured by an ATTO Densitometric Analyzer (ATTO, Tokyo, Japan). A portion of the nucleotide sequences of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (18) was chosen to construct primers for PCR: 1) AGGTGAAGGCGGAGTCAAC and TACTCCTTGGAGGCCATGTG, and 2) AACAGCCTCAAGATCATCAGC and ACT-CATGGCATGGACTGTGG, which are expected to produce 1-kbp and 123-bp fragments, respectively.

Screening of porcine genomic library
A porcine genomic library (Clontech, PL1010j) was screened using standard techniques (16). A Cx-60 cDNA fragment used for in situ hybridization was labeled by [{alpha}-32P]deoxy-CTP, using random hexamers and Klenow fragment (Takara, Kyoto, Japan), and used as the Cx-60 probe. Purified genomic clones were directly used for either PCR amplification or DNA sequencing analysis (Dye Terminator Cycle Sequencing Kit, Perkin Elmer). For the PCR reactions, following two sets of primers were prepared: 1) CAGACTGGGAAATCCTTCATAG (from -140 to -119) and GCTGTGAGCTGTGGTGTAGG (from +1835 to +1855), and 2) TCACAGCTTAGAGCCCAG (from +333 to +351) and GGCGTAGAACATCAATGGTAAG (from +1423 to +1445), respectively (the number 1 indicates the first nucleotide of the coding region).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Connexin genes expressed in the porcine ovarian follicles; construction of primers, cDNA cloning, and DNA sequence analysis
In the previous study (14) we searched for connexin genes expressed in the porcine ovarian follicles by applying RT-PCR with degenerate oligonucleotide primers, producing at least four types of cDNA corresponding to Cx-32, Cx-30.3, Cx-26, and Cx-43. Further analyses of the PCR products obtained with a pair of primers, one of which corresponded to the sense strand of the first extracellular loop (primer F) and the other of which corresponded to the antisense strand sequence of the 5'-portion of the second extracellular loop (primer R; Fig. 1Go) (1) , revealed a clone containing a sequence that was not identical to those of any known connexin genes, yet retained the characteristic sequences of the family (Fig. 2Go and Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Amino acid identities of the putative topological domains of Cx-60 compared with those of other connexin family genes

 
To obtain cDNA clones containing the entire coding region, we first tried to screen porcine ovary and liver cDNA libraries by using the PCR product labeled with [{alpha}-32P]deoxy-CTP as a probe, but neither library produced positive clones, suggesting the low expression level of the corresponding mRNA. Therefore, we took another approach by extending the cDNA clone to both the 5'- and 3'-ends separately by the RACE system; the nucleotide sequences GCACTTATAGACTCAGGGCCTTTG (GSP-1) and AGCAGACATCCTTTCAGAGGGAC (GSP-2) within the amplified fragment (Figs. 1BGo and 2Go) were used as gene-specific primers for 5'- and 3'-end amplification, respectively. Products by both reactions were found to contain the common region flanked by GSP-1 and -2 as expected, and a single uninterrupted open reading frame (ORF) was deduced from the combined nucleotide sequences (Fig. 2Go), indicating that this approach was successful.

Screening and characterization of genomic clone
To confirm the nucleotide sequence deduced from the cDNA clones obtained by the RACE system, an analysis of genomic clones was performed. We screened the porcine genomic library (Clontech, Palo Alto, CA) and isolated three independent clones. First, we carried out PCR amplification with primers corresponding to the sequences either within or outside the ORF using the genomic clones (Fig. 3Go). The amplified products gave their respective sizes as expected from the cDNA analysis, implying that the deduced ORF could exist on the porcine genome, and also that this new gene was an intron-less gene, as are the other connexin genes (2, 4). This idea and the deduced nucleotide sequence from the cDNA clones were eventually examined by sequencing the corresponding regions on the genomic clones.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. PCR amplification of the Cx-60 coding region on genomic clones. Two pairs of oligonucleotides that are expected to produce a 1058-bp (lane 1) and a 1995-bp (lane 2) fragment, respectively, were prepared as described in Materials and Methods and used as primers for PCR amplification on genomic clones isolated from the porcine genomic library. Reactions with three independent clones gave identical patterns, and a representative profile is shown. M, {lambda}-HindIII size marker.

