help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rees, C.
Right arrow Articles by Busby, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rees, C.
Right arrow Articles by Busby, W. H.
Endocrinology Vol. 139, No. 10 4182-4188
Copyright © 1998 by The Endocrine Society


ARTICLES

A Protease-Resistant Form of Insulin-Like Growth Factor (IGF) Binding Protein 4 Inhibits IGF-1 Actions1

C. Rees, D. R. Clemmons, G. D. Horvitz, J. B. Clarke and W. H. Busby

Department of Medicine, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599

Address all correspondence and requests for reprints to: David R. Clemmons, M.D., Division of Endocrinology, CB no. 7170, 6111 Thurston-Bowles Building, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599-7170.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Smooth muscle cells (SMC) secrete a serine protease that cleaves insulin-like growth factor (IGF) binding protein (IGFBP)-4 into fragments that have low affinity for IGF-1. When IGFBP-4 is added to monolayer cultures of cell types that do not secrete this protease, IGF-1 stimulation of DNA synthesis is significantly inhibited. In contrast, if cell types that secrete this protease are used, IGFBP-4 is a much less potent inhibitor. These studies were conducted to determine whether proteolysis of IGFBP-4 accounted for its reduced capacity to inhibit IGF-1-stimulated DNA synthesis. The cleavage site in IGFBP-4 that the SMC protease uses was determined to be lysine120, histidine121. A protease-resistant mutant form of IGFBP-4 was prepared, expressed, purified, and tested for biologic activity using porcine SMC cultures. Addition of the protease-resistant mutant resulted in inhibition of DNA and cell migration responses to IGF-1. The inhibition was concentration dependent and was maximal when 500 ng/ml (20 nM) of the mutant was added with 20 ng/ml (2.8 nM) of IGF-1. When the mutant was added in the absence of IGF-1, it had no activity. The results show that cleavage of IGFBP-4 at lysine120, histidine121 results in inactivation of the ability of IGFBP-4 to bind to IGF-1. Creation of a mutant form of IGFBP-4 that was not cleaved by the protease resulted in inhibition of IGF-1-stimulated actions. The results suggest that IGFBP-4 can act as a potent inhibitor of the anabolic effects of IGF-1 and that the variables that regulate protease activity may indirectly regulate IGF-1 actions.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
INSULIN-LIKE growth factor 1 (IGF-1) is produced by smooth muscle cells (SMC), which are the predominant cell type in normal vessel walls and in atherosclerotic lesions (1, 2). SMC also synthesize and secrete insulin-like growth factor binding protein (IGFBP)-2, -4, and -5 (3, 4, 5). In addition to synthesis and secretion of these forms of IGFBPs, SMC also release three distinct proteases that degrade each form of IGFBP specifically (6, 7, 8). We and others have determined previously that rat neuronal cells (B104 cells) (9) and human fibroblasts (10) cleave IGFBP-4 at lysine120, histidine121 (B104 cell protease) or methionine135, lysine136 (fibroblast protease). The activity of the IGFBP-4 protease that is secreted by porcine SMC is inhibited by a variety of serine protease inhibitors (7), and its molecular mass has been estimated to be 48 kDa (7). The cleavage site that it uses has not been identified. We have previously reported that the addition of increasing concentrations of IGFBP-4 to SMC cultures that are actively producing the protease results in minimal inhibition of cellular responsiveness to IGF-1 (11). The addition of concentrations of IGFBP-4 between 50 and 200 ng/ml resulted in no inhibition of DNA synthesis in cultures that had been exposed to 20 ng/ml IGF-1. A concentration of 500 ng/ml was required to detect any inhibition, and its effect was minimal (e.g. 28%). When the culture supernatants at the end of the experiment were analyzed, almost all of the IGFBP-4 had been degraded in the cultures that had been exposed to IGFBP-4 concentrations between 50–200 ng/ml. Only those that had received 500 ng/ml had detectable intact peptide. Because the addition of similar concentrations of IGFBP-4 to fibroblast cultures that did not secrete the protease resulted in more than 95% inhibition of IGF-1-stimulated DNA synthesis, this suggested that the amount of intact IGFBP-4 that was present in the medium was a major determinant of whether IGF-1-stimulated DNA synthesis could be inhibited. The purpose of these studies was to determine the cleavage site in IGFBP-4 that is used by the SMC protease, to mutagenize that site, and to use the protease-resistant form of IGFBP-4 to determine its capacity to inhibit IGF-1-stimulated actions.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
Porcine aortic SMC (pSMC) were isolated by a previously described method (12). The cells were grown from explants obtained from 3-week-old pigs. The cells that were isolated had abundant SMC actin, grew in hills and valleys, and had other properties of SMC, as previously described (12). The cultures were maintained in DMEM-H (Life Technologies, Gaithersburg, MD), supplemented with 10% FBS (Sigma Chemical Co., St. Louis, MO), 10 mM glutamine, penicillin (100 U/ml), and streptomycin (100 µg/ml; Life Technologies). The cultures were passaged every week; and after reaching confluence, they were trypsinized and replated at 4000 cells/cm2 in 10-cm dishes (Falcon 3003; Falcon Labware Division of Beckton Dickenson, Rutherford, NJ).

Assessment of proteolysis
To determine the degree of IGFBP-4 proteolysis, approximately 2.0 µg/ml IGFBP-4 was added to 0.05 ml of 0.5 M Tris (pH 7.4) containing 4 mM CaCl2, and the mixture was incubated with varying amounts of pSMC-conditioned medium (25–40 µl) that contained the IGFBP-4 protease, for 36 h at 37 C. IGF-1 (1.0 µg/ml) was also added to the incubation buffer. After this incubation, 50 µl was removed, and the reaction products were separated by SDS-PAGE, as previously described (13). The proteins were transferred to immobilon-P membranes (Millipore, Inc., Bedford, MA) and were immunoblotted using a 1:1000 dilution of antihuman IGFBP-4 rabbit serum (7). Immune complexes were visualized with the Proto-Blot system (Promega, Madison, WI) using the manufacturer’s recommended protocol. An alkaline phosphatase-conjugated second-antibody detection system was used to detect immunoreactive IGFBP-4 and its fragments.

Identification of the proteolytic cleavage site
To determine the proteolytic cleavage site, 200 cc pSMC-conditioned medium was collected by incubating 20 confluent 10-cm cultures with 10 ml serum-free medium for 24 h. This medium was chromatographed over heparin sepharose (Pharmacia Biotech, Piscataway, NJ), as previously described. The IGFBP-4 protease was eluted with 0.6 M NaCl (7). The pool of active fractions was concentrated 8-fold on a Biomax filter (Millipore, Inc.). The concentrated material (5 µl) was incubated with 10 µg human IGFBP-4 for 24 h at 37 C. The human IGFBP-4 had been purified to homogeneity, as described previously (9). The products of the reaction were separated by high-pressure electrophoresis using an Applied Biosystems (Palo Alto, CA) model 230A high-pressure tube gel separatory apparatus. This material was separated using a gel (10%) in 75 mM Tris-phosphate (pH 7.5), 0.1% SDS for 14 h at 120 mV. The eluted fractions were analyzed to determine exact fragment size and homogeneity by SDS-PAGE with immunoblotting for IGFBP-4. The method was found to reproducibly separate fragments with as little as a 2.0-kDa difference. The N-terminal sequence of each fragment was determined by Edman degradation, as described previously (14).

In vitro mutagenesis
To determine whether the cleavage site that was identified was correct, in vitro mutagenesis was used. The IGFBP-4 complementary DNA that had been cloned to the pRc RSV vector (Invitrogen, Carlsbad, CA) was used as a template for mutagenesis (15, 16), and an oligonucleotide with the following sequence: 5' c c t g c a g a a a1 a1 a c t t c g c c a 3', which contained two base substitutions that would change lysine120 and histidine121 to asparginines was used. The method has been previously published (16, 17). Briefly, 2 ng plasmid DNA was used to transform Escherichia coli (strain no. CJ-236), which was then superinfected with a helper phage R408. The secreted phagemid particles were precipitated with 8% polyethylene glycol, and the single-stranded DNA was then isolated by adherence to Glass Milk (Bio 101, Vista, CA). Complementary oligonucleotides containing bp mismatches were then phosphorylated with T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and annealed to the IGFBP-4 template using a 30:1 molar ratio. Second-strand synthesis was initiated by adding 2.5 U T4 DNA polymerase and 2 U DNA ligase (Boerhinger Mannheim, Indianapolis, IN). Ten microliters of synthesis mixture was used to transform 100 µl of competent Escherichia coli (strain no. DH5{alpha} F’), and ampicillin-resistant colonies were obtained. Six colonies were amplified and sequenced. Sequencing verified that the correct mutations were present. The plasmid, containing the altered IGFBP-4 sequence in the correct orientation, was directly transfected into Chinese hamster ovary (CHO) K-1 cells (Lineberger Cancer Research Center, Chapel Hill, NC) using the poly(L)ornithine (Sigma) method (18). The cells were grown to confluence in medium containing 400 µg/ml G-418 (Life Technologies), and the concentration of IGFBP-4 in the medium was determined by immunoblotting. The cultures secreting the highest concentration of mutant protein were then amplified.

Preparation of mutants containing the FLAG epitope and determination of binding affinities for IGF-1
A second mutant IGFBP-4 construct was prepared using a synthetic oligonucleotide that encodes the FLAG epitope. This 8-amino acid extension (DYKDDDDK) was used to make possible the efficient separation of the expressed human IGFBP-4 from Chinese hamster IGFBP-4 that is constitutively secreted by CHO cells. The oligonucleotide contained the sequence (ggcccggctcggatccactgatgttctgctgctgctgttctgcttcggtagg) that encoded the last 6 amino acids of the human IGFBP-4 propeptide, the 8 amino acids of the FLAG epitope, and the first 5 amino acids of the human IGFBP-4 peptide. Single-stranded mutagenesis was used exactly as described for preparation of the IGFBP-4 mutant. Both the pRc plasmids containing the full protein coding region of IGFBP-4, with substitutions for lysine120, histidine121, and the full-length wild-type IGFBP-4 sequences were used as templates. The insertion of the FLAG epitope was confirmed by DNA sequencing (19). These plasmids were used to transfect CHO cells, as described previously (9). After selection and amplification in G-418-containing medium, the cultures secreting the highest concentrations of either form of FLAG IGFBP-4 were identified by immunoblotting using specific anti-FLAG antiserum (Eastman Kodak, Rochester, NY). Two liters of conditioned medium from each of the four transfected cell lines was obtained, and the IGFBP-4 in each sample was purified by a 3-step purification described previously (15). To separate Chinese hamster IGFBP-4 that is produced by the CHO cells from human IGFBP-4, a specific immunoaffinity column was used. The FLAG epitope-containing proteins that had been purified as described previously were applied to the column containing 2.0 ml anti-FLAG M2 affinity gel (Eastman Kodak) that had been equilibrated with a buffer containing 0.05 M Tris, 150 mM NaCl, 2 mM CaCL2, pH 7.40. The sample was eluted with 0.1 M glycine HCL, pH 3.0, using a flow rate of 0.5 ml/min. Homogeneity of the eluted IGFBP-4 was determined by SDS-PAGE with silver staining and by amino acid sequencing. The amount of protein was estimated by comparing the HPLC peak area in the final purification step to known concentrations of IGFBP-4 that had been determined by amino acid composition analysis.

To verify that the mutants did not have alterations in their affinities for IGF-1, increasing concentrations of IGF-1 (1–40 ng/ml), 5 ng/ml of each form of IGFBP-4, and 20,000 cpm 125I-IGF-1 were added to 0.5 cc of 0.025 M Tris, pH 7.0, 0.25% polyethylene glycol. After 14 h at 4 C, the IGFBP-4 was precipitated by adding 15% polyethylene glycol. The pellets were washed once and then counted (13). The affinity of each form of IGFBP-4 for IGF-1 was calculated using Scatchard analysis and was compared with wild-type IGFBP-4. No alteration in affinity was detected. The affinity constants were as follows: native IGFBP-4 (1.6 x 10-9 M-1) K120N, H121N; IGFBP-4 (1.2 x 10-9 M-1); FLAG IGFBP-4 (1.9 x 10-9 M-1); and FLAG K120N, H121N, IGFBP-4 (2.1 x 10-9 M-1).

To determine whether the mutants were resistant to proteolysis, 2.0 µg/ml of the FLAG containing wild-type IGFBP-4, or both the FLAG or non-FLAG containing K120N, H121N mutants were incubated with 20 µl of the partially purified IGFBP-4 protease and 1.0 µg/ml IGF-1 for 16 h at 37 C, as previously described (7, 20). The products were analyzed by immunoblotting.

Assessment of 3H-thymidine incorporation
To determine whether failure to cleave IGFBP-4 would alter the cellular replication response to IGF-1, quiescent pSMC cultures were plated in 96-well plates at a density of 5000 cells/well. After 5 days, they were exposed to 0.2 cc DME containing 0.2% human platelet poor plasma, 0.5 µCi 3H-thymidine (16 Ci/mM; ICN Biochemicals, Costa Mesa, CA), increasing concentrations of IGF-1 (2–50 ng/ml), and a constant amount of IGFBP-4 (500 ng/ml). Additional cultures were exposed to 20 ng/ml IGF-1 and increasing concentrations of wild-type or K120N, H121N IGFBP-4 (50–500 ng/ml). After 36 h, the amount of 3H-thymidine that was incorporated into DNA was determined (21).

Measurement of cell migration
To analyze the effects of the IGFBP-4 mutants on IGF-1-stimulated pSMC migration, confluent monolayers were prepared using 6-well (35-mm) plates (Falcon 3036). The monolayers were wounded with a single-edge razor blade, as described by Jones et al. (22). The plate was rinsed once and incubated in DME containing 0.2% FBS with IGF-1 (100 ng/ml) and IGFBP-4 (500 ng–2.5 µg/ml) for 48 h at 37 C. The cells were fixed and stained with methylene blue, then the mutant number of cells that migrated across the wound edge was determined as described previously (22). Each data point represents the mean of 7–9, 1-mm regions that were selected immediately after wounding.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Susceptibility of IGFBP-4 and the protease-resistant mutants to cleavage
After incubation of nonmutated IGFBP-4 with the partially purified IGFBP-4 protease in vitro, it was cleaved to fragments of 18 and 14 kDa (Fig. 1AGo, lanes 1 and 2). The primary cleavage site used by the pSMC protease was determined by sequence analysis to be lysine120, histidine121. This site was mutated by converting the charged residues to asparginines; and the K120N, H121N IGFBP-1 was purified. When K120N, H121N IGFBP-4 was incubated with the protease, there was less cleavage, but a fragment was easily detected (Fig. 1AGo, lanes 3 and 4). To determine whether that fragment was derived from nonmutated Chinese hamster ovary (CHO) IGFBP-4, nonmutated, human IGFBP-4 containing the FLAG epitope was expressed. Two bands were noted in the purified starting material; and based on the fragment sizes that were detected, both bands seemed to be cleaved (Fig. 1AGo, lanes 5 and 6). Insertion of the FLAG epitope resulted in no change in the ability of IGFBP-4 to be cleaved by the protease. To determine whether one of the two bands was CHO-secreted IGFBP-4 and whether one was human IGFBP-4 that contained the FLAG epitope, this material was further purified by immunoaffinity chromatography using the specific anti-FLAG column, as described in Materials and Methods. Analysis of the purified, FLAG-containing wild-type IGFBP-4 showed that the lower molecular mass form of intact IGFBP-4 was not present and that the upper band that remained after purification was cleaved (Fig. 1AGo, lanes 7 and 8). To confirm that the lower band represented CHO-derived IGFBP-4, the FLAG containing K120N, H121N IGFBP-4 that had not been affinity purified was analyzed. As shown in lanes 9 and 10, the upper band intensity was unchanged, whereas the lower band was decreased. To further confirm that the K1210N, H121N FLAG IGFBP-4 was stable, the immunopurified mutant was analyzed. No cleavage was detected after 14 h (lanes 11 and 12). To confirm that the higher molecular mass form of IGFBP-4 contained the FLAG epitope, both the purified and nonpurified forms were analyzed by immunoblotting using anti-FLAG antiserum (Fig. 1BGo). Only the higher molecular band was detected with the FLAG antiserum. Importantly, the wild-type IGFBP-4 containing the FLAG epitope was degraded by the IGFBP-4 protease, indicating that insertion of the FLAG sequence had no effect on its susceptibility to degradation. The results show definitively that K120N, H121N IGFBP-4 and FLAG K120, H121N IGFBP-4 are resistant to cleavage.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. Cleavage of various forms of IGFBP-4 by the IGFBP-4 protease. A, The partially purified IGFBP-4 protease (20 µl) was incubated with 1.0 µg/ml IGF-1 and 1.0 µg/ml wild-type IGFBP-4 (lane 2), K120N, H121N nonpurified IGFBP-4 (lane 4), FLAG-containing wild-type IGFBP-4 (not immunopurified) (lane 6), FLAG wild-type IGFBP-4 (immunopurified) (lane 8), FLAG K120N, H121N IGFBP-4 (not immunopurified) (lane 10), and FLAG K120N, H121N IGFBP-4 (immunopurified) (lane 12). The incubation was continued at 37 C for 14 h, and the products were analyzed by immunoblotting for IGFBP-4. Control tubes that contained the corresponding protein, but no protease, were incubated using the same conditions and are shown in lanes 1, 3, 5, 7, 9, and 11. This experiment was repeated three times with similar results. B, Immunoblot of cleavage products using anti-FLAG antiserum. The FLAG containing nonpurified wild-type (lanes 1–2) and purified wild-type (lanes 3–4) IGFBP-4 or the FLAG-containing K120N, H121N nonpurified (lanes 5–6) or purified (lanes 7–8) mutant were incubated with the protease (lanes 2, 4, 6, and 8); then, the products of the reaction were analyzed by immunoblotting using the anti-FLAG antiserum. This experiment was repeated two times with similar results.

 
Time course of IGFBP-4 degradation and loss of the ability of fragments to bind IGF-1
To further confirm that this form of the FLAG IGFBP-4 mutant was very resistant to cleavage, FLAG and non-FLAG-containing wild-type and K120N, H121N IGFBP-4 were incubated with the protease; and the products of the reaction were analyzed at time points between 4 and 36 h. Both FLAG-containing and non-FLAG-containing IGFBP-4 had detectable fragments after 4 h; and after 14 h, the majority of each peptide was cleaved. In contrast, the purified FLAG K120N H121N IGFBP-4 was completely resistant to proteolysis over this time interval (Fig. 2Go). To determine the capacity of the proteolytically generated fragments to bind IGF-1, ligand blotting was performed. As shown in Fig. 3Go, after cleavage of the FLAG- or non-FLAG-containing wild-type IGFBP-4, the fragments that were generated had lost the ability to bind to IGF-1. In contrast, when mutant FLAG and non-FLAG forms of IGFBP-4 were analyzed, they remained intact, and the intact proteins bound to 125I-IGF-1.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 2. Resistance to cleavage by the IGFBP-4 protease. Wild-type IGFBP-4 (1.0 µg/ml) (A), or FLAG K120N, H121N IGFBP-4 (1.0 µg/ml) (B), or FLAG-containing wild-type IGFBP-4 (1.0 µg/ml) (C) were incubated with 20 µl of the partially purified IGFBP-4 protease and IGF-1 (1 µg/ml) for the times listed. The products of each reaction were analyzed by immunoblotting using anti-IGFBP-4 antiserum. As shown in the figure, no fragment was generated with the K120N, H121N mutant IGFBP-4, even after a 36-h incubation. The arrows denote the positions of intact IGFBP-4 and the IGFBP-4 fragments. This experiment was repeated three times with similar results.

 


View larger version (70K):
[in this window]
[in a new window]
 
Figure 3. Western ligand blot and immunoblot of IGFBP-4 and its fragments. Wild-type IGFBP-4 (1.0 µg/ml) (lanes 1 and 3), or K120N, H121N IGFBP-4 (1.0 µg/ml) (lanes 2 and 4) were incubated with IGF-1 (1.0 µg/ml) and the pSMC protease for 14 h at 37 C. At that time, the intact protein and its fragments were separated by SDS-PAGE and analyzed by immunoblotting (lanes 1–2) or Western ligand blotting using 125IGF-1 (500,000 cpm/ml) (lanes 3 and 4). As shown in the figure, the 18- and 14-kDa fragments that were generated do not bind to 125IGF-1, whereas the intact protein has easily detectable binding activity. The experiment was repeated two times with similar results.

 
Effects of IGFBP-4 mutants on IGF-1-stimulated actions
To determine the biologic significance of eliminating proteolysis, two types of experiments were performed. First, the pSMC cultures were exposed to a constant amount of either FLAG K120N, H121N IGFBP-4 or wild-type IGFBP-4 and increasing concentrations of IGF-1. No effect of IGF-1 was seen in the cultures exposed to 500 ng/ml K120N, H121N IGFBP-4 until a concentration of at least 50 ng/ml was added. In contrast, in the presence of wild-type IGFBP-4, significant stimulation was noted at 5 ng/ml IGF-1 (Fig. 4Go). Second, increasing concentrations of the FLAG-containing K120N, H121N mutant and FLAG-containing wild-type IGFBP-4 were added to pSMC cultures in the presence of 20 ng/ml IGF-1. The DNA synthesis response to IGF-1 was completely inhibited by 500 ng/ml of FLAG K120H, H121H IGFBP-4, and a significant inhibitory effect on the DNA synthesis response could be detected at 100 ng/ml (Fig. 5Go). In contrast, nonmutated FLAG IGFBP-4 did not inhibit the response to IGF-1 until 500 ng/ml was added, and then the inhibition was minimal, e.g. 21% (Fig. 5Go). These results suggested that K120N, H121N IGFBP-4 results in significant inhibition of IGF-1 response and that it is much more potent than wild-type IGFBP-4. When the products of the reaction at the end of the DNA synthesis experiment were analyzed by immunoblotting, no cleavage of FLAG K120N, H121N IGFBP-4 was detected. When the medium from the cultures that were exposed to 500 ng/ml wild-type IGFBP-4 was analyzed, IGFBP-4 was found to be nearly completely cleaved (Fig. 6Go). Thus, it seems that mutagenesis of the proteolytic cleavage site resulted in resistance to proteolytic cleavage and maintenance of a large concentration of intact protein, which resulted in inhibition of IGF-1 responsiveness.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. DNA synthesis response of pSMC to increasing concentrations of IGF-1. Increasing amounts of IGF-1, between 2–50 ng/ml ({circ}{circ}), were added to quiescent pSMC cultures. After 36 h, the amount of 3H-thymidine incorporation into DNA was determined as described in Materials and Methods. An additional set of cultures received the same concentrations of IGF-1 and either 200 (•– –•) or 500 ng/ml (x– –x) of wild-type IGFBP-4. Another set of cultures contained either 200 ({circ}– –{circ}) or 500 ng/ml (•—•) of the K120N, H121N mutant IGFBP-4. Each data point represents the mean of triplicate determinations. K120N, H121N IGFBP-4 (500 ng/ml) inhibited the cellular response to IGF-1 at each concentration that was tested. In contrast, the wild-type protein had no effect on inhibiting IGF-1-mediated increases in the DNA synthesis when IGF-1 concentrations greater than 20 ng/ml were used.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Effect of increasing concentrations of protease-resistant IGFBP-4 on IGF-1-stimulated DNA synthesis. To further analyze the effect of the protease resistant form of IGFBP-4 on the cellular response to IGF-1, the cultures were exposed to a constant concentration of IGF-1 (20 ng/ml) and increasing amounts of each form of IGFBP-4, including wild-type IGFBP-4 (•– –•), FLAG IGFBP-4 ({circ}– –{circ}), K120N, H121N IGFBP-4 (•—•), and FLAG K120N, H121N IGFBP-4 ({circ}{circ}). Each point represents the mean of triplicate determinations. As noted in the figure, the protease-resistant mutants were highly active, in terms of inhibiting the response to IGF-1, when used at concentrations between 100 and 500 ng/ml. Insertion of FLAG epitope made no difference in this response. In contrast, the addition of wild-type protein was not effective unless 500 ng/ml was added, and then the response to IGF-1 was inhibited by only 21%.

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. Immunoblotting of conditioned medium at the end of the DNA synthesis experiment. To determine whether there was a correlation between the capacity to inhibit the DNA synthesis response to IGF-1 and the amount of intact IGFBP-4 present in the conditioned medium, the supernatants from the cultures that were exposed to the highest concentrations of IGFBP-4 in the experiment shown in Fig. 5Go were analyzed by immunoblotting. The supernatants from the cultures that had received 500 ng of wild-type IGFBP-4 (lane 2) had almost no intact protein remaining. Those that were exposed to nonpurified K120N, H121N IGFBP-4 showed abundant intact protein and a small amount of fragment (lane 4). In contrast, those that were exposed to the purified, protease resistant IGFBP-4 showed no fragments (lane 6). Lanes 1, 3, and 5 contain the purified forms of the respective proteins that were used.

 
When three independent experiments were analyzed, IGF-1 (100 ng/ml) stimulated a 105 ± 18% increase in migration (Table 1Go). Coincubation with 500 ng/ml of native IGFBP-4 resulted in no inhibition of migration, and 2.5 µg/ml had only a minimal effect (e.g. 93 ± 21% increase). An equal concentration of K120N, H121N IGFBP-5 resulted in 94 ± 8% (P < 0.001) inhibition of the IGF-1-stimulated response.


View this table:
[in this window]
[in a new window]
 
Table 1. Cell migration response to IGF-1

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously reported that rat glial cells (B104) secrete an IGFBP-4 protease that cleaves rat IGFBP-4 at lysine120, histidine121 (9). These studies confirm that the protease secreted by pSMC also cleaves human IGFBP-4 at this position. Mutagenesis of the lysine120, histidine121 site resulted in a major decrease in degradation, compared with native IGFBP-4 (Fig. 1Go). However, a small amount of IGFBP-4 fragment was still detectable. Because CHO cells also secrete IGFBP-4, we assumed that the cleavage fragment that was detected arose from this nonmutated form of Chinese hamster IGFBP-4. To confirm that hypothesis, we prepared a second complementary DNA construct that contained the FLAG epitope. Human K120N, H121N IGFBP-4 was separated from CHO-derived IGFBP-4 by affinity chromatography. When the purified, FLAG-containing K120N, H121N IGFBP-4 was analyzed by immunoblotting, there was a single band; and after a prolonged incubation with the protease, no fragments were detected by immunoblotting. This confirmed that lysine120, histidine121 was the correct cleavage site and that the native CHO-derived IGFBP-4 had been removed.

A small amount of a peptide (<10% of the total), beginning with lysine136, was detected when wild-type IGFBP-4 was degraded by the protease and the fragments were sequenced. This site has previously been reported to be the cleavage site from an IGFBP-4 protease that is secreted by human fibroblasts (10). In contrast, this peptide was not detected after prolonged exposure of K120N, H121N to the IGFBP-4 protease (Fig 2BGo), indicating that the methionine135, lysine136 site was not used. Therefore, it seems that lysine120, histidine121 is the primary cleavage site within human IGFBP-4 that is used by the pSMC IGFBP-4 protease. Subsequently, a small amount of the 121–232 peptide is further cleaved at methionine135, lysine136.

To determine whether mutagenesis or insertion of the FLAG epitope resulted in a major change in the affinity of IGFBP-4 for IGF-1, Scatchard analysis was performed. Neither substitution for the two amino acids at the cleavage site nor insertion of the FLAG epitope resulted in a change in affinity. This suggests that K120N, H121N IGFBP-4 mutant is a useful reagent for analyzing the biologic activity of IGF-1 in this system.

To determine the effect of the IGFBP-4 mutant on IGF-1 actions, two types of experiments were performed. Addition of the mutant protein, using a 5:1 molar excess of IGFBP-4 over IGF-1, was shown to completely inhibit the cellular DNA synthesis response to added IGF-1. It inhibited the IGF-1-stimulated response dose dependently, and even a 2:1 molar excess ratio of IGFBP-4 to IGF-1 resulted in significant reduction in IGF-1 responsiveness. In this regard, it seems to be more potent than IGFBP-5 (8). To determine whether this mutant peptide would affect other IGF-1 actions, cell migration was measured. As can be seen in Table 1Go, concentrations as low as a 1.5:1 molar excess ratio of mutant IGFBP-4 to IGF-1 resulted in significant attenuation of the cell migration response, and a 4:1 molar excess completely inhibited the cellular migration response to IGF-1. Because cleavage of IGFBP-4 results in a major reduction of affinity of the generated fragments for IGF-1, this suggests that the protein is acting to block the DNA synthesis and cell migration responses of pSMC by inhibiting the association of IGF-1 with its receptor and that this mutant will be very useful in determining the actions of IGF-1 in target cell systems in vivo.

It is not completely possible to extrapolate these findings to a physiologic system in which no IGF-1 is added. However, IGFBP-4 inhibited the effect of 5 ng/ml IGF-1 on DNA synthesis, and this is a concentration that occurs in many in vitro test systems. The SMC migration assay requires higher concentrations of IGF-1, e.g. 100 ng/ml, to achieve reproducible stimulation of migration in 48 h. Therefore, it is difficult to make direct comparisons regarding the effect of IGFBP-4 on cell migration to physiologic test systems wherein 100 ng/ml of IGF-1 is usually not present.

Several cell types, including human fibroblasts (10, 20, 23), human decidual (24), vascular SMC (7) (25), glial B104 cells (9), and osteoblasts (26, 27) have been shown to secrete IGFBP-4 proteases. Whether all these proteases are identical is unclear, but our results indicate that the pSMC and B104 proteases use the same cleavage site. Whether the IGFBP-4 protease is expressed in smooth muscle in vivo has not been definitively determined. However, Wang and co-workers have transfected IGFBP-4 into aortic and bladder SMC. Extraction of these tissues has shown cleavage of the intact peptide into fragments, suggesting that cleavage does occur in vivo (28). Furthermore, using an SMC-specific promoter, Wang et al. showed that IGFBP-4 levels were increased 10-fold in aorta and bladder, and this was associated with SMC hypoplasia. This indicates that IGF-1 is an important growth factor for smooth muscle in vivo and that IGFBP-4 can act as an inhibitor.

IGF-1 is an important growth factor of aortic SMC, and its expression is altered in atherogenesis. Specifically, IGF-1 messenger RNA has been shown to increase after balloon denudation of the aorta in rats (29). More importantly, in human atherectomy specimens, IGF-1 expression has been shown to be markedly up-regulated (30). Because SMC possess IGF-1 receptors and respond to IGF-1 with both hypertrophy and hyperplasia, this suggests that up-regulation of IGF-1 synthesis may be an important component of the atherosclerotic process. IGF-1 stimulates not only increases in cell growth, but it also stimulates SMC protein synthesis (8) and cell migration (31); therefore, there are multiple potential mechanisms by which IGF-1 may stimulate SMC accumulation and enlargement within lesions. IGFBP-2 and -4 have been shown to inhibit IGF-1 actions in SMC. Specifically, when adequate amounts of intact proteins are added in vitro, they can overwhelm the effect of IGFBP proteases and lead to inhibition of IGF-1 action (9, 11). In contrast to IGFBP-4, the addition of IGFBP-5 to extracellular matrix (ECM) can result in a marked reduction in IGFBP-5 affinity for IGF-1 and augmentation of the effect of IGF-1 on cell growth (32). However, if proteolysis of IGFBP-5 is totally inhibited, and a 5:1 molar excess of IGFBP-5 to IGF-1 is added, this will overcome the stimulatory effect of ECM-associated IGFBP-5 and result in growth inhibition (8). The results from this study indicate that protease-resistant IGFBP-4 is a more potent inhibitor of IGF-1-stimulated DNA synthesis, compared with protease-resistant IGFBP-5 (e.g. a 1.5:1 ratio resulted in significant inhibition). This is probably caused by the fact that, unlike IGFBP-5, IGFBP-4 does not bind to ECM, and the addition of lower concentrations has no potentiating effect on IGF-1 actions.

Because all three forms of IGFBPs are synthesized by smooth muscle, it will be important in future studies to determine how coordinate regulation of these three proteins results in alterations in IGF-1 action. We have determined that SMC cultures, at high density, synthesize and release substantially less IGFBP-5, and this may mediate part of the density-dependent growth inhibition that occurs in these cultures (33). In contrast, high-density cultures have substantially lower amounts of IGFBP-4 proteolytic activity; and consequently, they have much higher concentrations of intact IGFBP-4, compared with low-density cultures. These findings suggest that there is coordinate regulation between IGFBP-4 and -5 in mediating density-dependent attenuation of growth responsiveness to IGF-1 in SMC. In contrast, IGFBP-2 is not regulated by changes in cell density, and its role in regulating SMC hyperplasia has not been definitively determined.

In summary, IGFBP-4 is cleaved into two non-IGF binding fragments by a serine protease in SMC medium. Mutagenesis of the cleavage site results in a form of IGFBP-4 that is not cleaved and is a potent inhibitor of IGF-1 action. IGFBP-4 is substantially more potent than IGFBP-5 in inhibiting IGF-1 action, and this is probably secondary to its inability to bind to ECM and potentiate IGF-1 actions. Future studies should be directed toward determining the major variables that control the synthesis and processing of this protease by SMC, because this may be an important mechanism by which these cells autoregulate their responsiveness to IGF-1. Likewise, determining whether macrophages and other cell types within atherosclerotic lesions produce this protease will be an important focus of future studies.


    Acknowledgments
 
The authors thank Ms. Christine Smith of Monsanto, Inc. (Chesterfield, MO), who performed the amino acid sequence analysis. We thank Mr. George Mosley for his editorial assistance in preparing the manuscript.


    Footnotes
 
1 These studies were supported by Grant HL-56850 from the National Institutes of Health. Back

Received February 20, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bennett MR, Evan GI, Schwartz SM 1995 Aproptosis of human vascular smooth muscle cells derived from normal vessel and coronary atherosclerotic plaques. J Clin Invest 95:2266–2274
  2. Ross R 1995 Cell biology of atherosclerosis. Annu Rev Physiol 57:791–804[CrossRef][Medline]
  3. Cohick WS, Gockerman A, Clemmons DR 1995 Regulation of insulin-like growth factor (IGF) binding protein-2 synthesis and degradation by platelet-derived growth factor and IGFs is enhanced by serum deprivation in vascular growth muscle cells. J Cell Physiol 164:187–196[CrossRef][Medline]
  4. Duan C, Hawes S, Prevette T, Clemmons DR 1996 Insulin-like growth factor-I (IGF-I) stimulates IGF binding protein-5 synthesis through transcriptional activation of the gene in aortic smooth muscle cells. J Biol Chem 271:4280–4288[Abstract/Free Full Text]
  5. Giannella-Neto D, Kamyar A, Sharifi B, Pirola J, Kupfer J, Rosenfeld RG, Forrester JS, Fagin JA 1992 Platelet-derived growth factor isoforms decrease insulin-like growth factor I gene expression in rat vascular smooth muscle cells and selectively stimulate the biosynthesis of insulin-like growth factor binding protein 4. Circ Res 71:646–656[Abstract/Free Full Text]
  6. Gockerman A, Clemmons DR 1995 Porcine aortic smooth muscle cells secrete a serine protease for insulin-like growth factor binding protein-2. Circ Res 76:514–521[Abstract/Free Full Text]
  7. Parker A, Gockerman A, Busby WH, Clemmons DR 1995 Properties of an insulin-like growth factor binding protein 4 protease that is secreted by smooth muscle cells. Endocrinology 135:2470–2476
  8. Imai Y, Busby WH, Smith CE, Clark JB, Horvitz GD, Rees C, Clemmons DR 1997 Protease resistant form of insulin-like growth factor binding protein-5 is an inhibitor of insulin-like growth factor-I actions in porcine smooth muscle cells in culture. J Clin Invest 100:2596–2605[Medline]
  9. Chernausek SD, Smith CE, Duffin KL, Busby WH, Wright G, Clemmons DR 1995 Proteolytic cleavage of insulin-like growth factor binding protein-4 (IGFBP-4). J Biol Chem 270:11377–11382[Abstract/Free Full Text]
  10. Conover CA, Durham SK, Zapf J, Masiarz FR, Keifer MC 1995 Cleavage analysis of insulin-like growth factor (IGF)-dependent IGF binding protein-4 proteolysis and expression of protease-resistant IGF binding protein-4 mutants. J Biol Chem 270:4395–4400[Abstract/Free Full Text]
  11. Cohick WS, Gockerman A, Clemmons DR 1993 Vascular smooth muscle cells synthesize two forms of insulin-like growth factor binding proteins which are regulated differently by the insulin-like growth factors. J Cell Physiol 157:52–60[CrossRef][Medline]
  12. Ross R 1971 The smooth muscle cell: growth of smooth muscle in cultures and formation of elastic fibers. J Cell Biol 50:172–186[Abstract/Free Full Text]
  13. McCusker RH, Camacho-Hubner C, Clemmons DR 1989 Identification of the types of insulin-like growth factor binding proteins that are secreted by muscle cells in vitro. J Biol Chem 264:7795–7800[Abstract/Free Full Text]
  14. Busby WH, Klapper DG, Clemmons DR 1988 Purification of a 31000 dalton insulin-like growth factor binding protein from human amniotic fluid. J Biol Chem 263:14203–14210[Abstract/Free Full Text]
  15. Camacho-Hubner C, Busby WH, McCusker RH, Wright G, Clemmons DR 1992 Identification of the forms of insulin-like growth factor binding proteins produced by human fibroblasts and the mechanisms that regulate their secretion. J Biol Chem 267:11949–11956[Abstract/Free Full Text]
  16. Parker A, Busby WH, Clemmons DR 1996 Identification of the extracellular matrix binding site for insulin-like growth factor binding protein-5. J Biol Chem 271:13523–13529[Abstract/Free Full Text]
  17. Arai T, Clarke JB, Parker A, Busby Jr W, Nam TJ, Clemmons DR 1996 Substitution of specific amino acids in insulin-like growth factor binding protein-5 alters heparin binding and its change in affinity for IGF-I in response to heparin. J Biol Chem 271:6099–6106[Abstract/Free Full Text]
  18. Dong Y, Skoulteki A, Pollard J 1993 Efficient DNA transfection of quiescent mammalian cells. Nucleic Acids Res 21:1771–1772
  19. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  20. Fowlkes J, Freemark M 1992 Evidence for a novel insulin-like growth factor (IGF)-dependent protease regulating IGF binding protein-4 in dermal fibroblasts. Endocrinology 131:2071–2076[Abstract/Free Full Text]
  21. Clemmons DR, Gardner LI 1990 A factor contained in plasma is required for IGF binding protein-1 to potentiate the effect of IGF-I on smooth muscle cell DNA synthesis. J Cell Physiol 145:129–135[CrossRef][Medline]
  22. Jones JI, Prevette T, Gockerman A, Clemmons DR 1996 Binding of vitronectin to an aVB3 integrin is necessary for smooth muscle cells to migrate in response to IGF-I. Proc Natl Acad Sci 93:2462–2467
  23. Conover CA, Keifer MC, Zapf J 1993 Posttranslational regulation of insulin-like growth factor binding protein 4 in normal and transformed human fibroblasts. J Clin Invest 91:1129–1137
  24. Myers SE, Cheung PT, Handwerger SH, Chernausek SD 1993 Insulin-like growth factor I enhanced proteolysis of IGF binding protein-4 in conditioned medium from primary cultures of human decidua. Endocrinology 133:1525–1531[Abstract/Free Full Text]
  25. Kamyar A, Pirola CJ, Wang HM, Sharifi B, Mohan S, Forrester JS, Fagin JA 1994 Expression and insulin-like growth factor-dependent proteolysis of insulin-like growth factor binding protein-4 are regulated by cell confluence in vascular smooth muscle cells. Circ Res 74:576–585[Abstract/Free Full Text]
  26. Durham SK, Keifer MR, Riggs BL, Conover CA 1994 Regulation of insulin-like growth factor binding protein-4 by a specific insulin-like growth factor binding protein-4 protease in normal human osteoblast like cells. Implications on human cell physiology. J Bone Miner Res 9:111–117[Medline]
  27. Kanzaki S, Hilliker S, Baylink DJ, Mohan S 1994 Evidence that human bone cells in culture produce insulin-like growth factor binding protein-4 and -5 proteases. Endocrinology 134:383–392[Abstract/Free Full Text]
  28. Wang J, Wen N, Witte DP, Chernausek SD, Nikiforov YE, Clemens TL, Sharifi B, Strauch AR, Fagin JA 1998 Overexpression of IGFBP-4 in smooth muscle cells of transgenic mice through a smooth muscle {alpha} actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia. Endocrinology 139:2605–2614[Abstract/Free Full Text]
  29. Khorsondi MJ, Fagin JA, Ginnella-Neto JC, Forrester JS, Cercek B 1992 Regulation of insulin-like growth factor I and its receptor in rat aorta after balloon degradation: evidence for local bioactivity. J Clin Invest 90:1926–1931
  30. Grant MB, Wargovich TJ, Ellis EA, Caballero S, Mansour M, Pepine CJ 1994 Localization of insulin-like growth factor-I and inhibition of coronary smooth muscle cell growth by somatostatin analogues in human coronary smooth muscle cells. Circulation 89:1511–1517[Abstract/Free Full Text]
  31. Gockerman A, Jones JI, Prevette T, Clemmons DR 1995 Insulin-like growth factor binding protein-2 inhibits smooth muscle cell migration response to IGF-I. Endocrinology 136:4168–4173[Abstract]
  32. Jones JI, Gockerman A, Busby WH, Camacho-Hubner C, Clemmons DR 1993 Extracellular matrix contains insulin-like growth factor binding protein-5: potentiation of the effects of IGF-I. J Cell Biol 121:679–687[Abstract/Free Full Text]
  33. Duan C, Clemmons DR 1998 Differential expression and opposing biological effects of insulin-like growth factor (IGF) binding proteins-4 and -5 in vascular smooth muscle cells. J Biol Chem 273:16836–16842[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. C. Nichols, W. H. Busby Jr., E. Merricks, J. Sipos, M. Rowland, K. Sitko, and D. R. Clemmons
Protease-Resistant Insulin-Like Growth Factor (IGF)-Binding Protein-4 Inhibits IGF-I Actions and Neointimal Expansion in a Porcine Model of Neointimal Hyperplasia
Endocrinology, October 1, 2007; 148(10): 5002 - 5010.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. T. Resch, R. D. Simari, and C. A. Conover
Targeted Disruption of the Pregnancy-Associated Plasma Protein-A Gene Is Associated with Diminished Smooth Muscle Cell Response to Insulin-like Growth Factor-I and Resistance to Neointimal Hyperplasia after Vascular Injury
Endocrinology, December 1, 2006; 147(12): 5634 - 5640.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
R. P A Rooman, L. O. De Beeck, M. Martin, J. van Doorn, S. Mohan, and M. V L Du Caju
Ethinylestradiol and testosterone have divergent effects on circulating IGF system components in adolescents with constitutional tall stature
Eur. J. Endocrinol., April 1, 2005; 152(4): 597 - 604.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. M. Firth and R. C. Baxter
Cellular Actions of the Insulin-Like Growth Factor Binding Proteins
Endocr. Rev., December 1, 2002; 23(6): 824 - 854.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, E. P. Smith, H. Kuroda, W. Banach, S. D. Chernausek, and J. A. Fagin
Targeted Expression of a Protease-resistant IGFBP-4 Mutant in Smooth Muscle of Transgenic Mice Results in IGFBP-4 Stabilization and Smooth Muscle Hypotrophy
J. Biol. Chem., June 7, 2002; 277(24): 21285 - 21290.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B.-K. Chen, M. T. Overgaard, L. K. Bale, Z. T. Resch, M. Christiansen, C. Oxvig, and C. A. Conover
Molecular Regulation of the IGF-Binding Protein-4 Protease System in Human Fibroblasts: Identification of a Novel Inducible Inhibitor
Endocrinology, April 1, 2002; 143(4): 1199 - 1205.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
D. R. Clemmons
Use of Mutagenesis to Probe IGF-Binding Protein Structure/Function Relationships
Endocr. Rev., December 1, 2001; 22(6): 800 - 817.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. P. Smith, A. Kamyar, W. Niu, J. Wang, B. Cercek, S. D. Chernausek, and J. A. Fagin
IGF-Binding Protein-4 Expression and IGF-Binding Protein-4 Protease Activity Are Regulated Coordinately in Smooth Muscle During Postnatal Development and After Vascular Injury
Endocrinology, October 1, 2001; 142(10): 4420 - 4427.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G.M. Rivera, Y.A. Chandrasekher, A.C.O. Evans, L.C. Giudice, and J.E. Fortune
A Potential Role for Insulin-Like Growth Factor Binding Protein-4 Proteolysis in the Establishment of Ovarian Follicular Dominance in Cattle
Biol Reprod, July 1, 2001; 65(1): 102 - 111.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
M. L. Gimbel, D. Chelius, T. K. Hunt, and E. M. Spencer
A Novel Approach to Reducing Postoperative Intraperitoneal Adhesions Through the Inhibition of Insulinlike Growth Factor I Activity
Arch Surg, March 1, 2001; 136(3): 311 - 317.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Fernandez-Celemin and J.-P. Thissen
Interleukin-6 Stimulates Hepatic Insulin-Like Growth Factor Binding Protein-4 Messenger Ribonucleic Acid and Protein
Endocrinology, January 1, 2001; 142(1): 241 - 248.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. R. SCHNEIDER, H. LAHM, M. WU, A. HOEFLICH, and E. WOLF
Transgenic mouse models for studying the functions of insulin-like growth factor-binding proteins
FASEB J, April 1, 2000; 14(5): 629 - 640.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
I. Demori, S. Balocco, A. Voci, and E. Fugassa
Increased insulin-like growth factor binding protein-4 expression after partial hepatectomy in the rat
Am J Physiol Gastrointest Liver Physiol, March 1, 2000; 278(3): G384 - G389.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Anwar, A. A. Zahid, L. Phillips, and P. Delafontaine
Insulin-Like Growth Factor Binding Protein-4 Expression Is Decreased by Angiotensin II and Thrombin in Rat Aortic Vascular Smooth Muscle Cells
Arterioscler Thromb Vasc Biol, February 1, 2000; 20(2): 370 - 376.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Byun, S. Mohan, C. Kim, K. Suh, M. Yoo, H. Lee, D. J. Baylink, and X. Qin
Studies on Human Pregnancy-Induced Insulin-Like Growth Factor (IGF)-Binding Protein-4 Proteases in Serum: Determination of IGF-II Dependency and Localization of Cleavage Site
J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 373 - 381.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
V. Hwa, Y. Oh, and R. G. Rosenfeld
The Insulin-Like Growth Factor-Binding Protein (IGFBP) Superfamily
Endocr. Rev., December 1, 1999; 20(6): 761 - 787.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. R. Clemmons, G. Horvitz, W. Engleman, T. Nichols, A. Moralez, and G. A. Nickols
Synthetic {alpha}V{beta}3 Antagonists Inhibit Insulin-Like Growth Factor-I-Stimulated Smooth Muscle Cell Migration and Replication
Endocrinology, October 1, 1999; 140(10): 4616 - 4621.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
S. Mazerbourg, J. Zapf, R. S. Bar, D. R. Brigstock, C. Lalou, M. Binoux, and P. Monget
Insulin-Like Growth Factor Binding Protein-4 Proteolytic Degradation in Ovine Preovulatory Follicles: Studies of Underlying Mechanisms
Endocrinology, September 1, 1999; 140(9): 4175 - 4184.
[Abstract] [Full Text]


Home page
JCBHome page
D. C. Martin, J. L. Fowlkes, B. Babic, and R. Khokha
Insulin-like Growth Factor II Signaling in Neoplastic Proliferation Is Blocked by Transgenic Expression of the Metalloproteinase Inhibitor Timp-1
J. Cell Biol., August 23, 1999; 146(4): 881 - 892.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rees, C.
Right arrow Articles by Busby, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rees, C.
Right arrow Articles by Busby, W. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals