| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Pharmacology and Experimental Therapeutics (L.K.S., W.B., X.P., R.L., T.C.T.), Tufts University School of Medicine, Boston, Massachusetts 02111; Section of Pediatric Endocrinology (E.W., G.C.), National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: T. C. Theoharides, Ph.D., M.D., Department of Pharmacology and Experimental Therapeutics, Tufts University School of Medicine, 136 Harrison Avenue, Boston, Massachusetts 02111. E-mail: ttheoharides{at}infonet.tufts.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CRH may be synthesized locally at inflammatory sites, as evidenced by the presence of CRH messenger RNA (mRNA) in chronically inflamed synovia in rats (7). Both immunoreactive CRH (iCRH) and CRH mRNA have also been demonstrated in various components of the immune system, whereas mitogenic stimulation of human T lymphocytes results in synthesis of CRH (for review, see Ref.8). However, there is a discrepancy between the abundance of iCRH and the paucity of its mRNA at inflammatory sites in the early, acute phase of inflammation. The demonstration of CRH-like immunoreactivity in the dorsal horn of the spinal cord and dorsal root ganglia (9, 10), as well as in sympathetic nerve cell bodies in sympathetic ganglia (9, 11), support the hypothesis that the majority of iCRH in early inflammation is of neuronal rather than immune cell origin.
CRH administration to humans or animals iv causes significant dose-dependent peripheral vasodilation, manifested as flushing and hypotension (12). These effects may derive from activation of mast cells, which are located perivascularly, close to nerves (for review see Ref.13). In fact, acute psychological stress in rats resulted in dura mast cell activation and rat mast cell protease I secretion, which were CRH-dependent (14). Mast cells can be activated by nerve stimulation (15) or sensory neuropeptides such as SP (16), and they secrete potent vasoactive and proinflammatory mediators that include histamine, cytokines, prostanoids, and proteases (17).
The ability of CRH to activate mast cells may explain its proinflammatory actions and the pathophysiology of certain skin conditions, which are precipitated or exacerbated by stress, such as atopic dermatitis, eczema, psoriasis, and urticaria. Here we studied the ability of CRH to activate skin mast cells and increase vascular permeability in a receptor-specific, dose-dependent fashion.
| Materials and Methods |
|---|
|
|
|---|
Evans blue extravasation
Male Sprague Dawley rats, each weighing approximately 350 g
(Charles River, NY), were anesthetized with a single ip injection of
0.2 ml ketamine and 0.05 ml xylazine (100 mg/ml each) and injected iv
via the tail vein with 0.6 ml of 1% Evans blue, 10 min before
treatment. The same procedure was repeated with 0.01 ml of 10 mg/kg
xylazine and 80 mg/kg ketamine in 8-week-old male C57B/6J, as well as
W/Wv mast cell deficient mice [WBBGF1 (WB -
W/+ x C57BL/6-Wv) lineage] and
their +/+ normal counterparts (Jackson Laboratories, Bar Harbor, ME),
which were kept in virus-free sections. The W geno-type was
inferred from the white coat (depletion of hair pigment) of the
animals. All animals were housed in a modern animal facility and were
allowed ad libitum access to food and water. Drugs were
tested by intradermal injection in 0.05 ml normal saline using a
tuberculin syringe. The CRH was drawn in one syringe while, when
appropriate, the pretreatment solutions were prepared in different
syringes to avoid any mixing between the two solutions. The
pretreatment solution was injected first and was allowed to remain in
the skin for 5 min before CRH. Antalarmin was dissolved as 20 mg/0.05
ml in absolute ethanol and the appropriate amount (to correspond to the
desired mg/kg BW) was then dissolved in normal saline; unfortunately,
it quickly came out of solution and clearly resulted in variable
bioavailability. The final amount injected was 0.5 ml iv in the tail
vein 6 h before CRH injection. The animal was killed 15 min later
by asphyxiation over CO2 vapor and decapitated; the skin
was removed, turned over, and photographed. Animals were handled one at
a time in an isolated procedure room inside the animal facility to
minimize any effect of the stress of handling, change of environment,
or presence of other injected animals.
Evans blue extraction
Evans blue extravasated in the skin was extracted by incubating
the skin samples in 99% N,N-dimethyl-formamide (Sigma) for
24 h at 55 C and was quantitated fluorometrically at an excitation
wavelength of 620 nm and an emission wavelength of 680 nm (18).
Microscopy
In rats or mice not injected with Evans blue, the skin from the
site where drugs were introduced was rapidly removed at the end of the
injection period and was fixed in 4% paraformaldehyde for light
microscopy (19). The tissue was then frozen and thin sections (7 µm)
were cut using a cryostat (Jung CM 3000, Leica, Deerfield, IL). The
sections were stained with acidified (pH < 2.5) toluidine blue
(Sigma), and all mast cells were counted by two different researchers,
blinded to the experimental conditions, at 200x magnification using a
Diaphot inverted Nikon microscope (Don Santo Corp., Natick, MA). For
electron microscopy, samples were fixed in modified Kanovskys
fixative containing 0.2% paraformaldehyde, 3% glutaraldehyde, and
0.5% tannic acid in 0.1 mM Na-cacodylate buffer prepared
as before (20) and photographed using a Philips-300 transmission
electron microscope.
Capsaicin treatment
For sensory nerve neuropeptide depletion, one entire litter of
rats was injected with capsaicin within 2 days of birth, and the male
rats were used 5 weeks later as described before (15). The
effectiveness of this procedure was confirmed by immunocytochemistry
(21), which showed that there were no SP-positive cells or nerve
processes in the skin of capsaicin-treated rats.
Immunohistochemistry
Frozen sections were cut at 7 µm by cryostat (Jung CM 3000,
Leica) and thaw-mounted. All specimens were treated with 0.3%
H2O2 in methanol for 30 min to block endogenous
peroxidase. After briefly rinsing in PBS, the sections were incubated
in 5% normal goat serum in PBS for 30 min, then exposed to rabbit
anti-SP polyclonal antibody in PBS containing 5% normal goat serum at
1:4000 dilution for 48 h at 4 C. The sections were incubated for
2 h at 4 C in rhodamine-conjugated goat antirabbit immunoglobulin
(Cappel Laboratories, Cochranville, PA), diluted 1:500 with 1% normal
goat serum and 0.02% Triton X-100 in 0.1 M PBS. Final
observation and photography were performed with Nikon Diaphot inverted
microscope (Don Santo).
RT-PCR amplification of CRH-receptor mRNA in HMC-1
cells
Human leukemic mast cells (HMC-1) were obtained from Dr.
Butterfield (Mayo Clinic, MN) and were grown as described previously
(22). To determine whether mast cells express CRH receptors, mRNA was
extracted from 1 x 106 HMC-1 cells or RBL cells using
Tri-Reagent (Molecular Resources; Cincinatti, OH). For RT-PCR analysis,
complementary DNA (cDNA) was synthesized using Superscript
Preamplification System (GIBCO-BRL, Gaithersburg, MD). Two successive
amplifications were conducted using overlapping, nested primers. Primer
selection was based on the published sequence of CRHR1
(23). In the first amplification, PCR was carried out for 30 cycles
using the 5' outer primer CCGAATTCGGGCATTCAGGACGGTAGCCGAGCGAGC and the
3" outer primer CCGGATCCCCATGACCTGCCAGCTCAGACTGCT-GTG. The
second amplification was performed for 20 cycles using 1 µl of the
first reaction product and the 5' inner primer
CCGAATTCAATGGGAGGGCACCCGCAGCTCCGTCTCGTC and the 3' inner primer
CCGGATCCCCATGACCTGCCAGCTCAGAC. An EcoR1, CCGAA-TTC and a
BamH1, CCGGATCC, restriction enzyme site was included on the 5" end
of the 5' and 3' primers, respectively. A product of identical size was
also simultaneously amplified by RT-PCR, using pituitary polyA RNA
(Clontech, Palo Alto, CA) under identical conditions.
Presentation of results
Results are presented as the mean ±
SD values of Evans blue extravasation under different
experimental conditions. The number of animals tested in
vivo or in vitro is denoted by (n). Evans blue
extravasation is evaluated by ANOVA and Student-Newman-Keuls tests,
whereas the mast cell degranulation results are compared using
nonparametric analysis with Mann Whitney U test.
Significance is denoted by P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
The CRH effect on mast cell degranulation was investigated
morphologically and was judged by granule content extrusion and/or more
than 50% loss of cellular staining (Fig. 3
). Degranulation was observed in 49
± 15% of the mast cells at skin sites treated with 10-4
M CRH (n = 5 rats, 902 mast cells counted), which was
statistically higher (P < 0.05) when compared with
20 ± 3% (n = 8 rats, 2840 mast cells counted) of the mast
cells from control sites (Table 1
). The inactive acid form of CRH had
no effect (Table 1
) on mast cell degranulation (14 ± 9%, n
= 3, 710 mast cells counted). Ultrastructural observations of mast
cells from CRH-injected sites had obvious signs of degranulation
evidenced by loss of the electron dense content of their secretory
granules (Fig. 4
).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The vasodilatory effect of CRH was blocked by the antiallergic drug cromolyn, which can inhibit mast cell secretion from connective tissue mast cells (25), providing indirect evidence that mast cells are necessary. The morphological evidence clearly indicated that CRH results in mast cell degranulation. The strongest evidence for the dependence of the vasodilatory effect of CRH on mast cells, however, came from the absence of this action in W/Wv mast cell deficient mice. Other studies using W/Wv mice concluded that SP-induced increase in vascular permeability and granulocyte infiltration was also mast cell dependent (26, 27). Somatostatin did not block the effect of CRH on fluid extravasation, but increased vascular permeability itself. This is not surprising because somatostatin had previously been shown to stimulate rat (28) and human (29) mast cell secretion.
The increase in vascular permeability induced by CRH appears to be receptor mediated because only the amidated form of CRH, which interacts with CRH receptors (30), was active. Moreover, the nonpeptide CRHR1 antagonist antalarmin reduced the effect of intradermal CRH, suggesting that CRH-induced skin mast cell activation and increased vascular permeability involved CRHR1 at least partially. Antalarmin, an analog of Pfizers CP-154,526 which was shown to block the effect of exogenously administered CRH on ACTH levels (31), also inhibited carrageenin-induced sc inflammation (32). The fact that antalarmin did not inhibit the CRH-induced response entirely is most likely due to its insolubility in aqueous media, which results in poor bioavailability. Alternatively, CRHR2 may also be involved. In this context, we recently showed that urocortin, which has 45% sequence identity with CRH and is more potent agonist of the CRHR2 (33), is more potent than CRH in increasing skin vascular permeability (34). In vivo, some direct action of CRH on blood vessels cannot be precluded because a CRHR2 subtype was recently identified on arterioles (35). Our finding that the peptide CRH antagonist [D-phe12, Nie21,38, Ala32]rCRH(12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41) acted as a partial agonist for mast cell degranulation was unexpected. However, similar effects have also been reported for SP antagonists (36) and LHRH antagonists (37).
The presence of mRNA for CRHR1 in HMC-1 cells supports the findings with antalarmin, suggesting that CRHR1 is also expressed in rat skin mast cells. We believe that the band seen with RT-PCR in HMC-1 cells does signify CRHR1 receptor expression in this cell line because it was reliably obtained, whereas no such band was seen (when simultaneously run using identical solutions) in cultured human synoviocytes obtained from patients undergoing joint replacement. Admittedly, it is hard to extrapolate from leukemic mast cells to normal rat skin mast cells and confirmation will have to await in situ hybridization of rat skin samples. Nevertheless, our results are supported by other evidence showing that human skin expresses genes for CRH receptors and for CRH (38).
At this time, the relative contribution of CRH in inflammatory processes, compared with other neuropeptides colocalized in postganglionic sympathetic and/or afferent sensory endings is not known. The lack of an inhibitory effect of capsaicin treatment on the effect of injected CRH indicates that, at least when given exogenously, the action of CRH does not depend on the presence of sensory afferent fiber terminals or SP release. The identification of CRH in primary sensory afferent fibers (10), however, suggests that antidromic release of CRH from unmyelinated C fibers innervating the skin may participate in vivo. For instance, skin mast cells degranulated in response to electrical stimulation (ES) of sensory nerves (39), whereas dura mast cells degranulated after ES of the trigeminal (15) or cervical (40) ganglion. CRH is also present in neurons of sympathetic chain ganglia (41) from the terminals of which it may be also secreted during stress. In general, mast cell-neuron interactions appear to be important in hypersensitivity reactions (16) and in neuroinflammatory syndromes (42).
CRH binding sites have been found on human peripheral blood leukocytes (for review see Ref.8) and inflamed synovia from arthritic rats (7). Consequently, CRH may either initiate or potentiate the inflammatory process mediated by mast cells via the release of cytokines. This possibility is not excluded by our present results since CRH stimulates secretion of IL-1 from monocytes (43), whereas IL-1 (44) and stem cell factor (45) have been reported to induce mast cell secretion. However, inflammatory cells are unlikely to be present under normal conditions in the skin.
The fact that the histamine-1 receptor antagonist diphenhydramine could not block the CRH effect entirely indicates that vasodilatory molecules other than histamine may be involved. For instance, vasodilation in rodents is equally dependent on histamine and serotonin (46), whereas cytokines present in mast cells (17) may also be involved. For instance, tumor necrosis factor (TNF) secreted from skin mast cells in response to morphine sulfate was shown to result in skin vasodilation and expression of endothelial adhesion molecule-1 (47). Another vasoactive candidate is NO, which can also be released from mast cells (48). Surprisingly, inhibition of the inducible pathway of NO synthesis, using L-NAME (49), augmented the effect of CRH. A similar increase in vasodilation following inhibition of NO synthesis by L-NAME (documented as increased intestinal permeability and secretion) was attributed to release of histamine from mast cells and not to a direct effect of NO (49). In fact, the inducible isozyme of NO synthase is known to be up-regulated in mast cells and macrophages in intestinal inflammation (50). The relation between CRH and NO, however, is far from clear at the moment. For instance, feto-placental vessels are dilated in response to CRH via a NO-mediated mechanism (51), whereas NO inhibits placental CRH secretion (52). In the hypothalamus, NO has been reported to both stimulate (53) and inhibit (54) CRH secretion.
Our hypothesis is that, during stress in vivo, CRH is released from postganglionic sympathetic nerves and/or peripheral sensory afferents and acts on local mast cells to induce vascular permeability. The inflammatory mediators released could recruit and activate immune cells, as well as act on nerve endings to release more peptides, thus further stimulating mast cells. Preliminary results indicate that rat skin mast cells degranulate during 30 min of acute stress by immobilization (55). This same process was previously shown to induce degranulation of dura mast cells through CRH release (14). In keeping with this hypothesis, a random poll of systemic mastocytosis patients indicated that cutaneous flushing was exacerbated by emotional or physical stress in 40/45 patients (Theoharides, unpublished information). Novel nonpeptide CRH-receptor antagonists, or other molecules that could interfere with CRH-induced skin mast cell activation, might be useful in the management of skin disorders, which are triggered or exacerbated by stress, such as atopic dermatitis, eczema, psoriasis or urticaria.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received April 9, 1997.
| References |
|---|
|
|
|---|
and CRF2ß receptor mRNAs are
differentially distributed between the rat central nervous system and
peripheral tissues. Endocrinology 136:41394142[Abstract]
, which induces endothelial leukocyte adhesion molecule 1.
Proc Natl Acad Sci USA 88:42204224This article has been cited by other articles:
![]() |
D. Papaliodis, W. Boucher, D. Kempuraj, M. Michaelian, A. Wolfberg, M. House, and T. C. Theoharides Niacin-induced "Flush" Involves Release of Prostaglandin D2 from Mast Cells and Serotonin from Platelets: Evidence from Human Cells in Vitro and an Animal Model J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 665 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Weik, A. Herforth, V. Kolb-Bachofen, and R. Deinzer Acute Stress Induces Proinflammatory Signaling at Chronic Inflammation Sites Psychosom Med, October 1, 2008; 70(8): 906 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ferrier Significance of increased human colonic permeability in response to corticotrophin-releasing hormone (CRH) Gut, January 1, 2008; 57(1): 7 - 9. [Full Text] [PDF] |
||||
![]() |
J. A. Ralph, D. Zocco, B. Bresnihan, O. FitzGerald, A. N. McEvoy, and E. P. Murphy A Role for Type 1{alpha} Corticotropin-Releasing Hormone Receptors in Mediating Local Changes in Chronically Inflamed Tissue Am. J. Pathol., March 1, 2007; 170(3): 1121 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-H. Choi, M. Demerjian, D. Crumrine, B. E. Brown, T. Mauro, P. M. Elias, and K. R. Feingold Glucocorticoid blockade reverses psychological stress-induced abnormalities in epidermal structure and function Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1657 - R1662. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mastorakos, E. I Karoutsou, and M. Mizamtsidi Corticotropin releasing hormone and the immune/inflammatory response Eur. J. Endocrinol., November 1, 2006; 155(suppl_1): S77 - S84. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Zoumakis, D K Grammatopoulos, and G P Chrousos Corticotropin-releasing hormone receptor antagonists Eur. J. Endocrinol., November 1, 2006; 155(suppl_1): S85 - S91. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff Neuronal control of skin function: the skin as a neuroimmunoendocrine organ. Physiol Rev, October 1, 2006; 86(4): 1309 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. LaBerge, S. E. Malley, K. Zvarova, and M. A. Vizzard Expression of corticotropin-releasing factor and CRF receptors in micturition pathways after cyclophosphamide-induced cystitis Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2006; 291(3): R692 - R703. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Donelan, W. Boucher, N. Papadopoulou, M. Lytinas, D. Papaliodis, P. Dobner, and T. C. Theoharides Corticotropin-releasing hormone induces skin vascular permeability through a neurotensin-dependent process PNAS, May 16, 2006; 103(20): 7759 - 7764. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, Y. Xu, H. Zhou, J. Tao, and S. Li Expression of urocortin in rat lung and its effect on pulmonary vascular permeability. J. Endocrinol., April 1, 2006; 189(1): 167 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cao, C. L. Cetrulo, and T. C. Theoharides Corticotropin-Releasing Hormone Induces Vascular Endothelial Growth Factor Release from Human Mast Cells via the cAMP/Protein Kinase A/p38 Mitogen-Activated Protein Kinase Pathway Mol. Pharmacol., March 1, 2006; 69(3): 998 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Mazon, B. M. L. Verburg-van Kemenade, G. Flik, and M. O. Huising Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding protein (CRH-BP) are expressed in the gills and skin of common carp Cyprinus carpio L. and respond to acute stress and infection J. Exp. Biol., February 1, 2006; 209(3): 510 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tsatsanis, A. Androulidaki, T. Alissafi, I. Charalampopoulos, E. Dermitzaki, T. Roger, A. Gravanis, and A. N. Margioris Corticotropin-Releasing Factor and the Urocortins Induce the Expression of TLR4 in Macrophages via Activation of the Transcription Factors PU.1 and AP-1 J. Immunol., February 1, 2006; 176(3): 1869 - 1877. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G Papadopoulou, L. Oleson, D. Kempuraj, J. Donelan, C. L Cetrulo, and T. C Theoharides Regulation of corticotropin-releasing hormone receptor-2 expression in human cord blood-derived cultured mast cells J. Mol. Endocrinol., December 1, 2005; 35(3): R1 - R8. [Abstract] [Full Text] [PDF] |
||||
![]() |
V L Clifton, R Crompton, M A Read, P G Gibson, R Smith, and I M R Wright Microvascular effects of corticotropin-releasing hormone in human skin vary in relation to estrogen concentration during the menstrual cycle J. Endocrinol., July 1, 2005; 186(1): 69 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cao, N. Papadopoulou, D. Kempuraj, W. S. Boucher, K. Sugimoto, C. L. Cetrulo, and T. C. Theoharides Human Mast Cells Express Corticotropin-Releasing Hormone (CRH) Receptors and CRH Leads to Selective Secretion of Vascular Endothelial Growth Factor J. Immunol., June 15, 2005; 174(12): 7665 - 7675. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Benou, Y. Wang, J. Imitola, L. VanVlerken, C. Chandras, K. P. Karalis, and S. J. Khoury Corticotropin-Releasing Hormone Contributes to the Peripheral Inflammatory Response in Experimental Autoimmune Encephalomyelitis J. Immunol., May 1, 2005; 174(9): 5407 - 5413. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Matsumoto, Y. Inoue, K. Tsuchiya, T. Shimada, and T. Aikawa Degranulation of mast cells located in median eminence in response to compound 48/80 evokes adrenocortical secretion via histamine and CRF in dogs Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2004; 287(4): R969 - R980. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Tantisira, S. Lake, E. S. Silverman, L. J. Palmer, R. Lazarus, E. K. Silverman, S. B. Liggett, E. W. Gelfand, L. J. Rosenwasser, B. Richter, et al. Corticosteroid pharmacogenetics: association of sequence variants in CRHR1 with improved lung function in asthmatics treated with inhaled corticosteroids Hum. Mol. Genet., July 1, 2004; 13(13): 1353 - 1359. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Anton, J. Gay, A. Mykoniatis, A. Pan, M. O'Brien, D. Brown, K. Karalis, and C. Pothoulakis Corticotropin-releasing hormone (CRH) requirement in Clostridium difficile toxin A-mediated intestinal inflammation PNAS, June 1, 2004; 101(22): 8503 - 8508. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chen, A. Blount, J. Vaughan, B. Brar, and W. Vale Urocortin II Gene Is Highly Expressed in Mouse Skin and Skeletal Muscle Tissues: Localization, Basal Expression in Corticotropin-Releasing Factor Receptor (CRFR) 1- and CRFR2-Null Mice, and Regulation by Glucocorticoids Endocrinology, May 1, 2004; 145(5): 2445 - 2457. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Ginsburg and A. L. Baldwin Disodium cromoglycate stabilizes mast cell degranulation while reducing the number of hemoglobin-induced microvascular leaks in rat mesentery Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1750 - H1756. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kempuraj, N. G. Papadopoulou, M. Lytinas, M. Huang, K. Kandere-Grzybowska, B. Madhappan, W. Boucher, S. Christodoulou, A. Athanassiou, and T. C. Theoharides Corticotropin-Releasing Hormone and Its Structurally Related Urocortin Are Synthesized and Secreted by Human Mast Cells Endocrinology, January 1, 2004; 145(1): 43 - 48. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Crompton, V. L. Clifton, A. T. Bisits, M. A. Read, R. Smith, and I. M. R. Wright Corticotropin-Releasing Hormone Causes Vasodilation in Human Skin via Mast Cell-Dependent Pathways J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5427 - 5432. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Stander, M. Steinhoff, M. Schmelz, E. Weisshaar, D. Metze, and T. Luger Neurophysiology of Pruritus: Cutaneous Elicitation of Itch Arch Dermatol, November 1, 2003; 139(11): 1463 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Steinhoff, S. Stander, S. Seeliger, J. C. Ansel, M. Schmelz, and T. Luger Modern Aspects of Cutaneous Neurogenic Inflammation Arch Dermatol, November 1, 2003; 139(11): 1479 - 1488. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huang, X. Pang, K. Karalis, and T. C. Theoharides Stress-induced interleukin-6 release in mice is mast cell-dependent and more pronounced in Apolipoprotein E knockout mice Cardiovasc Res, July 1, 2003; 59(1): 241 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Madhappan, D. Kempuraj, S. Christodoulou, S. Tsapikidis, W. Boucher, V. Karagiannis, A. Athanassiou, and T. C. Theoharides High Levels of Intrauterine Corticotropin-Releasing Hormone, Urocortin, Tryptase, and Interleukin-8 in Spontaneous Abortions Endocrinology, June 1, 2003; 144(6): 2285 - 2290. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Botchkarev Stress and the Hair Follicle: Exploring the Connections Am. J. Pathol., March 1, 2003; 162(3): 709 - 712. [Full Text] [PDF] |
||||
![]() |
P. C. Arck, B. Handjiski, E. M. J. Peters, A. S. Peter, E. Hagen, A. Fischer, B. F. Klapp, and R. Paus Stress Inhibits Hair Growth in Mice by Induction of Premature Catagen Development and Deleterious Perifollicular Inflammatory Events via Neuropeptide Substance P-Dependent Pathways Am. J. Pathol., March 1, 2003; 162(3): 803 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Esposito, N. Chandler, K. Kandere, S. Basu, S. Jacobson, R. Connolly, D. Tutor, and T. C. Theoharides Corticotropin-Releasing Hormone and Brain Mast Cells Regulate Blood-Brain-Barrier Permeability Induced by Acute Stress J. Pharmacol. Exp. Ther., December 1, 2002; 303(3): 1061 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Agelaki, C. Tsatsanis, A. Gravanis, and A. N. Margioris Corticotropin-Releasing Hormone Augments Proinflammatory Cytokine Production from Macrophages In Vitro and in Lipopolysaccharide-Induced Endotoxin Shock in Mice Infect. Immun., November 1, 2002; 70(11): 6068 - 6074. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhao and K. P. Karalis Regulation of Nuclear Factor-{kappa}B by Corticotropin-Releasing Hormone in Mouse Thymocytes Mol. Endocrinol., November 1, 2002; 16(11): 2561 - 2570. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Buske-Kirschbaum, A. Geiben, H. Hollig, E. Morschhauser, and D. Hellhammer Altered Responsiveness of the Hypothalamus-Pituitary-Adrenal Axis and the Sympathetic Adrenomedullary System to Stress in Patients with Atopic Dermatitis J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4245 - 4251. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Saban, N.-B. Nguyen, T. G. Hammond, and R. Saban Gene Expression Profiling of Mouse Bladder Inflammatory Responses to LPS, Substance P, and Antigen-Stimulation Am. J. Pathol., June 1, 2002; 160(6): 2095 - 2110. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kohno, Y. Kawahito, Y. Tsubouchi, A. Hashiramoto, R. Yamada, K.-i. Inoue, Y. Kusaka, T. Kubo, I. J. Elenkov, G. P. Chrousos, et al. Urocortin Expression in Synovium of Patients with Rheumatoid Arthritis and Osteoarthritis: Relation to Inflammatory Activity J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4344 - 4352. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. SLOMINSKI, J. WORTSMAN, A. PISARCHIK, B. ZBYTEK, E. A. LINTON, J. E. MAZURKIEWICZ, and E. T. WEI Cutaneous expression of corticotropin-releasing hormone (CRH), urocortin, and CRH receptors FASEB J, August 1, 2001; 15(10): 1678 - 1693. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Smith, L. de Jonge, M. Pellymounter, T. Nguyen, R. Harris, D. York, S. Redmann, J. Rood, and G. A. Bray Peripheral Administration of Human Corticotropin-Releasing Hormone: A Novel Method to Increase Energy Expenditure and Fat Oxidation in Man J. Clin. Endocrinol. Metab., May 1, 2001; 86(5): 1991 - 1998. [Abstract] [Full Text] |
||||
![]() |
F. A. Tausk and H. Nousari Stress and the Skin Arch Dermatol, January 1, 2001; 137(1): 78 - 82. [Full Text] [PDF] |
||||
![]() |
I. J. Elenkov, R. L. Wilder, G. P. Chrousos, and E. S. Vizi The Sympathetic Nerve---An Integrative Interface between Two Supersystems: The Brain and the Immune System Pharmacol. Rev., December 1, 2000; 52(4): 595 - 638. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Slominski and J. Wortsman Neuroendocrinology of the Skin Endocr. Rev., October 1, 2000; 21(5): 457 - 487. [Abstract] [Full Text] |
||||
![]() |
A. Slominski, A. Szczesniewski, and J. Wortsman Liquid Chromatography-Mass Spectrometry Detection of Corticotropin-Releasing Hormone and Proopiomelanocortin-Derived Peptides in Human Skin J. Clin. Endocrinol. Metab., October 1, 2000; 85(10): 3582 - 3588. [Abstract] [Full Text] |
||||
![]() |
A. Slominski, J. Wortsman, T. Luger, R. Paus, and S. Solomon Corticotropin Releasing Hormone and Proopiomelanocortin Involvement in the Cutaneous Response to Stress Physiol Rev, July 1, 2000; 80(3): 979 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Habib, K. P. Weld, K. C. Rice, J. Pushkas, M. Champoux, S. Listwak, E. L. Webster, A. J. Atkinson, J. Schulkin, C. Contoreggi, et al. Oral administration of a corticotropin-releasing hormone receptor antagonist significantly attenuates behavioral, neuroendocrine, and autonomic responses to stress in primates PNAS, May 23, 2000; 97(11): 6079 - 6084. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Slominski, B. Roloff, J. Curry, M. Dahiya, A. Szczesniewski, and J. Wortsman The Skin Produces Urocortin J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 815 - 823. [Abstract] [Full Text] |
||||
![]() |
R. J. Woods, C. F. Kemp, J. David, I. G. Sumner, and P. J. Lowry Cleavage of Recombinant Human Corticotropin-Releasing Factor (CRF)-Binding Protein Produces a 27-Kilodalton Fragment Capable of Binding CRF J. Clin. Endocrinol. Metab., August 1, 1999; 84(8): 2788 - 2794. [Abstract] [Full Text] |
||||
![]() |
J. Santos, P. R. Saunders, N. P. M. Hanssen, P.-C. Yang, D. Yates, J. A. Groot, and M. H. Perdue Corticotropin-releasing hormone mimics stress-induced colonic epithelial pathophysiology in the rat Am J Physiol Gastrointest Liver Physiol, August 1, 1999; 277(2): G391 - G399. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Karalis, E. Kontopoulos, L. J. Muglia, and J. A. Majzoub Corticotropin-releasing hormone deficiency unmasks the proinflammatory effect of epinephrine PNAS, June 8, 1999; 96(12): 7093 - 7097. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Singh, W. Boucher, X. Pang, R. Letourneau, D. Seretakis, M. Green, and T. C. Theoharides Potent Mast Cell Degranulation and Vascular Permeability Triggered by Urocortin Through Activation of Corticotropin-Releasing Hormone Receptors J. Pharmacol. Exp. Ther., March 1, 1999; 288(3): 1349 - 1356. [Abstract] [Full Text] |
||||
![]() |
R. J Wright, M. Rodriguez, and S. Cohen Review of psychosocial stress and asthma: an integrated biopsychosocial approach Thorax, December 1, 1998; 53(12): 1066 - 1074. [Full Text] |
||||
![]() |
X. Pang, N. Alexacos, R. Letourneau, D. Seretakis, W. Gao, W. Boucher, D. E. Cochrane, and T. C. Theoharides A Neurotensin Receptor Antagonist Inhibits Acute Immobilization Stress-Induced Cardiac Mast Cell Degranulation, a Corticotropin-Releasing Hormone-Dependent Process J. Pharmacol. Exp. Ther., October 1, 1998; 287(1): 307 - 314. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |