Endocrinology Vol. 139, No. 10 4182-4188
Copyright © 1998 by The Endocrine Society
A Protease-Resistant Form of Insulin-Like Growth Factor (IGF) Binding Protein 4 Inhibits IGF-1 Actions1
C. Rees,
D. R. Clemmons,
G. D. Horvitz,
J. B. Clarke and
W. H. Busby
Department of Medicine, University of North Carolina School of
Medicine, Chapel Hill, North Carolina 27599
Address all correspondence and requests for reprints to: David R. Clemmons, M.D., Division of Endocrinology, CB no. 7170, 6111 Thurston-Bowles Building, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599-7170.
 |
Abstract
|
|---|
Smooth muscle cells (SMC) secrete a serine protease that cleaves
insulin-like growth factor (IGF) binding protein (IGFBP)-4 into
fragments that have low affinity for IGF-1. When IGFBP-4 is added to
monolayer cultures of cell types that do not secrete this protease,
IGF-1 stimulation of DNA synthesis is significantly inhibited. In
contrast, if cell types that secrete this protease are used, IGFBP-4 is
a much less potent inhibitor. These studies were conducted to determine
whether proteolysis of IGFBP-4 accounted for its reduced capacity to
inhibit IGF-1-stimulated DNA synthesis. The cleavage site in IGFBP-4
that the SMC protease uses was determined to be lysine120,
histidine121. A protease-resistant mutant form of IGFBP-4
was prepared, expressed, purified, and tested for biologic activity
using porcine SMC cultures. Addition of the protease-resistant mutant
resulted in inhibition of DNA and cell migration responses to IGF-1.
The inhibition was concentration dependent and was maximal when 500
ng/ml (20 nM) of the mutant was added with 20 ng/ml (2.8
nM) of IGF-1. When the mutant was added in the absence of
IGF-1, it had no activity. The results show that cleavage of IGFBP-4 at
lysine120, histidine121 results in inactivation
of the ability of IGFBP-4 to bind to IGF-1. Creation of a mutant form
of IGFBP-4 that was not cleaved by the protease resulted in inhibition
of IGF-1-stimulated actions. The results suggest that IGFBP-4 can act
as a potent inhibitor of the anabolic effects of IGF-1 and that the
variables that regulate protease activity may indirectly regulate IGF-1
actions.
 |
Introduction
|
|---|
INSULIN-LIKE growth factor 1 (IGF-1) is
produced by smooth muscle cells (SMC), which are the predominant cell
type in normal vessel walls and in atherosclerotic lesions (1, 2). SMC
also synthesize and secrete insulin-like growth factor binding protein
(IGFBP)-2, -4, and -5 (3, 4, 5). In addition to synthesis and secretion of
these forms of IGFBPs, SMC also release three distinct proteases that
degrade each form of IGFBP specifically (6, 7, 8). We and others have
determined previously that rat neuronal cells (B104 cells) (9) and
human fibroblasts (10) cleave IGFBP-4 at lysine120,
histidine121 (B104 cell protease) or
methionine135, lysine136 (fibroblast protease).
The activity of the IGFBP-4 protease that is secreted by porcine SMC is
inhibited by a variety of serine protease inhibitors (7), and its
molecular mass has been estimated to be 48 kDa (7). The cleavage site
that it uses has not been identified. We have previously reported that
the addition of increasing concentrations of IGFBP-4 to SMC cultures
that are actively producing the protease results in minimal inhibition
of cellular responsiveness to IGF-1 (11). The addition of
concentrations of IGFBP-4 between 50 and 200 ng/ml resulted in no
inhibition of DNA synthesis in cultures that had been exposed to 20
ng/ml IGF-1. A concentration of 500 ng/ml was required to detect any
inhibition, and its effect was minimal (e.g. 28%). When the
culture supernatants at the end of the experiment were analyzed, almost
all of the IGFBP-4 had been degraded in the cultures that had been
exposed to IGFBP-4 concentrations between 50200 ng/ml. Only those
that had received 500 ng/ml had detectable intact peptide. Because the
addition of similar concentrations of IGFBP-4 to fibroblast cultures
that did not secrete the protease resulted in more than 95% inhibition
of IGF-1-stimulated DNA synthesis, this suggested that the amount of
intact IGFBP-4 that was present in the medium was a major determinant
of whether IGF-1-stimulated DNA synthesis could be inhibited. The
purpose of these studies was to determine the cleavage site in IGFBP-4
that is used by the SMC protease, to mutagenize that site, and to use
the protease-resistant form of IGFBP-4 to determine its capacity to
inhibit IGF-1-stimulated actions.
 |
Materials and Methods
|
|---|
Cell culture
Porcine aortic SMC (pSMC) were isolated by a previously
described method (12). The cells were grown from explants obtained from
3-week-old pigs. The cells that were isolated had abundant SMC actin,
grew in hills and valleys, and had other properties of SMC, as
previously described (12). The cultures were maintained in
DMEM-H (Life Technologies, Gaithersburg, MD), supplemented with
10% FBS (Sigma Chemical Co., St. Louis, MO), 10 mM
glutamine, penicillin (100 U/ml), and streptomycin (100 µg/ml; Life
Technologies). The cultures were passaged every week; and after
reaching confluence, they were trypsinized and replated at 4000
cells/cm2 in 10-cm dishes (Falcon 3003; Falcon Labware
Division of Beckton Dickenson, Rutherford, NJ).
Assessment of proteolysis
To determine the degree of IGFBP-4 proteolysis, approximately
2.0 µg/ml IGFBP-4 was added to 0.05 ml of 0.5 M Tris (pH
7.4) containing 4 mM CaCl2, and the mixture was
incubated with varying amounts of pSMC-conditioned medium (2540 µl)
that contained the IGFBP-4 protease, for 36 h at 37 C. IGF-1 (1.0
µg/ml) was also added to the incubation buffer. After this
incubation, 50 µl was removed, and the reaction products were
separated by SDS-PAGE, as previously described (13). The proteins were
transferred to immobilon-P membranes (Millipore, Inc., Bedford, MA) and
were immunoblotted using a 1:1000 dilution of antihuman IGFBP-4 rabbit
serum (7). Immune complexes were visualized with the Proto-Blot system
(Promega, Madison, WI) using the manufacturers recommended protocol.
An alkaline phosphatase-conjugated second-antibody detection system was
used to detect immunoreactive IGFBP-4 and its fragments.
Identification of the proteolytic cleavage site
To determine the proteolytic cleavage site, 200 cc
pSMC-conditioned medium was collected by incubating 20 confluent 10-cm
cultures with 10 ml serum-free medium for 24 h. This medium was
chromatographed over heparin sepharose (Pharmacia Biotech, Piscataway,
NJ), as previously described. The IGFBP-4 protease was eluted with 0.6
M NaCl (7). The pool of active fractions was concentrated
8-fold on a Biomax filter (Millipore, Inc.). The concentrated
material (5 µl) was incubated with 10 µg human IGFBP-4 for 24
h at 37 C. The human IGFBP-4 had been purified to homogeneity, as
described previously (9). The products of the reaction were separated
by high-pressure electrophoresis using an Applied Biosystems (Palo
Alto, CA) model 230A high-pressure tube gel separatory apparatus. This
material was separated using a gel (10%) in 75 mM
Tris-phosphate (pH 7.5), 0.1% SDS for 14 h at 120 mV. The eluted
fractions were analyzed to determine exact fragment size and
homogeneity by SDS-PAGE with immunoblotting for IGFBP-4. The method was
found to reproducibly separate fragments with as little as a 2.0-kDa
difference. The N-terminal sequence of each fragment was determined by
Edman degradation, as described previously (14).
In vitro mutagenesis
To determine whether the cleavage site that was identified was
correct, in vitro mutagenesis was used. The IGFBP-4
complementary DNA that had been cloned to the pRc RSV vector
(Invitrogen, Carlsbad, CA) was used as a template for mutagenesis (15, 16), and an oligonucleotide with the following sequence: 5' c c t g c a
g a a a1 a1 a c t t c g c c a 3', which contained two base
substitutions that would change lysine120 and
histidine121 to asparginines was used. The method has been
previously published (16, 17). Briefly, 2 ng plasmid DNA was used to
transform Escherichia coli (strain no. CJ-236), which was
then superinfected with a helper phage R408. The secreted phagemid
particles were precipitated with 8% polyethylene glycol, and the
single-stranded DNA was then isolated by adherence to Glass Milk (Bio
101, Vista, CA). Complementary oligonucleotides containing bp
mismatches were then phosphorylated with T4 polynucleotide
kinase (New England Biolabs, Beverly, MA) and annealed to the IGFBP-4
template using a 30:1 molar ratio. Second-strand synthesis was
initiated by adding 2.5 U T4 DNA polymerase and 2 U DNA
ligase (Boerhinger Mannheim, Indianapolis, IN). Ten microliters of
synthesis mixture was used to transform 100 µl of competent
Escherichia coli (strain no. DH5
F), and
ampicillin-resistant colonies were obtained. Six colonies were
amplified and sequenced. Sequencing verified that the correct mutations
were present. The plasmid, containing the altered IGFBP-4 sequence in
the correct orientation, was directly transfected into Chinese hamster
ovary (CHO) K-1 cells (Lineberger Cancer Research Center, Chapel Hill,
NC) using the poly(L)ornithine (Sigma) method (18). The cells
were grown to confluence in medium containing 400 µg/ml G-418
(Life Technologies), and the concentration of IGFBP-4 in the medium was
determined by immunoblotting. The cultures secreting the highest
concentration of mutant protein were then amplified.
Preparation of mutants containing the FLAG epitope and
determination of binding affinities for IGF-1
A second mutant IGFBP-4 construct was prepared using a
synthetic oligonucleotide that encodes the FLAG epitope. This 8-amino
acid extension (DYKDDDDK) was used to make possible the efficient
separation of the expressed human IGFBP-4 from Chinese hamster IGFBP-4
that is constitutively secreted by CHO cells. The oligonucleotide
contained the sequence
(ggcccggctcggatccactgatgttctgctgctgctgttctgcttcggtagg) that encoded the
last 6 amino acids of the human IGFBP-4 propeptide, the 8 amino acids
of the FLAG epitope, and the first 5 amino acids of the human IGFBP-4
peptide. Single-stranded mutagenesis was used exactly as described for
preparation of the IGFBP-4 mutant. Both the pRc plasmids containing the
full protein coding region of IGFBP-4, with substitutions for
lysine120, histidine121, and the full-length
wild-type IGFBP-4 sequences were used as templates. The insertion of
the FLAG epitope was confirmed by DNA sequencing (19). These plasmids
were used to transfect CHO cells, as described previously (9). After
selection and amplification in G-418-containing medium, the cultures
secreting the highest concentrations of either form of FLAG IGFBP-4
were identified by immunoblotting using specific anti-FLAG antiserum
(Eastman Kodak, Rochester, NY). Two liters of conditioned medium from
each of the four transfected cell lines was obtained, and the IGFBP-4
in each sample was purified by a 3-step purification described
previously (15). To separate Chinese hamster IGFBP-4 that is produced
by the CHO cells from human IGFBP-4, a specific immunoaffinity column
was used. The FLAG epitope-containing proteins that had been purified
as described previously were applied to the column containing 2.0 ml
anti-FLAG M2 affinity gel (Eastman Kodak) that had been
equilibrated with a buffer containing 0.05 M Tris, 150
mM NaCl, 2 mM CaCL2, pH 7.40. The
sample was eluted with 0.1 M glycine HCL, pH 3.0, using a
flow rate of 0.5 ml/min. Homogeneity of the eluted IGFBP-4 was
determined by SDS-PAGE with silver staining and by amino acid
sequencing. The amount of protein was estimated by comparing the HPLC
peak area in the final purification step to known concentrations of
IGFBP-4 that had been determined by amino acid composition
analysis.
To verify that the mutants did not have alterations in their affinities
for IGF-1, increasing concentrations of IGF-1 (140 ng/ml), 5 ng/ml of
each form of IGFBP-4, and 20,000 cpm 125I-IGF-1 were added
to 0.5 cc of 0.025 M Tris, pH 7.0, 0.25% polyethylene
glycol. After 14 h at 4 C, the IGFBP-4 was precipitated by adding
15% polyethylene glycol. The pellets were washed once and then
counted (13). The affinity of each form of IGFBP-4 for IGF-1 was
calculated using Scatchard analysis and was compared with wild-type
IGFBP-4. No alteration in affinity was detected. The affinity constants
were as follows: native IGFBP-4 (1.6 x 10-9
M-1) K120N, H121N; IGFBP-4 (1.2 x
10-9 M-1); FLAG IGFBP-4 (1.9
x 10-9 M-1); and FLAG K120N,
H121N, IGFBP-4 (2.1 x 10-9
M-1).
To determine whether the mutants were resistant to proteolysis, 2.0
µg/ml of the FLAG containing wild-type IGFBP-4, or both the FLAG or
non-FLAG containing K120N, H121N mutants were incubated with 20 µl of
the partially purified IGFBP-4 protease and 1.0 µg/ml IGF-1 for
16 h at 37 C, as previously described (7, 20). The products were
analyzed by immunoblotting.
Assessment of 3H-thymidine incorporation
To determine whether failure to cleave IGFBP-4 would alter the
cellular replication response to IGF-1, quiescent pSMC cultures were
plated in 96-well plates at a density of 5000 cells/well. After 5 days,
they were exposed to 0.2 cc DME containing 0.2% human platelet poor
plasma, 0.5 µCi 3H-thymidine (16 Ci/mM; ICN
Biochemicals, Costa Mesa, CA), increasing concentrations of
IGF-1 (250 ng/ml), and a constant amount of IGFBP-4 (500 ng/ml).
Additional cultures were exposed to 20 ng/ml IGF-1 and increasing
concentrations of wild-type or K120N, H121N IGFBP-4 (50500 ng/ml).
After 36 h, the amount of 3H-thymidine that was
incorporated into DNA was determined (21).
Measurement of cell migration
To analyze the effects of the IGFBP-4 mutants on
IGF-1-stimulated pSMC migration, confluent monolayers were prepared
using 6-well (35-mm) plates (Falcon 3036). The monolayers were wounded
with a single-edge razor blade, as described by Jones et al.
(22). The plate was rinsed once and incubated in DME containing 0.2%
FBS with IGF-1 (100 ng/ml) and IGFBP-4 (500 ng2.5 µg/ml) for
48 h at 37 C. The cells were fixed and stained with methylene
blue, then the mutant number of cells that migrated across the wound
edge was determined as described previously (22). Each data point
represents the mean of 79, 1-mm regions that were selected
immediately after wounding.
 |
Results
|
|---|
Susceptibility of IGFBP-4 and the protease-resistant mutants to
cleavage
After incubation of nonmutated IGFBP-4 with the partially purified
IGFBP-4 protease in vitro, it was cleaved to fragments of 18
and 14 kDa (Fig. 1A
, lanes 1 and 2). The
primary cleavage site used by the pSMC protease was determined by
sequence analysis to be lysine120,
histidine121. This site was mutated by converting the
charged residues to asparginines; and the K120N, H121N IGFBP-1 was
purified. When K120N, H121N IGFBP-4 was incubated with the protease,
there was less cleavage, but a fragment was easily detected (Fig. 1A
, lanes 3 and 4). To determine whether that fragment was derived from
nonmutated Chinese hamster ovary (CHO) IGFBP-4, nonmutated, human
IGFBP-4 containing the FLAG epitope was expressed. Two bands were noted
in the purified starting material; and based on the fragment sizes that
were detected, both bands seemed to be cleaved (Fig. 1A
, lanes 5 and
6). Insertion of the FLAG epitope resulted in no change in the ability
of IGFBP-4 to be cleaved by the protease. To determine whether one of
the two bands was CHO-secreted IGFBP-4 and whether one was human
IGFBP-4 that contained the FLAG epitope, this material was further
purified by immunoaffinity chromatography using the specific anti-FLAG
column, as described in Materials and Methods. Analysis of
the purified, FLAG-containing wild-type IGFBP-4 showed that the
lower molecular mass form of intact IGFBP-4 was not present and that
the upper band that remained after purification was cleaved (Fig. 1A
, lanes 7 and 8). To confirm that the lower band represented CHO-derived
IGFBP-4, the FLAG containing K120N, H121N IGFBP-4 that had not been
affinity purified was analyzed. As shown in lanes 9 and 10, the upper
band intensity was unchanged, whereas the lower band was decreased. To
further confirm that the K1210N, H121N FLAG IGFBP-4 was stable, the
immunopurified mutant was analyzed. No cleavage was detected after
14 h (lanes 11 and 12). To confirm that the higher molecular mass
form of IGFBP-4 contained the FLAG epitope, both the purified and
nonpurified forms were analyzed by immunoblotting using anti-FLAG
antiserum (Fig. 1B
). Only the higher molecular band was detected with
the FLAG antiserum. Importantly, the wild-type IGFBP-4 containing the
FLAG epitope was degraded by the IGFBP-4 protease, indicating that
insertion of the FLAG sequence had no effect on its susceptibility to
degradation. The results show definitively that K120N, H121N IGFBP-4
and FLAG K120, H121N IGFBP-4 are resistant to cleavage.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 1. Cleavage of various forms of IGFBP-4 by the
IGFBP-4 protease. A, The partially purified IGFBP-4 protease (20 µl)
was incubated with 1.0 µg/ml IGF-1 and 1.0 µg/ml wild-type IGFBP-4
(lane 2), K120N, H121N nonpurified IGFBP-4 (lane 4), FLAG-containing
wild-type IGFBP-4 (not immunopurified) (lane 6), FLAG wild-type IGFBP-4
(immunopurified) (lane 8), FLAG K120N, H121N IGFBP-4 (not
immunopurified) (lane 10), and FLAG K120N, H121N IGFBP-4
(immunopurified) (lane 12). The incubation was continued at 37 C for
14 h, and the products were analyzed by immunoblotting for
IGFBP-4. Control tubes that contained the corresponding protein, but no
protease, were incubated using the same conditions and are shown in
lanes 1, 3, 5, 7, 9, and 11. This experiment was repeated three times
with similar results. B, Immunoblot of cleavage products using
anti-FLAG antiserum. The FLAG containing nonpurified wild-type (lanes
12) and purified wild-type (lanes 34) IGFBP-4 or the
FLAG-containing K120N, H121N nonpurified (lanes 56) or purified
(lanes 78) mutant were incubated with the protease (lanes 2, 4, 6,
and 8); then, the products of the reaction were analyzed by
immunoblotting using the anti-FLAG antiserum. This experiment was
repeated two times with similar results.
|
|
Time course of IGFBP-4 degradation and loss of the ability of
fragments to bind IGF-1
To further confirm that this form of the FLAG IGFBP-4 mutant was
very resistant to cleavage, FLAG and non-FLAG-containing wild-type and
K120N, H121N IGFBP-4 were incubated with the protease; and the products
of the reaction were analyzed at time points between 4 and 36 h.
Both FLAG-containing and non-FLAG-containing IGFBP-4 had detectable
fragments after 4 h; and after 14 h, the majority of each
peptide was cleaved. In contrast, the purified FLAG K120N H121N IGFBP-4
was completely resistant to proteolysis over this time interval (Fig. 2
). To determine the capacity of the
proteolytically generated fragments to bind IGF-1, ligand blotting was
performed. As shown in Fig. 3
, after
cleavage of the FLAG- or non-FLAG-containing wild-type IGFBP-4, the
fragments that were generated had lost the ability to bind to IGF-1. In
contrast, when mutant FLAG and non-FLAG forms of IGFBP-4 were analyzed,
they remained intact, and the intact proteins bound to
125I-IGF-1.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2. Resistance to cleavage by the IGFBP-4 protease.
Wild-type IGFBP-4 (1.0 µg/ml) (A), or FLAG K120N, H121N IGFBP-4 (1.0
µg/ml) (B), or FLAG-containing wild-type IGFBP-4 (1.0 µg/ml) (C)
were incubated with 20 µl of the partially purified IGFBP-4 protease
and IGF-1 (1 µg/ml) for the times listed. The products of each
reaction were analyzed by immunoblotting using anti-IGFBP-4 antiserum.
As shown in the figure, no fragment was generated with the K120N, H121N
mutant IGFBP-4, even after a 36-h incubation. The arrows
denote the positions of intact IGFBP-4 and the IGFBP-4 fragments. This
experiment was repeated three times with similar results.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Figure 3. Western ligand blot and immunoblot of IGFBP-4 and
its fragments. Wild-type IGFBP-4 (1.0 µg/ml) (lanes 1 and 3), or
K120N, H121N IGFBP-4 (1.0 µg/ml) (lanes 2 and 4) were incubated with
IGF-1 (1.0 µg/ml) and the pSMC protease for 14 h at 37 C. At
that time, the intact protein and its fragments were separated by
SDS-PAGE and analyzed by immunoblotting (lanes 12) or Western ligand
blotting using 125IGF-1 (500,000 cpm/ml) (lanes 3 and 4).
As shown in the figure, the 18- and 14-kDa fragments that were
generated do not bind to 125IGF-1, whereas the intact
protein has easily detectable binding activity. The experiment was
repeated two times with similar results.
|
|
Effects of IGFBP-4 mutants on IGF-1-stimulated actions
To determine the biologic significance of eliminating proteolysis,
two types of experiments were performed. First, the pSMC cultures were
exposed to a constant amount of either FLAG K120N, H121N IGFBP-4 or
wild-type IGFBP-4 and increasing concentrations of IGF-1. No effect of
IGF-1 was seen in the cultures exposed to 500 ng/ml K120N, H121N
IGFBP-4 until a concentration of at least 50 ng/ml was added. In
contrast, in the presence of wild-type IGFBP-4, significant stimulation
was noted at 5 ng/ml IGF-1 (Fig. 4
).
Second, increasing concentrations of the FLAG-containing K120N, H121N
mutant and FLAG-containing wild-type IGFBP-4 were added to pSMC
cultures in the presence of 20 ng/ml IGF-1. The DNA synthesis response
to IGF-1 was completely inhibited by 500 ng/ml of FLAG K120H, H121H
IGFBP-4, and a significant inhibitory effect on the DNA synthesis
response could be detected at 100 ng/ml (Fig. 5
). In contrast, nonmutated FLAG IGFBP-4
did not inhibit the response to IGF-1 until 500 ng/ml was added, and
then the inhibition was minimal, e.g. 21% (Fig. 5
). These
results suggested that K120N, H121N IGFBP-4 results in significant
inhibition of IGF-1 response and that it is much more potent than
wild-type IGFBP-4. When the products of the reaction at the end of the
DNA synthesis experiment were analyzed by immunoblotting, no cleavage
of FLAG K120N, H121N IGFBP-4 was detected. When the medium from the
cultures that were exposed to 500 ng/ml wild-type IGFBP-4 was analyzed,
IGFBP-4 was found to be nearly completely cleaved (Fig. 6
). Thus, it seems that mutagenesis of
the proteolytic cleavage site resulted in resistance to proteolytic
cleavage and maintenance of a large concentration of intact protein,
which resulted in inhibition of IGF-1 responsiveness.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 5. Effect of increasing concentrations of
protease-resistant IGFBP-4 on IGF-1-stimulated DNA synthesis. To
further analyze the effect of the protease resistant form of IGFBP-4 on
the cellular response to IGF-1, the cultures were exposed to a constant
concentration of IGF-1 (20 ng/ml) and increasing amounts of each form
of IGFBP-4, including wild-type IGFBP-4 ( ), FLAG IGFBP-4
( ), K120N, H121N IGFBP-4 (), and FLAG
K120N, H121N IGFBP-4 ( ). Each point represents
the mean of triplicate determinations. As noted in the figure, the
protease-resistant mutants were highly active, in terms of inhibiting
the response to IGF-1, when used at concentrations between 100 and 500
ng/ml. Insertion of FLAG epitope made no difference in this response.
In contrast, the addition of wild-type protein was not effective unless
500 ng/ml was added, and then the response to IGF-1 was inhibited by
only 21%.
|
|

View larger version (57K):
[in this window]
[in a new window]
|
Figure 6. Immunoblotting of conditioned medium at the end of
the DNA synthesis experiment. To determine whether there was a
correlation between the capacity to inhibit the DNA synthesis response
to IGF-1 and the amount of intact IGFBP-4 present in the conditioned
medium, the supernatants from the cultures that were exposed to the
highest concentrations of IGFBP-4 in the experiment shown in Fig. 5
were analyzed by immunoblotting. The supernatants from the cultures
that had received 500 ng of wild-type IGFBP-4 (lane 2) had almost no
intact protein remaining. Those that were exposed to nonpurified K120N,
H121N IGFBP-4 showed abundant intact protein and a small amount of
fragment (lane 4). In contrast, those that were exposed to the
purified, protease resistant IGFBP-4 showed no fragments (lane 6).
Lanes 1, 3, and 5 contain the purified forms of the respective proteins
that were used.
|
|
When three independent experiments were analyzed, IGF-1 (100 ng/ml)
stimulated a 105 ± 18% increase in migration (Table 1
). Coincubation with 500 ng/ml of native
IGFBP-4 resulted in no inhibition of migration, and 2.5 µg/ml had
only a minimal effect (e.g. 93 ± 21% increase). An
equal concentration of K120N, H121N IGFBP-5 resulted in 94 ± 8%
(P < 0.001) inhibition of the IGF-1-stimulated
response.
 |
Discussion
|
|---|
We have previously reported that rat glial cells (B104) secrete an
IGFBP-4 protease that cleaves rat IGFBP-4 at lysine120,
histidine121 (9). These studies confirm that the protease
secreted by pSMC also cleaves human IGFBP-4 at this position.
Mutagenesis of the lysine120, histidine121 site
resulted in a major decrease in degradation, compared with native
IGFBP-4 (Fig. 1
). However, a small amount of IGFBP-4 fragment was still
detectable. Because CHO cells also secrete IGFBP-4, we assumed that the
cleavage fragment that was detected arose from this nonmutated form of
Chinese hamster IGFBP-4. To confirm that hypothesis, we prepared a
second complementary DNA construct that contained the FLAG epitope.
Human K120N, H121N IGFBP-4 was separated from CHO-derived IGFBP-4 by
affinity chromatography. When the purified, FLAG-containing K120N,
H121N IGFBP-4 was analyzed by immunoblotting, there was a single band;
and after a prolonged incubation with the protease, no fragments were
detected by immunoblotting. This confirmed that lysine120,
histidine121 was the correct cleavage site and that the
native CHO-derived IGFBP-4 had been removed.
A small amount of a peptide (<10% of the total), beginning with
lysine136, was detected when wild-type IGFBP-4 was degraded
by the protease and the fragments were sequenced. This site has
previously been reported to be the cleavage site from an IGFBP-4
protease that is secreted by human fibroblasts (10). In contrast, this
peptide was not detected after prolonged exposure of K120N, H121N to
the IGFBP-4 protease (Fig 2B
), indicating that the
methionine135, lysine136 site was not used.
Therefore, it seems that lysine120,
histidine121 is the primary cleavage site within human
IGFBP-4 that is used by the pSMC IGFBP-4 protease. Subsequently, a
small amount of the 121232 peptide is further cleaved at
methionine135, lysine136.
To determine whether mutagenesis or insertion of the FLAG epitope
resulted in a major change in the affinity of IGFBP-4 for IGF-1,
Scatchard analysis was performed. Neither substitution for the two
amino acids at the cleavage site nor insertion of the FLAG epitope
resulted in a change in affinity. This suggests that K120N, H121N
IGFBP-4 mutant is a useful reagent for analyzing the biologic activity
of IGF-1 in this system.
To determine the effect of the IGFBP-4 mutant on IGF-1 actions, two
types of experiments were performed. Addition of the mutant protein,
using a 5:1 molar excess of IGFBP-4 over IGF-1, was shown to completely
inhibit the cellular DNA synthesis response to added IGF-1. It
inhibited the IGF-1-stimulated response dose dependently, and even a
2:1 molar excess ratio of IGFBP-4 to IGF-1 resulted in significant
reduction in IGF-1 responsiveness. In this regard, it seems to be more
potent than IGFBP-5 (8). To determine whether this mutant peptide would
affect other IGF-1 actions, cell migration was measured. As can be seen
in Table 1
, concentrations as low as a 1.5:1 molar excess ratio of
mutant IGFBP-4 to IGF-1 resulted in significant attenuation of the cell
migration response, and a 4:1 molar excess completely inhibited the
cellular migration response to IGF-1. Because cleavage of IGFBP-4
results in a major reduction of affinity of the generated fragments for
IGF-1, this suggests that the protein is acting to block the DNA
synthesis and cell migration responses of pSMC by inhibiting the
association of IGF-1 with its receptor and that this mutant will be
very useful in determining the actions of IGF-1 in target cell systems
in vivo.
It is not completely possible to extrapolate these findings to a
physiologic system in which no IGF-1 is added. However, IGFBP-4
inhibited the effect of 5 ng/ml IGF-1 on DNA synthesis, and this is a
concentration that occurs in many in vitro test systems. The
SMC migration assay requires higher concentrations of IGF-1,
e.g. 100 ng/ml, to achieve reproducible stimulation of
migration in 48 h. Therefore, it is difficult to make direct
comparisons regarding the effect of IGFBP-4 on cell migration to
physiologic test systems wherein 100 ng/ml of IGF-1 is usually not
present.
Several cell types, including human fibroblasts (10, 20, 23), human
decidual (24), vascular SMC (7) (25), glial B104 cells (9), and
osteoblasts (26, 27) have been shown to secrete IGFBP-4 proteases.
Whether all these proteases are identical is unclear, but our results
indicate that the pSMC and B104 proteases use the same cleavage site.
Whether the IGFBP-4 protease is expressed in smooth muscle in
vivo has not been definitively determined. However, Wang and
co-workers have transfected IGFBP-4 into aortic and bladder SMC.
Extraction of these tissues has shown cleavage of the intact peptide
into fragments, suggesting that cleavage does occur in vivo
(28). Furthermore, using an SMC-specific promoter, Wang et
al. showed that IGFBP-4 levels were increased 10-fold in aorta and
bladder, and this was associated with SMC hypoplasia. This indicates
that IGF-1 is an important growth factor for smooth muscle in
vivo and that IGFBP-4 can act as an inhibitor.
IGF-1 is an important growth factor of aortic SMC, and its expression
is altered in atherogenesis. Specifically, IGF-1 messenger RNA has been
shown to increase after balloon denudation of the aorta in rats (29).
More importantly, in human atherectomy specimens, IGF-1 expression has
been shown to be markedly up-regulated (30). Because SMC possess IGF-1
receptors and respond to IGF-1 with both hypertrophy and hyperplasia,
this suggests that up-regulation of IGF-1 synthesis may be an important
component of the atherosclerotic process. IGF-1 stimulates not only
increases in cell growth, but it also stimulates SMC protein synthesis
(8) and cell migration (31); therefore, there are multiple potential
mechanisms by which IGF-1 may stimulate SMC accumulation and
enlargement within lesions. IGFBP-2 and -4 have been shown to inhibit
IGF-1 actions in SMC. Specifically, when adequate amounts of intact
proteins are added in vitro, they can overwhelm the effect
of IGFBP proteases and lead to inhibition of IGF-1 action (9, 11). In
contrast to IGFBP-4, the addition of IGFBP-5 to extracellular matrix
(ECM) can result in a marked reduction in IGFBP-5 affinity for IGF-1
and augmentation of the effect of IGF-1 on cell growth (32). However,
if proteolysis of IGFBP-5 is totally inhibited, and a 5:1 molar excess
of IGFBP-5 to IGF-1 is added, this will overcome the stimulatory effect
of ECM-associated IGFBP-5 and result in growth inhibition (8). The
results from this study indicate that protease-resistant IGFBP-4 is a
more potent inhibitor of IGF-1-stimulated DNA synthesis, compared with
protease-resistant IGFBP-5 (e.g. a 1.5:1 ratio resulted in
significant inhibition). This is probably caused by the fact that,
unlike IGFBP-5, IGFBP-4 does not bind to ECM, and the addition of lower
concentrations has no potentiating effect on IGF-1 actions.
Because all three forms of IGFBPs are synthesized by smooth muscle, it
will be important in future studies to determine how coordinate
regulation of these three proteins results in alterations in IGF-1
action. We have determined that SMC cultures, at high density,
synthesize and release substantially less IGFBP-5, and this may mediate
part of the density-dependent growth inhibition that occurs in these
cultures (33). In contrast, high-density cultures have substantially
lower amounts of IGFBP-4 proteolytic activity; and consequently, they
have much higher concentrations of intact IGFBP-4, compared with
low-density cultures. These findings suggest that there is coordinate
regulation between IGFBP-4 and -5 in mediating density-dependent
attenuation of growth responsiveness to IGF-1 in SMC. In contrast,
IGFBP-2 is not regulated by changes in cell density, and its role
in regulating SMC hyperplasia has not been definitively determined.
In summary, IGFBP-4 is cleaved into two non-IGF binding fragments by a
serine protease in SMC medium. Mutagenesis of the cleavage site results
in a form of IGFBP-4 that is not cleaved and is a potent inhibitor of
IGF-1 action. IGFBP-4 is substantially more potent than IGFBP-5 in
inhibiting IGF-1 action, and this is probably secondary to its
inability to bind to ECM and potentiate IGF-1 actions. Future studies
should be directed toward determining the major variables that control
the synthesis and processing of this protease by SMC, because this may
be an important mechanism by which these cells autoregulate their
responsiveness to IGF-1. Likewise, determining whether macrophages and
other cell types within atherosclerotic lesions produce this protease
will be an important focus of future studies.
 |
Acknowledgments
|
|---|
The authors thank Ms. Christine Smith of Monsanto, Inc.
(Chesterfield, MO), who performed the amino acid sequence analysis. We
thank Mr. George Mosley for his editorial assistance in preparing
the manuscript.
 |
Footnotes
|
|---|
1 These studies were supported by Grant HL-56850 from the National
Institutes of Health. 
Received February 20, 1998.
 |
References
|
|---|
-
Bennett MR, Evan GI, Schwartz SM 1995 Aproptosis of human vascular smooth muscle cells derived from normal
vessel and coronary atherosclerotic plaques. J Clin Invest 95:22662274
-
Ross R 1995 Cell biology of atherosclerosis. Annu
Rev Physiol 57:791804[CrossRef][Medline]
-
Cohick WS, Gockerman A, Clemmons DR 1995 Regulation of insulin-like growth factor (IGF) binding protein-2
synthesis and degradation by platelet-derived growth factor and IGFs is
enhanced by serum deprivation in vascular growth muscle cells. J
Cell Physiol 164:187196[CrossRef][Medline]
-
Duan C, Hawes S, Prevette T, Clemmons DR 1996 Insulin-like growth factor-I (IGF-I) stimulates IGF binding protein-5
synthesis through transcriptional activation of the gene in aortic
smooth muscle cells. J Biol Chem 271:42804288[Abstract/Free Full Text]
-
Giannella-Neto D, Kamyar A, Sharifi B, Pirola J, Kupfer
J, Rosenfeld RG, Forrester JS, Fagin JA 1992 Platelet-derived
growth factor isoforms decrease insulin-like growth factor I gene
expression in rat vascular smooth muscle cells and selectively
stimulate the biosynthesis of insulin-like growth factor binding
protein 4. Circ Res 71:646656[Abstract/Free Full Text]
-
Gockerman A, Clemmons DR 1995 Porcine aortic
smooth muscle cells secrete a serine protease for insulin-like growth
factor binding protein-2. Circ Res 76:514521[Abstract/Free Full Text]
-
Parker A, Gockerman A, Busby WH, Clemmons DR 1995 Properties of an insulin-like growth factor binding protein 4 protease
that is secreted by smooth muscle cells. Endocrinology 135:24702476
-
Imai Y, Busby WH, Smith CE, Clark JB, Horvitz GD, Rees
C, Clemmons DR 1997 Protease resistant form of insulin-like growth
factor binding protein-5 is an inhibitor of insulin-like growth
factor-I actions in porcine smooth muscle cells in culture. J Clin
Invest 100:25962605[Medline]
-
Chernausek SD, Smith CE, Duffin KL, Busby WH, Wright G,
Clemmons DR 1995 Proteolytic cleavage of insulin-like growth
factor binding protein-4 (IGFBP-4). J Biol Chem 270:1137711382[Abstract/Free Full Text]
-
Conover CA, Durham SK, Zapf J, Masiarz FR, Keifer
MC 1995 Cleavage analysis of insulin-like growth factor
(IGF)-dependent IGF binding protein-4 proteolysis and expression of
protease-resistant IGF binding protein-4 mutants. J Biol Chem 270:43954400[Abstract/Free Full Text]
-
Cohick WS, Gockerman A, Clemmons DR 1993 Vascular
smooth muscle cells synthesize two forms of insulin-like growth factor
binding proteins which are regulated differently by the insulin-like
growth factors. J Cell Physiol 157:5260[CrossRef][Medline]
-
Ross R 1971 The smooth muscle cell: growth of
smooth muscle in cultures and formation of elastic fibers. J Cell
Biol 50:172186[Abstract/Free Full Text]
-
McCusker RH, Camacho-Hubner C, Clemmons DR 1989 Identification of the types of insulin-like growth factor binding
proteins that are secreted by muscle cells in vitro. J
Biol Chem 264:77957800[Abstract/Free Full Text]
-
Busby WH, Klapper DG, Clemmons DR 1988 Purification
of a 31000 dalton insulin-like growth factor binding protein from human
amniotic fluid. J Biol Chem 263:1420314210[Abstract/Free Full Text]
-
Camacho-Hubner C, Busby WH, McCusker RH, Wright G,
Clemmons DR 1992 Identification of the forms of insulin-like
growth factor binding proteins produced by human fibroblasts and the
mechanisms that regulate their secretion. J Biol Chem 267:1194911956[Abstract/Free Full Text]
-
Parker A, Busby WH, Clemmons DR 1996 Identification
of the extracellular matrix binding site for insulin-like growth factor
binding protein-5. J Biol Chem 271:1352313529[Abstract/Free Full Text]
-
Arai T, Clarke JB, Parker A, Busby Jr W, Nam TJ,
Clemmons DR 1996 Substitution of specific amino acids in
insulin-like growth factor binding protein-5 alters heparin binding and
its change in affinity for IGF-I in response to heparin. J Biol
Chem 271:60996106[Abstract/Free Full Text]
-
Dong Y, Skoulteki A, Pollard J 1993 Efficient DNA
transfection of quiescent mammalian cells. Nucleic Acids Res 21:17711772
-
Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing
with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:54635467[Abstract/Free Full Text]
-
Fowlkes J, Freemark M 1992 Evidence for a novel
insulin-like growth factor (IGF)-dependent protease regulating IGF
binding protein-4 in dermal fibroblasts. Endocrinology 131:20712076[Abstract/Free Full Text]
-
Clemmons DR, Gardner LI 1990 A factor contained in
plasma is required for IGF binding protein-1 to potentiate the effect
of IGF-I on smooth muscle cell DNA synthesis. J Cell Physiol 145:129135[CrossRef][Medline]
-
Jones JI, Prevette T, Gockerman A, Clemmons DR 1996 Binding of vitronectin to an aVB3 integrin is necessary for smooth
muscle cells to migrate in response to IGF-I. Proc Natl Acad Sci 93:24622467
-
Conover CA, Keifer MC, Zapf J 1993 Posttranslational regulation of insulin-like growth factor binding
protein 4 in normal and transformed human fibroblasts. J Clin
Invest 91:11291137
-
Myers SE, Cheung PT, Handwerger SH, Chernausek SD 1993 Insulin-like growth factor I enhanced proteolysis of IGF binding
protein-4 in conditioned medium from primary cultures of human decidua.
Endocrinology 133:15251531[Abstract/Free Full Text]
-
Kamyar A, Pirola CJ, Wang HM, Sharifi B, Mohan S,
Forrester JS, Fagin JA 1994 Expression and insulin-like growth
factor-dependent proteolysis of insulin-like growth factor binding
protein-4 are regulated by cell confluence in vascular smooth muscle
cells. Circ Res 74:576585[Abstract/Free Full Text]
-
Durham SK, Keifer MR, Riggs BL, Conover CA 1994 Regulation of insulin-like growth factor binding protein-4 by a
specific insulin-like growth factor binding protein-4 protease in
normal human osteoblast like cells. Implications on human cell
physiology. J Bone Miner Res 9:111117[Medline]
-
Kanzaki S, Hilliker S, Baylink DJ, Mohan S 1994 Evidence that human bone cells in culture produce insulin-like growth
factor binding protein-4 and -5 proteases. Endocrinology 134:383392[Abstract/Free Full Text]
-
Wang J, Wen N, Witte DP, Chernausek SD, Nikiforov YE,
Clemens TL, Sharifi B, Strauch AR, Fagin JA 1998 Overexpression of
IGFBP-4 in smooth muscle cells of transgenic mice through a smooth
muscle
actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia.
Endocrinology 139:26052614[Abstract/Free Full Text]
-
Khorsondi MJ, Fagin JA, Ginnella-Neto JC, Forrester JS,
Cercek B 1992 Regulation of insulin-like growth factor I and its
receptor in rat aorta after balloon degradation: evidence for local
bioactivity. J Clin Invest 90:19261931
-
Grant MB, Wargovich TJ, Ellis EA, Caballero S, Mansour
M, Pepine CJ 1994 Localization of insulin-like growth factor-I and
inhibition of coronary smooth muscle cell growth by somatostatin
analogues in human coronary smooth muscle cells. Circulation 89:15111517[Abstract/Free Full Text]
-
Gockerman A, Jones JI, Prevette T, Clemmons DR 1995 Insulin-like growth factor binding protein-2 inhibits smooth muscle
cell migration response to IGF-I. Endocrinology 136:41684173[Abstract]
-
Jones JI, Gockerman A, Busby WH, Camacho-Hubner C,
Clemmons DR 1993 Extracellular matrix contains insulin-like growth
factor binding protein-5: potentiation of the effects of IGF-I. J
Cell Biol 121:679687[Abstract/Free Full Text]
-
Duan C, Clemmons DR 1998 Differential expression
and opposing biological effects of insulin-like growth factor (IGF)
binding proteins-4 and -5 in vascular smooth muscle cells. J Biol
Chem 273:1683616842[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. C. Nichols, W. H. Busby Jr., E. Merricks, J. Sipos, M. Rowland, K. Sitko, and D. R. Clemmons
Protease-Resistant Insulin-Like Growth Factor (IGF)-Binding Protein-4 Inhibits IGF-I Actions and Neointimal Expansion in a Porcine Model of Neointimal Hyperplasia
Endocrinology,
October 1, 2007;
148(10):
5002 - 5010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. T. Resch, R. D. Simari, and C. A. Conover
Targeted Disruption of the Pregnancy-Associated Plasma Protein-A Gene Is Associated with Diminished Smooth Muscle Cell Response to Insulin-like Growth Factor-I and Resistance to Neointimal Hyperplasia after Vascular Injury
Endocrinology,
December 1, 2006;
147(12):
5634 - 5640.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P A Rooman, L. O. De Beeck, M. Martin, J. van Doorn, S. Mohan, and M. V L Du Caju
Ethinylestradiol and testosterone have divergent effects on circulating IGF system components in adolescents with constitutional tall stature
Eur. J. Endocrinol.,
April 1, 2005;
152(4):
597 - 604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Firth and R. C. Baxter
Cellular Actions of the Insulin-Like Growth Factor Binding Proteins
Endocr. Rev.,
December 1, 2002;
23(6):
824 - 854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zhang, E. P. Smith, H. Kuroda, W. Banach, S. D. Chernausek, and J. A. Fagin
Targeted Expression of a Protease-resistant IGFBP-4 Mutant in Smooth Muscle of Transgenic Mice Results in IGFBP-4 Stabilization and Smooth Muscle Hypotrophy
J. Biol. Chem.,
June 7, 2002;
277(24):
21285 - 21290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-K. Chen, M. T. Overgaard, L. K. Bale, Z. T. Resch, M. Christiansen, C. Oxvig, and C. A. Conover
Molecular Regulation of the IGF-Binding Protein-4 Protease System in Human Fibroblasts: Identification of a Novel Inducible Inhibitor
Endocrinology,
April 1, 2002;
143(4):
1199 - 1205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Clemmons
Use of Mutagenesis to Probe IGF-Binding Protein Structure/Function Relationships
Endocr. Rev.,
December 1, 2001;
22(6):
800 - 817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. P. Smith, A. Kamyar, W. Niu, J. Wang, B. Cercek, S. D. Chernausek, and J. A. Fagin
IGF-Binding Protein-4 Expression and IGF-Binding Protein-4 Protease Activity Are Regulated Coordinately in Smooth Muscle During Postnatal Development and After Vascular Injury
Endocrinology,
October 1, 2001;
142(10):
4420 - 4427.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.M. Rivera, Y.A. Chandrasekher, A.C.O. Evans, L.C. Giudice, and J.E. Fortune
A Potential Role for Insulin-Like Growth Factor Binding Protein-4 Proteolysis in the Establishment of Ovarian Follicular Dominance in Cattle
Biol Reprod,
July 1, 2001;
65(1):
102 - 111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Gimbel, D. Chelius, T. K. Hunt, and E. M. Spencer
A Novel Approach to Reducing Postoperative Intraperitoneal Adhesions Through the Inhibition of Insulinlike Growth Factor I Activity
Arch Surg,
March 1, 2001;
136(3):
311 - 317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Fernandez-Celemin and J.-P. Thissen
Interleukin-6 Stimulates Hepatic Insulin-Like Growth Factor Binding Protein-4 Messenger Ribonucleic Acid and Protein
Endocrinology,
January 1, 2001;
142(1):
241 - 248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. SCHNEIDER, H. LAHM, M. WU, A. HOEFLICH, and E. WOLF
Transgenic mouse models for studying the functions of insulin-like growth factor-binding proteins
FASEB J,
April 1, 2000;
14(5):
629 - 640.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
I. Demori, S. Balocco, A. Voci, and E. Fugassa
Increased insulin-like growth factor binding protein-4 expression after partial hepatectomy in the rat
Am J Physiol Gastrointest Liver Physiol,
March 1, 2000;
278(3):
G384 - G389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Anwar, A. A. Zahid, L. Phillips, and P. Delafontaine
Insulin-Like Growth Factor Binding Protein-4 Expression Is Decreased by Angiotensin II and Thrombin in Rat Aortic Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol.,
February 1, 2000;
20(2):
370 - 376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Byun, S. Mohan, C. Kim, K. Suh, M. Yoo, H. Lee, D. J. Baylink, and X. Qin
Studies on Human Pregnancy-Induced Insulin-Like Growth Factor (IGF)-Binding Protein-4 Proteases in Serum: Determination of IGF-II Dependency and Localization of Cleavage Site
J. Clin. Endocrinol. Metab.,
January 1, 2000;
85(1):
373 - 381.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. Hwa, Y. Oh, and R. G. Rosenfeld
The Insulin-Like Growth Factor-Binding Protein (IGFBP) Superfamily
Endocr. Rev.,
December 1, 1999;
20(6):
761 - 787.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. R. Clemmons, G. Horvitz, W. Engleman, T. Nichols, A. Moralez, and G. A. Nickols
Synthetic {alpha}V{beta}3 Antagonists Inhibit Insulin-Like Growth Factor-I-Stimulated Smooth Muscle Cell Migration and Replication
Endocrinology,
October 1, 1999;
140(10):
4616 - 4621.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Mazerbourg, J. Zapf, R. S. Bar, D. R. Brigstock, C. Lalou, M. Binoux, and P. Monget
Insulin-Like Growth Factor Binding Protein-4 Proteolytic Degradation in Ovine Preovulatory Follicles: Studies of Underlying Mechanisms
Endocrinology,
September 1, 1999;
140(9):
4175 - 4184.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. C. Martin, J. L. Fowlkes, B. Babic, and R. Khokha
Insulin-like Growth Factor II Signaling in Neoplastic Proliferation Is Blocked by Transgenic Expression of the Metalloproteinase Inhibitor TIMP-1
J. Cell Biol.,
August 23, 1999;
146(4):
881 - 892.
[Abstract]
[Full Text]
[PDF]
|
 |
|