 
Primary structure of Cx-60
The deduced amino acid sequence predicts the product of 60 kDa molecular mass with structural features of the putative four transmembrane domains conserved in the connexin family (Fig. 2Go); hence, we named this gene Cx-60. The presence of the four putative membrane-spanning regions unique to the connexin family divide the connexin proteins into the nine regions shown schematically in Fig. 1Go. The primary sequences of Cx-60 in the respective regions are compared with those of other rat connexin genes (19, 20, 21, 22, 23, 24) and are summarized in Table 1Go. As the Cy and C regions are completely diverged among the family, the corresponding region is not included. In total, 53 residues common to all of the rat connexin genes can also be found in Cx-60 (Fig. 2Go); among them, cysteine residues in EC1 and EC2 (at 54, 61, 65, 189, 194, and 200) that show the conserved sequences CX6CX3C and CX4CX5C, respectively, were noted and have been suggested to be involved in intramolecular disulfide bond formation to link two extracellular loops (4).

The connexin family genes can be classified into two groups based on their similarities in primary structures and thus are prefixed with either {alpha} or ß; to date, seven genes in group {alpha} and five genes in group ß have been identified and characterized in the rodent system (1, 2, 5). This classification coincides fairly well with the molecular masses; the ß group includes the connexin proteins with molecular masses less than 33 kDa, suggesting that newly identified Cx-60 could be classified as a member of group {alpha}. Actually, Cx-60 showed more similarities with connexins larger than Cx-37 in the TM domains, in particular TM2 and TM3 (Table 1Go). In addition, group-specific residues, either {alpha} or ß, can be pointed out in the primary structures of the connexin family through the species; they are at Met2 (ß), Gly13 (ß), Val38 (ß), Val79 ({alpha}), Leu82 (ß), Tyr92 ({alpha})/Val92 (ß), Ala97 (ß), TrpTrp154–155 (ß), Gln/Arg191 ({alpha}), and SerLeu224–225 ({alpha}). In this respect, Cx-60 shows the characteristic features of group {alpha} at the corresponding residues.

Expression of Cx-60: in situ hybridization in the porcine ovary
As spatial- and stage-specific expressions of four connexin genes (Cx-26, -30.3, -32, and -43) have been revealed in porcine ovarian follicles (14), the expression profile of the newly isolated Cx-60 gene was studied first in porcine ovarian follicles and compared with those of other genes.

First, the specificity of the Cx-60 probe was examined against the four connexin genes, showing no cross-reactivity with the corresponding regions of other genes (Fig. 4AGo). By using this probe, expression of the Cx-60 gene and the size of its transcript were examined with total RNA from follicles and whole ovaries by Northern blotting, but no significant signals were obtained. As the same filter revealed the expression profile of the Cx-43 gene as that shown in the previous study (14), the low copy numbers of Cx-60 transcript in the respective tissues were evident, and the expression of Cx-60 mRNA was able to be confirmed only by RT-PCR (Fig. 4BGo) and in situ hybridization (described below).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 4. Expression of Cx-60 mRNA in the porcine antral follicles. A, Specificity of the Cx-60 probe. Fifty picograms (top row) or 5 pg (second row) of plasmid DNA encoding Cx-43 (a), Cx-32 (b), Cx-30.3 (c), Cx-26 (d), and Cx-60 (e), respectively, in addition to pGEM vector DNA (f) and calf thymus DNA (g), were spotted on a nitrocellulose membrane and hybridized with the digoxigenin-labeled Cx-60 probe. B, Detection of Cx-60 mRNA by RT-PCR. Total RNA from follicles was prepared and reverse transcribed as described in Materials and Methods. Cx-60- and Cx-43-specific primers were prepared to detect Cx-60 and Cx-43 mRNA, respectively, by PCR amplification of their portions, and the reaction products were separated by 3.5% NuSieve agarose gel electrophoresis. A portion of GAPDH (123 bp) was amplified as an internal control. Lane M, HindIII-digested {lambda} DNA (125 bp); lane 1, Cx-43; lane 2, Cx-43 and GAPDH; lane 3, Cx-60; lane 4, Cx-60 and GAPDH; lane 5, Cx-60 and GAPDH (no RT products); lane 6, GAPDH. C, In situ hybridizations. A section (8 µm) of the large porcine follicles hybridized with the Cx-60 probe is shown with (a) or without (b) phase contrast (magnification, x20). c, A RNase-treated section. d, The same sample as a at a higher magnification (x100). e, A representative profile of a cumulus-oocyte complex (bar = 25 µm).

 
Next, the digoxigenin-labeled Cx-60 probe was prepared and hybridized with thin sections of porcine ovary containing antral follicles. Cx-60 was expressed exclusively in the theca interna (Fig. 4CGo, a, b, and d), where the expression of Cx-26 or -30.3 was detected in the previous experiments (14). RNase-treatment of the sections before hybridization failed to give any signals (Fig. 4CGo, c), indicating that the hybridization reactions were actually between the probe and the intrinsic Cx-60 transcripts.

We then examined Cx-60 expression in cumulus cells. As no follicle sections with cumulus-oocyte complexes (COC) were recovered or detected in those preparations due to the fixation procedures with antral follicles, we recovered COC separately from the total contents of antral follicles and probed them with the Cx-60 probe. Although the Cx-60 probe did not give positive signals in the granulosa cell compartment, in contrast to the thecal compartment, as described above, the same probe gave positive signal in the cumulus cells in five of seven samples to an extent similar to that in the thecal cells (Fig. 4CGo, e). In the previous study in which we showed the expression of Cx-43 and Cx-30.3 in cumulus cells, 10–20% of the COC remained unstained with the probes as well, whereas neither the Cx-26 nor the Cx-32 probe gave signals greater than the background level (14). Taken together, these results indicate that Cx-60 was expressed in cumulus cells.

Effect of gonadotropin administration on Cx-60 mRNA level in the rat ovary
To further investigate the above findings obtained using porcine ovaries and to examine the effect of gonadotropin (PMSG or/and hCG) stimulation on the expression of Cx-60 mRNA, we carried out the following experiments using 5- and 11-week-old hypophysectomized rats; the following results were obtained in both age groups. First, the expression profiles of five connexin genes, Cx-60, Cx-43, Cx-32, Cx-30.3, and Cx-26, were essentially identical between porcine and rat ovaries; those of Cx-60, Cx-43, and Cx-30.3 are shown in Fig. 5Go. Cx-60 mRNA was detected in the surrounding thecal cell compartment, where Cx-26 mRNA was also detected (as in the porcine system), although the compartment seemed to consist of fewer cell layers than that in the porcine ovary (Fig. 5aGo). This presumably made Cx-43 mRNA almost undetectable in the rat thecal cell compartment unlike in the porcine ovary (Fig. 5cGo). We detected Cx-60 mRNA expression in cumulus cells in the porcine ovary using recovered COC for the reason described above (14). However, unlike in the porcine system, it was very difficult to recover COC in a large quantity from the rat ovary. Therefore, we have little information on Cx-60 mRNA in rat cumulus cells.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 5. Differential expression of connexin genes in rat ovarian follicles. Hypophysectomized 5-week-old rats were stimulated with PMSG, and sections were prepared as described in Fig. 4Go, followed by hybridization with digoxigenin-labeled Cx-60 (a), Cx-30.3 (b), or Cx-43 (c) probe.

 
Second, the expression of Cx-60 mRNA was detected in hypophysectomized rats without gonadotropin stimulation, and the level seemed unchanged after PMSG or PMSG/hCG administration (Fig. 6Go), suggesting that Cx-60 is expressed constitutively in the rat ovarian follicle under the conditions observed. This profile was quite different from that of Cx-43 (Fig. 6Go), whose expression level was negligible without gonadotropin stimulation, whereas the level was significantly enhanced by PMSG stimulation and was down-regulated by additional hCG administration (25, 26, 27).



View larger version (145K):
[in this window]
[in a new window]
 
Figure 6. Effect of gonadotropin stimulation on Cx-43 and Cx-60 mRNA levels in the rat ovary. Hypophysectomized 5-week-old Wistar female rats were injected with PBS, PMSG, or PMSG/hCG as described in Materials and Methods. Sections (8 µm) were hybridized with the digoxigenin-labeled Cx-43 or Cx-60 probe. a, PBS-treated rats; b, PMSG-treated rats; c, PMSG/hCG-treated rats.

 
Cx-60 mRNA levels in other porcine tissues
Connexins are expressed in overlapping patterns, with most tissues expressing more than one connexin type. Northern blot analyses have shown that each connexin gene has its own distinct pattern of expression; for example, Cx-43 is widely expressed in several organs by many cell types, whereas other genes, such as Cx-31, -31.1, and -30.3, display a very restricted distribution (2, 4, 5). We, therefore, examined the expression of Cx-60 in various porcine tissues (i.e. intestine, lung, muscle, kidney, liver, ovary, colon, spleen, heart, cerebrum, pituitary gland, lens, and thymus) in comparison with Cx-43. Northern blotting with the Cx-43 probe showed a fairly ubiquitous expression of Cx-43 in those tissues (data not shown), as has been previously reported (4). However, hybridization of the same filter with the Cx-60 probe did not show any significant signals, indicating low expression levels in the tissues examined. Therefore, we examined the expression of Cx-60 by RT-PCR using the same RNA as that used for filter hybridization, and a typical profile of the agarose gel electrophoresis of the reaction products is shown in Fig. 7Go. Despite its overall limited expression, Cx-60 mRNA levels in restricted tissues such as the colon, thymus, and spleen (in addition to the ovaries) were noticeable; in contrast, Cx-60 mRNA levels in the lens and liver were extremely low.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 7. Expression of Cx-60 in tissues. Total RNA was isolated from each tissue and subjected to RT-PCR as described in Materials and Methods; under the conditions used, a linear amplification was achieved (14). Typical product profiles obtained by agarose gel electrophoresis (3.5% NuSieve GTG agarose) are shown. The upper bands (1 kbp) correspond to the GAPDH fragment, and the lower bands (176 bp) derive from an internal region of Cx-60. Lane M, HaeIII-digested pBR322; lane 1, intestine; lane 2, lung; lane 3, muscle; lane 4, kidney; lane 5, liver; lane 6, ovary; lane 7, no RNA; lane 8, colon; lane 9, spleen; lane 10, heart; lane 11, cerebrum; lane 12, pituitary gland; lane 13, lens; lane 14, thymus. The expression level in each tissue was normalized with the densities given by GAPDH RT products, and their relative estimates against the lane 1 (1.0) are shown at the bottom. (-) in lanes 5 and 13 indicates that Cx-60 bands in these lanes are too faint to estimate.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In a previous study we identified the expression of four connexin genes (Cx-43, Cx-32, Cx-30.3, and Cx-26) in porcine ovarian follicles and the surrounding thecal cells and showed that their expression patterns were differently regulated both temporally and spatially (14). Those findings suggested that the respective connexins and the resulting gap junctions play different physiological roles in folliculogenesis and/or oogenesis. In the present study we isolated a new member of the connexin gene family, Cx-60, which was predicted to encode the connexin with the largest mol wt reported to date.

We found that Cx-60 was expressed at very low levels in various organs and tissues. However, the possibility that the expression of Cx-60 is greater in other organs and tissues or at specific stages in development cannot be excluded. Although a low expression of Cx-60 mRNA does not necessarily indicate its less physiological significance, the low Cx-60 mRNA content made it difficult to quantitate its expression levels without combining appropriate techniques such as RT-PCR. An analysis at the protein level making use of an anti-Cx-60 antibody might be useful for quantitating the expression level of Cx-60 mRNA.

Despite this difficulty, Cx-60 was observed to have a unique expression profile by in situ hybridization in porcine ovarian follicles compared with those of the previously identified four connexin genes; namely, Cx-60 mRNA was identified in both thecal cells and cumulus cells, and Cx-60 seemed to be expressed constitutively upon gonadotropin stimulation. We previously reported that Cx-26, Cx-30.3, and Cx-32 are ubiquitously expressed in the theca interna, and that Cx-30.3 and Cx-43 are expressed in cumulus cells. The newly identified expression of Cx-60 in these two compartments thus confirms that multiple genes, including Cx-60, are expressed in each compartment, raising essential questions concerning the function of gap junctions formed by the respective connexins and their behaviors, e.g. whether all gap junctions are functional or, rather, cell-cell coupling is via one specific connexin, and whether these connexins can form heterologous channels. To examine these questions, experiments using cell systems expressing the respective connexin genes are required. Such experiments are underway in our laboratory.

In the porcine ovary, Cx-60 and Cx-26 mRNAs were found in the same region of the thecal cells as that previously described, but Cx-60 was different from Cx-26, in that Cx-60 mRNA was also detected in the cumulus cells in antral follicles. As, unlike Cx-30.3 and Cx-43, Cx-60 mRNA was not detected in the granulosa cells, this observation might seem odd. However, it has become evident in recent years that granulosa cells do not constitute a homogeneous tissue but, rather, show interesting regional specialization; there are distinctive differences between the peripheral positions of the membrane granulosa, periantral granulosa cells, and the cumulus region (13, 28, 29). These regions show not only morphological differences, but also distinctive characteristics in several other respects. For example, 1) the mitotic indexes in cumulus cells are 3 times higher than those in the mural granulosa cells (30, 31); 2) the affinity of hCG to rat cumulus and mural granulosa cells is the same, but the number of hCG-binding sites is very different between the two cell types (223 sites/cumulus cells vs. 2000 sites/mural cells) (32, 33); and 3) when the enzyme activity of P450 side-chain cleavage (P450scc) was examined after the administration of PMSG to immature rats, P450scc appeared in normal granulosa cells by 48 h, whereas P450scc was detected in the cumulus cells for the first time at the early onset of the endogenous LH surge (34, 35).

Taken together, these findings suggest that Cx-60 plays some specific role(s) in the cumulus cells in preovulatory and/or ovulating follicles. One specific function for the connexin gene(s) expressed in cumulus cells seems to be the formation of intercellular channels that ensure a communication pathway for the delivery of crucial signals to the oocyte (13, 36). As was found in Cx-37-/- mice (37), Cx-37 is expressed in the oocyte and is essential for oocyte maturation, implying that a functional gap junction between the oocyte and the cumulus cells is crucial for this process. As Cx-43 seems not to be involved in this channel formation (36, 37), Cx-60 as well as Cx-30.3 may be involved in forming heterotypic channels with Cx-37. An investigation of the expression of Cx-60 in murine cumulus cells and/or the expression of Cx-37 in porcine ovary and a construction of animals lacking Cx-60 are needed to understand the physiological role of Cx-60 in oogenesis and ovulation. Regarding the expression of Cx-60 in porcine cumulus cells, as described above, a limited number of COC could not be stained with the Cx-60 probe; it is not clear at this time, however, whether the presence of unstained COC has some physiological significance.

The expression profiles of the connexin genes were further examined in the rat ovary and compared with those in the porcine ovary. We reported previously that the porcine theca interna could be classified into two zones by probing with Cx-43. Although Cx-43 mRNA was detected in both the thecal and granulosa cell compartments, about a quarter of the region close to the lamina basalis (inner zone) appeared to be devoid of Cx-43 mRNA and protein as well (14). Cx-26, Cx-30.3, and Cx-32 mRNAs were detected in this zone. A major difference in the rat ovary was that Cx-43 mRNA was not clearly detected in the thecal cell compartment, unlike that in the porcine ovary. However, Cx-30.3 mRNA was equally expressed in the thecal and granulosa compartments, and Cx-43 is known to be incompatible with both Cx-26 and Cx-32 (Ref. 4 and references therein), suggesting that Cx-30.3 plays a role in connecting the thecal compartment with cumulus cells through the granulosa compartment. The compatibility of Cx-60 with Cx-26 and Cx-32 awaits further study.

The effects of gonadotropin administration on the expression of Cx-43 and Cx-60 were examined using hypophysectomized 5-week-old rats. Cx-43 mRNA was undetectable in the sections prepared from unstimulated ovaries, whereas the expression was induced after FSH administration, followed by a decrease in expression upon LH exposure. In this regard, the Cx-43 mRNA level was examined quantitatively in the porcine estrous cycle in the previous study (14) using RNA from the corpus luteum and corpus albicans in addition to small and large follicles. In that study the expression of Cx-43 mRNA was detected in the small follicles, and the level was constant until luteinization proceeded, then declined to 20% of the follicular level, indicating that the results obtained in these two studies are consistent. The down-regulation of Cx-43 expression by LH has been reported previously in follicle culture systems (26, 27). Cx-60 mRNA, in contrast, was essentially detected in the thecal layer, as was observed in the porcine ovary in all sections to a similar extent, suggesting that Cx-60 is expressed constitutively. However, the results obtained with Cx-60 mRNA in this context are qualitative, and further analyses may be needed to quantitate the change in expression levels and define the cell types in the rat thecal layer. In particular, as the thecal layer is known to be a complex tissue consisting of several different cell types, it might be important to specify the cell type in which Cx-60 is predominantly expressed. Finally, the sensitivity to gonadotropin administration seems to be different for each gene, because Cx-30.3 gave an expression profile similar to that of Cx-43 after PMSG treatment, whereas hCG stimulation did not reduce the Cx-30.3 mRNA level (data not shown).

The wide distribution and conservation of connexins in different cells and organisms as well as their modulation at both the transcription and protein levels indicate their fundamental importance for cell functions. Some of the physiological roles of the respective connexins in specific tissues have been revealed by the different approaches described above: the involvement of Cx-32 in an inherited human disease, CMT disease, and the swelling and blockage of the right ventricular outflow tract of the heart caused by a null mutation in Cx-43. Cx-37 was recently found to be present in the gap junction between oocytes and granulosa cells in mice, and mice lacking Cx-37 were reported to fail to complete meiotic processes and to ovulate as mentioned above (37). In the present study, Cx-60 was revealed to be unique in that its mRNA was detected predominantly in the thymus and spleen in addition to the ovary, where Cx-60 was originally isolated. As no other connexin genes have been reported to be expressed in the thymus or spleen (4), it is intriguing to examine the specific role of Cx-60 in these tissues; in particular, whether Cx-60 is directly involved in immune competence or the maturation of lymphocytes, and if it is required for channel formation between stromal cells and lymphocytes. With regard to these questions, very limited information on molecule selectivity or the regulatory mechanism of the Cx-60 gap junction is available at present; hence, the physiological significance of the rather restricted expression of Cx-60 awaits further clarification.


    Footnotes
 
1 This work was supported by a grant from the Japan Livestock Technology Association. Back

2 Present address: Lawrence Berkeley Laboratory, University of California, Berkeley, California 94720. Back

3 Present address: Mochida Pharmaceutical Co. Ltd., Kamiya, Kita, Tokyo 115, Japan. Back

Received May 22, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bennett MVL, Barrio LC, Bargiello TA, Spray DC, Hertzberg E, Saez JC 1991 Gap junctions: new tools, new answers, new questions. Neuron 6:305–320[CrossRef][Medline]
  2. Beyer EC 1993 Gap junctions. Int Rev Cytol 137C:1–37
  3. Paul DL 1995 New functions for gap junctions. Curr Opin Cell Biol 7:665–672[CrossRef][Medline]
  4. Bruzzone R, White TW, Paul DL 1996 Connections with connexins: the molecular basis of direct intercellular signaling. Eur J Biochem 238:1–27[Medline]
  5. Kumar NM, Gilula NB 1996 The gap junction communication channel. Cell 84:381–388[CrossRef][Medline]
  6. Reaume AG, deSousa PA, Kulkarni S, Langille BL, Zhu D, Davies TC, Juneja SC, Kidder GM, Rossant J 1995 Cardiac malformation in neonatal mice lacking connexin 43. Science 267:1831–1834[Abstract/Free Full Text]
  7. Britz-Cunningham SH, Maithili MS, Zuppan CW, Fletcher WH 1995 Mutations of the connexin 43 gap-junction gene in patients with heart malformations and defects of laterality. N Engl J Med 332:1323–1329[Abstract/Free Full Text]
  8. Chance PF, Fischbeck KH 1994 Molecular genetics of Charcot-Marie-Tooth disease and related neuropathies. Hum Mol Genet 3:1503–1507[Abstract]
  9. Bruzzone R, White TW, Scherer SS, Fischbeck KH, Paul DL 1994 Null mutations of connexin 32 in patients with X-linked Charcot-Marie-Tooth disease. Neuron 13:1253–1260[CrossRef][Medline]
  10. Fairweather N, Bell C, Cochrane S, Chelly J, Wang S, Mostacciuolo ML, Monaco AP, Haites NE 1994 Mutations in the connexin 32 gene in X-linked dominant Chrcot-Marie-Tooth disease (CMTX1). Hum Mol Genet 3:329–348
  11. Ionasescu V, Searby C, Ionasescu R 1994 Point mutations of the connexin 32 gene in X-linked dominant Charcot-Marie-Tooth neuropathy. Hum Mol Genet 3:355–358[Abstract/Free Full Text]
  12. Orth, U, Fairweather N, Exler MC, Schwinger E, Gal A 1994 X-linked dominant Charcot-Marie-Tooth neuropathy: valine-38-methionine substitution of connexin 32. Hum Mol Genet 3:1699–1700[Free Full Text]
  13. Eppig JJ 1991 Intercommunication between mammalian oocytes and companion somatic cells. Bioessays 13:569–574[CrossRef][Medline]
  14. Itahana K, Morikazu Y, Takeya T 1996 Differential expression of four connexin genes, Cx-26, Cx-30.3, Cx-32, and Cx-43, in the porcine ovarian follicle. Endocrinology 137:5036–5044[Abstract]
  15. Tanaka T, Andoh N, Takeya T, Sato E 1992 Differential screening of ovarian cDNA libraries detected the expression of the porcine collagenase inhibitor gene in junctional corpora lutea. Mol Cell Endocrionol 83:65–71[CrossRef][Medline]
  16. Ausubel FM, Brent R, Kingston RE, Moore DD, Smith JA, Seidman JG, Struhl K 1988 Current Protocols in Molecular Biology, suppl 7. Wiley Interscience, New York
  17. Tanaka T, Itahana K, Andoh N, Takeya T, Sato E 1995 Expression of prostatic secretary protein (PSP)-like protein in porcine corpus luteum: isolation and characterization of a new gene encoding PSP94-like protein. Mol Rep Dev 42:149–156[CrossRef][Medline]
  18. Tokunaga K, Nakamura Y, Sakata K, Fujimori K, Ohkubo M, Sawada K, Sakiyama S 1987 Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res 47:5616–5619[Abstract/Free Full Text]
  19. Paul, DL 1986 Molecular cloning of cDNA for rat liver gap junction protein. J Cell Biol 103:123–134[Abstract/Free Full Text]
  20. Beyer EC, Paul DL, Goodenough DA 1987 Connexin 43: a protein from rat heart homologous to a gap junction protein from liver. J Cell Biol 105:2621–2629[Abstract/Free Full Text]
  21. Beyer EC, Reed KE, Westphale EM, Kanter HL, Larson DM 1992 Molecular cloning and expression of rat connexin 40, a gap junction protein expressed in vascular smooth muscle. J Membr Biol 127:69–76[Medline]
  22. Zhang J-T, Nicholson BJ 1989 Sequence and tissue distribution of a second protein of hepatic gap junctions, Cx26, as deduced from its cDNA. J Cell Biol 109:3391–3401[Abstract/Free Full Text]
  23. Haefliger JA, Bruzzone R, Jenkins NA, Gilbert DJ, Copeland NG, Paul DL 1992 Four novel members of the connexin family of gap junction proteins. J Biol Chem 267:2057–2064[Abstract/Free Full Text]
  24. Ebihara L, Paul DL, Takemoto LJ, Swnson KI, Goodenough DA 1992 Connexin 46, a novel lens gap junction protein, induces voltage gated current in non-junctional plasma membrane of Xenopus oocytes. J Cell Biol 115:1077–1089[Abstract/Free Full Text]
  25. Wiesen JF, Midgley RJr 1993 Changes in expression of connexin 43 gap junction messenger ribonucleic acid and protein during ovarian follicular growth. Endocrinology 133:741–746[Abstract/Free Full Text]
  26. Schreiber JR, Beckmann MW, Polacek D, Davies PF 1993 Changes in gap junction connexin-43 messenger ribonucleic acid levels associated with rat ovarian follicular development as demonstrated by in situ hybridiazation. Am J Obstet Gynecol 168:1094–1104[Medline]
  27. Granot I, Dekel N 1994 Phosphorylation and expression of connexin-43 ovarian gap junction protein are regulated by luteinizing hormone. J Biol Chem 269:30502–30509[Abstract/Free Full Text]
  28. Greenwald GS, Roy SK 1994 Knobil E, Neill JD (eds) Follicular development and its control. The Physiology of Reproduction, ed 2, vol 1. Raven Press, New York, pp 571–627
  29. Weisz J, Zoller LC 1979 Pattison JR, Bitensky L, Chayen J (eds) Quantitative Cytochemistry and Its Applications. Academic Press, New York, pp 269–283
  30. Takaoka H, Satoh H, Makinoda S, Moriya S, Ichinoe K 1985 Granulosa-cell growth factor in oocyte and its transport systems. Acta Obstet Gynaecol Jpn 37:92–98
  31. Hirshfield AN 1986 Patterns of [3H]thymidine differ in immature rats and mature, cycling rats. Biol Reprod 34:229–235[Abstract]
  32. Amsterdam A, Koch Y, Lieberman ME, Lindner HR 1975 Distribution of binding sites for human chorionic gonadotropin in the preovulatory follicle of the rat. J Cell Biol 67:894–900[Abstract/Free Full Text]
  33. Lawrence TS, Dekel N, Beers WH 1980 Binding of human chorionic gonadotropin by rat cumuli oophori and granulosa cells: a comparative study. Endocrinology 106:1114–1118[Abstract/Free Full Text]
  34. Orly, J 1989 Orchstrated expression of steroidogenic side-chain cleavage cytochrome P-450 during follicular development in the rat ovary. J Reprod Fertil 37[Suppl]:155–162
  35. Goldschmit D, Kraicer P, Orly J 1989 Preovulatory expression of cholesterol side-chain cleavage cytochrome P-450 in cumulus cells. Endocrinology 124:369–378[Abstract/Free Full Text]
  36. Nicholson SM, Bruzzone R 1997 Gap junctions: getting the message through. Curr Biol 7:R340–R344
  37. Simon AM, Goodenough DA, Li E, Paul DL 1997 Female infertility in mice lacking connexin 37. Nature 385:525–529[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
A. M. Ratchford, C. R. Esguerra, and K. H. Moley
Decreased Oocyte-Granulosa Cell Gap Junction Communication and Connexin Expression in a Type 1 Diabetic Mouse Model
Mol. Endocrinol., December 1, 2008; 22(12): 2643 - 2654.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. C. SAEZ, V. M. BERTHOUD, M. C. BRANES, A. D. MARTINEZ, and E. C. BEYER
Plasma Membrane Channels Formed by Connexins: Their Regulation and Functions
Physiol Rev, October 1, 2003; 83(4): 1359 - 1400.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. E. I. Gittens, A. A. Mhawi, D. Lidington, Y. Ouellette, and G. M. Kidder
Functional analysis of gap junctions in ovarian granulosa cells: distinct role for connexin43 in early stages of folliculogenesis
Am J Physiol Cell Physiol, April 1, 2003; 284(4): C880 - C887.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W. E. I. Li, K. Waldo, K. L. Linask, T. Chen, A. Wessels, M. S. Parmacek, M. L. Kirby, and C. W. Lo
An essential role for connexin43 gap junctions in mouse coronary artery development
Development, March 6, 2003; 129(8): 2031 - 2042.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
I. Granot, E. Bechor, A. Barash, and N. Dekel
Connexin43 in Rat Oocytes: Developmental Modulation of Its Phosphorylation
Biol Reprod, March 1, 2002; 66(3): 568 - 573.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Shimada, T. Maeda, and T. Terada
Dynamic Changes of Connexin-43, Gap Junctional Protein, in Outer Layers of Cumulus Cells Are Regulated by PKC and PI 3-Kinase During Meiotic Resumption in Porcine Oocytes
Biol Reprod, April 1, 2001; 64(4): 1255 - 1263.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
B. Sommersberg, A. Bulling, U. Salzer, U. Fröhlich, R. E. Garfield, A. Amsterdam, and A. Mayerhofer
Gap Junction Communication and Connexin 43 Gene Expression in a Rat Granulosa Cell Line: Regulation by Follicle-Stimulating Hormone
Biol Reprod, December 1, 2000; 63(6): 1661 - 1668.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. Manthey, F. Bukauskas, C. G. Lee, C. A. Kozak, and K. Willecke
Molecular Cloning and Functional Expression of the Mouse Gap Junction Gene Connexin-57 in Human HeLa Cells
J. Biol. Chem., May 21, 1999; 274(21): 14716 - 14723.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itahana, K.
Right arrow Articles by Takeya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itahana, K.
Right arrow Articles by Takeya, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals