| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette Cedex, France
Address all correspondence and requests for reprints to: Dr. Philippe Vernier, Institut Alfred Fessard, UPR2212, Centre National de la Recherche Scientifique, 91198 Gif-sur-Yvette Cedex, France. E-mail: vernier{at}iaf.cnrs-gif.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The characteristic structural features of the D2 receptor show it to be a seven-transmembrane segment protein exhibiting a long third intracellular loop and a short intracellular C-terminus. These peptide stretches determine the efficiency and affinity of receptor-G protein coupling (3). In mammals, the length of the third cytoplasmic loop can be modified by alternative splicing of the premessenger RNA (pre-mRNA). The sixth exon of the D2 receptor gene codes for 29 amino acids and may or may not be included in the mature transcript (4, 5, 6), leading to the expression of either a long isoform (D2a) or a short isoform (D2b; nomenclature according to IUPHAR recommendations) (7).
The two D2 receptor isoforms are found in different proportions in dopamine target areas (4, 8, 9). The long isoform is predominant in the striatum and the pituitary gland of male rats, whereas it is no more abundant than the short isoform in the substantia nigra or the olfactory tubercle. This observation suggested that a tissue-specific factor could modulate the pre-mRNA splicing. In addition, it was observed that changes in the physiological concentrations of sex steroid hormones [estradiol, progesterone (P), or testosterone (T)] were able to modify the proportion of the two D2 receptor isoforms. Such an effect was observed first in primary cultures of PRL cells, where the relative amounts of each isoform were modified depending on the presence or absence of estradiol in the culture medium (10). It was then demonstrated that sex steroid hormones were able to modulate D2 receptor mRNA splicing in vivo by acting via their specific receptors in different regions of the male rat brain (11). For example, in the pituitary gland of male rats, the splicing of the D2 receptor mRNA was only affected by T acting via the androgen receptor, whereas in the olfactory tubercle, the relative proportions of the two isoforms of the D2 receptor were affected by estrogen receptors activated by T aromatized to estradiol.
To be able to properly analyze the molecular mechanisms regulating D2 receptor splicing, we chose to use MMQ cells, a PRL-secreting cell line isolated from an anterior pituitary tumor induced by estrogen in a female rat (12). These cells are exquisitely sensitive to sex steroid hormones, they possess a functional D2 receptor (12, 13), and they express exclusively the long isoform of this receptor when they are cultured with calf or horse serum (14). In the work presented here, the effects of steroid hormones on the expression of the two D2 receptor isoforms were studied by using a combination of receptor antagonists and inhibitors of protein expression. It was shown that estradiol and P were able to modify the proportion of each of the D2 receptor mRNA isoforms by acting via their intracellular receptors. This effect required protein synthesis, probably by modulating the expression of a splicing factor.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Time-course experiments were performed to analyze the genomic effects
of sex steroid hormones by treating the cells with 10-8
M 17ß-estradiol (E2), P, or T for
0, 6, 12, 24, and 48 h. The different inhibitors of translation
(cycloheximide) or transcription (actinomycin D and 
-amanitin;
10-6 M for each) were added in the different
conditions of steroid treatment for 24 h.
To analyze the contribution of sex steroid receptors, we used antagonists [antiestrogen, RU 58668 (16); antiprogestin, RU 486; antiandrogen, RU 56187 (17)] provided by Roussel-UCLAF (Romainville, France). They were added to the different sex steroid treatments at a concentration of 10-10 M (chosen as to provide the highest receptor specificity for the hormone concentration we used) for 48 h before cells were harvested and processed for the various assays. After the incubation, each cell sample was collected individually, and cells were pelleted by centrifugation at 500 xg for 5 min and stored at -80 C until RNA extraction.
RNA extraction, Northern blot, and semiquantitative RT-PCR
Total RNA from each sample was extracted by the guanidium-phenol
acid method (18). To analyze the modulation of D2 receptor
expression after the steroid hormone treatments, Northern blots were
performed. Briefly, 10 µg total RNA were run on a denaturing 1%
agarose gel, transferred onto nitrocellulose membrane, and probed with
32P-labeled D2 complementary DNA (cDNA) or
glyceraldehyde-3-phosphate dehydrogenase cDNA as control.
RT-PCR was performed essentially as described previously (11). Three micrograms of each sample were denatured at 90 C for 5 min with oligo(deoxythymidine)15 (0.5 mg/ml) and random primer (0.5 mg/ml) and kept on ice. Then, first strand buffer, dithiothreitol (10 mM), deoxy-NTP (0.5 mM), RNAsin (40 U/µl), and Superscript 200 U (Life Technologies) were added in a 50-µl final volume, and the reaction proceeded at 42 C for 1 h. The enzyme was inactivated by heating at 70 C for 10 min. The relative amounts of the two isoforms of the rat dopamine D2 receptor were measured by a semiquantitative PCR procedure. Oligonucleotides corresponding to upstream (CCTTCATCGTC-ACTCTGCTGG) and downstream (CTCCATTTCCAGCTCCTGAG) sequences of the spliced exon of the D2 receptor mRNA were 32P labeled by phosphorylation with polynucleotide kinase and used as primers for the Taq polymerase (Promega, Madison, WI). The linearity and reproducibility of the PCR reaction were optimized and carefully checked over a large range of cycle numbers (n = 15–45) with different amounts of cDNA. Tests were also performed with various proportions of in vitro transcribed RNA corresponding to the two D2 receptor cDNA isoforms cloned in the pBluescript vector (Stratagene, La Jolla, CA) to ensure that no bias would favor the amplification of one isoform over the other. PCR reactions were carried out for every sample and for five different numbers of cycles (20, 25, 30, 35, and 40). Quantification of the radioactive PCR products was performed by separating the DNA fragments on a 10% polyacrylamide gel (29:1) and directly counting the radioactivity from the dried gel with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Statistical significance of the differences for the ratio D2a/D2b measured in the different groups was assessed by ANOVA (Scheffé’s test, StatView II, Abacus Concepts, Berkeley, CA).
PCR for estrogen, androgen, and P receptors
The presence of various sex steroid receptors was analyzed by
RT-PCR using RNA from cells cultured for 48 h in the different
conditions described above. Primers used for the estrogen receptor
were: upstream oligonucleotide, -GTCTGGTCCTGTGAAGGCTGCA-; and
downstream oligonucleotide, -ACCAGGCACACTCCAGAAGGTG-; those used for
the androgen receptor were: upstream oligonucleotide,
-TTACTTCCCACCCCAGAAGACC-; and downstream oligonucleotide,
-GCAAATACCATCAGTCCCATCC-; and those used for the P receptor were:
upstream oligonucleotide, -TATGGCTTTGATTCCTTACCTC-; and downstream
oligonucleotide, -GCAAAATATAGCATCTGTCCAC-. All of the oligonucleotides
were individually 32P labeled by phosphorylation with
polynucleotide kinase and used as primers for the Taq
polymerase (Promega) for 25 cycles. The radioactive PCR products were
analyzed on polyacrylamide gels as described above.
Western blot of estrogen receptor
Cells treated for 48 h in the different conditions with or
without sex steroid hormones were lysed in buffer [50 mM
Tris-HCl (pH 7.5), 100 mM NaCl, 1% Triton X-100, 50
mM NaF, 10 mM
Na4P2O7, 5 mM EDTA, 1%
aprotinin, 1 µg/ml leupeptin, 1 mM sodium orthovanadate,
and 1 mM Pefabloc SC, Boehringer Mannheim, Mannheim,
Germany] for 15 min at 4 C. Cell lysates were centrifuged for 20 min
at 4 C and 14,000 x g, and proteins from the
supernatants were quantified by the Bradford technique (Bio-Rad,
Hercules, CA). Fifty micrograms of protein were loaded and run on 10%
SDS-PAGE, transferred onto nitrocellulose membrane, incubated with
estrogen receptor antibodies (Santa Cruz Biotechnologies, Santa Cruz,
CA), and revealed by chemiluminescence (ECL, Amersham, Arlington
Heights, IL).
Single cell PCR
To answer the question of whether individual MMQ cells possess
only one of the two isoforms or both of them, single cell PCR was
performed in normal serum (N) and hormone-depleted (O) conditions.
Cytoplasm of each cell was collected using a patch-clamp pipette;
expelled in 7 µl water containing 5 µM random primers,
20 U/µl RNAsin, 10 mM dithiothreitol, 0.5 mM
deoxy-NTP, and first strand buffer; immediately boiled at 95 C for 2
min for denaturation; and kept on ice. Reverse transcriptase (100 U;
Superscript, Life Technologies) was added, and the 10-µl reaction was
incubated at 42 C for 1 h. PCR was then performed in a 20-µl
reaction mix for 30 cycles using the same radiolabeled D2
primers and PCR conditions as previously described. PCR products were
analyzed on polyacrylamide gels as described above.
Cloning and sequencing of introns flanking exon 6
The D2a PCR product was used as a
32P-labeled probe to screen a rat genomic library
constructed in 
EMBL3 (generously given by Gert Scherrer) as
described previously (19). Four hybridizing clones were isolated and
purified, and corresponding DNA was sequenced with Sequenase (U.S.
Biochemical-Amersham, Cleveland, OH) using the upstream and downstream
oligonucleotides used for PCR of the alternative exon (see above).
Three clones were shown to possess exons 5 and 7 and therefore the
corresponding intervening sequences. Cloned DNAs were digested with
EcoRI and subcloned in pBluescript KS+
(Stratagene). Each construct encompassing the whole length of introns
flanking the alternative exon 6 was sequenced with internal
oligonucleotides (Genome Express, Grenoble, France).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
shows the time course of the sex
steroid effect on the ratio of the two D2 receptor isoforms
(D2a/D2b) measured in MMQ cells. When cells
were cultured in hormone-depleted serum (control conditions; see
Materials and Methods) the amount of the long isoform of the
D2 receptor mRNA decreased but still predominated to give a
D2a/D2b ratio close to 8. Addition of
E2 or T at 10-8 M
maintained the predominance of the long isoform in amounts about
30-fold greater than those of the short isoform. In sharp contrast,
treatment with both E2 and P (10-8
M each) markedly decreased the
D2a/D2b ratio to a value close to 1. All of
these effects reached a maximum 12 h after the start of hormonal
treatments and remained stable up to 48 h.
|
). These results suggested that the
basal or default splicing mechanism in MMQ cells led to the production
of the long and the short isoforms of the D2 receptor
pre-mRNA in approximately equivalent amounts.
|
and Table 1, none of these treatments significantly
changed the amounts of D2 mRNA or the levels of
D2 receptor-binding sites, as determined by binding
capacity values. Similarly, the presence of hormones in the cell
culture medium did not affect the affinity of the receptor for
[3H]spiperone (Kd = 0.5 x
10-10 M). The functional consequences of the
splicing were tested on the ability of the receptor to inhibit the
activity of forskolin-stimulated adenylyl cyclase, but no significant
changes were observed in any of the tested conditions.
|
|
The actions of sex steroid hormones are receptor specific
To demonstrate the contribution of sex steroid receptors, we used
three compounds that act as specific steroid receptor antagonists,
namely RU 486, a classical P receptor inhibitor; RU 58668, a good
estrogen receptor antagonist (16); and RU 56187, an androgen receptor
antagonist (17). Accordingly, these compounds have been shown to block
the regulatory effect of steroid hormones on the expression of target
genes.
The effects of the different combinations of sex steroids and
antagonists are summarized in Table 2. RU
58668, the estrogen antagonist, but not RU 56187, the androgen
antagonist, blocked the effect of E2 or T on the
splicing of D2 receptor mRNA. This suggests that T is
probably aromatized to estradiol and acts via estrogen receptors. Under
control conditions (hormone-depleted serum), the progestin receptor
antagonist RU 486 had no effect on the ratio of the two D2
receptor transcripts, indicating that this receptor alone cannot
influence the splicing mechanism. Under the same control conditions,
the estrogen antagonist decreased the D2a/D2b
ratio to a value close to 1. A similar result was obtained with the
combined E2 plus P treatment, supporting the idea
that the estrogen receptor is required to produce a high amount of the
long D2 receptor isoform. Accordingly, when the MMQ cells
were cultured in the presence of both E2 and P,
the progestin receptor antagonist elicited an increase in the
proportion of the long isoform, similar to that obtained with
E2 treatment alone. With the same hormone
treatment, the estrogen antagonist RU 58668 did not modify the ratio of
D2 receptor isoforms, revealing that under these
conditions, P is required to maintain a D2a/D2b
ratio close to 1.
|
). MMQ cells express androgen
receptor transcripts at a much lower level than those of estrogen or P
receptors, as expected for a PRL cell line derived from a female rat.
In addition, as assessed by Western blots, estrogen receptor protein
levels were not affected by any of the sex steroid treatments (Fig. 4B). Therefore, no change in steroid receptor expression needed to be
taken into account in the interpretation of the effects of sex steroid
hormones on the D2 receptor mRNA splicing observed in MMQ
cells.
|
Regulation of the D2 mRNA splicing by sex
steroids depends on the expression of splicing factors
As steroid receptors are transcription factors, gene expression
inhibitors were used to investigate whether a transcription step was
required for the effects of steroid hormones on the splicing of the
D2 receptor to occur. The results are summarized in Fig. 5.
|
-amanitin produced similar results, implying that
the action of the steroid hormones indeed involved transcription
modulation. At this point, evidence was accumulating to suggest that steroid-bound receptors were able to modulate the expression of one or several protein factors that could act as trans-regulators of the splicing of D2 receptor mRNA. Interestingly, none of the protein expression inhibitors used in these experiments changed the D2a/D2b ratio obtained by incubation of the cells with E2 and P together. In addition, neither this latter treatment nor protein expression inhibitors led to a D2a/D2b ratio below 1, suggesting that both long and short mature transcripts had equal chances of being produced in these experimental conditions. Therefore, the effect of E2 to favor the production of the long D2 receptor isoform must involve the transcriptional regulation of a given trans-acting splicing factor, whereas P seems to inhibit this effect at the same transcriptional level.
To gain new insights in the mechanisms of this unusual splicing phenomenon, we isolated from a rat genomic library introns 5 and 6 that flank the alternative exon 6 of the rat D2 receptor gene (see Materials and Methods) (19). Their sequences revealed that the rat intron 5 sequence bore two polypyrimidine-rich sequences, one 200 bp long and the other 60 bp long, as well as three putative lariat branch points, two of them flanking the longest polypyrimidine stretch. Such sequences were not found in intron 6, suggesting that the regulation of the mRNA splicing involves intron 5, as is to be expected knowing that only the maturation of long mRNA isoform is modulated.
When these sequences were compared with their published human homologs,
it became apparent that human intron 5 exhibited only one of these
pyrimidine stretches, and the lariat branch point upstream of this
sequence was absent (Fig. 6). Otherwise,
the sizes of introns 5 and 6 are identical in both species (954 and
1474 bp, respectively), and their sequences are strikingly conserved.
Therefore, the differences in the number and type of regulatory
intronic sequences between the rat and the human could be related to
the fact that in the human, the short receptor isoform is generally
found at a higher level than in rat, although here also it is never
predominant (9).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In a previous series of experiments (11), we showed that in male rats T was able to regulate the ratio of the two isoforms of D2 receptor mRNA in vivo, particularly in the olfactory tubercle, where it occurred via estrogen receptors after aromatization of T to estradiol, and in the anterior pituitary gland, where it depended on androgen receptor activation. However, insights into the mechanisms by which these hormones are able to change the amount of the D2 receptor isoforms were difficult to obtain from such experiments. The MMQ cells appeared more suitable because they naturally express a small amount of the D2 receptor and are sensitive to sex steroids. This cell line originates from PRL cells cloned from the 7315a tumor induced by estrogen in a female rat (12). Estrogen receptors are the predominant form of sex steroid receptors in these cells, although transcripts for P and androgen receptors have also been observed. Contrasting with male rats, in which androgen receptors are responsible for hormone action on D2 mRNA splicing, all such effects can be attributed to the intervention of estrogen and P receptors in MMQ cells. The T effect we detected in these cells is probably not physiological and required its prior aromatization to estrogen, as the estrogen receptor antagonist, but not the androgen receptor antagonist, inhibited its effect.
The sex steroid receptor antagonists are compounds that were developed essentially for their antitumorigenic effects. As far as possible we have used compounds devoid of partial agonist activity. Under our experimental conditions, the antiestrogen RU 58668 inhibits the effects of E2 as well as T on D2 mRNA splicing. Interestingly, in hormone-depleted conditions where the D2a/D2b ratio is significantly lower than in the presence of E2, the antiestrogen compound is able to further decrease this ratio to 1. This suggests that either a small amount of E2 is still present in the culture medium despite the charcoal treatment, or that the estrogen receptor is active in the absence of estrogen. In the latter hypothesis, the antiestrogen RU 58668 would be acting as an inverse agonist in this system. The existence of a pool of constitutively active estrogen receptors has also been demonstrated by Tzuckerman et al. (20) by analyzing the activity of an estrogen response element in CV-1 cells. This basal activity could contribute to the predominance of the long D2 receptor isoform found in MMQ cells.
The strong antagonistic effect of P on E2 action is another functionally relevant observation made in our experiments. This blocking effect could be due to either the antagonism of estrogen receptor activity by P receptor or the strong inhibition of the estrogen receptor expression by P. We showed by PCR and Western blotting that none of the sex steroid treatments affected the amount of each steroid receptor transcript, including those of estrogen receptors. Therefore, the effect of P did not depend on the decrease in estrogen receptor expression. P, however, did act via its receptors, as the antiprogestin drug RU 486 blocked this effect when P was present in association with E2. In addition, as P completely blocked estradiol receptor activation, the antiestrogen compound was not able to modify the effect of E2 plus P. Such an antagonistic effect of the progestin receptor on estrogen receptor activity has also been demonstrated in 3T3 cells and depended on the direct transcription inhibition exerted by progestin receptors on an estrogen-responsive promoter (21). Whether the effect of P to inhibit the splicing of the long isoform depends on the direct interaction of the P receptor with the estradiol receptor via cis-acting regulatory elements will await identification of the corresponding splicing factors.
Different blockers of gene transcription and translation (respectively,
-amanitin, actinomycin D, and cycloheximide) were used to confirm
that the actions of steroid receptors on D2 receptor mRNA
splicing involved protein synthesis. Translation and transcription
inhibitors produced exactly the same effects, indicating that
transcription is probably the limiting step of steroid action. Two
important observations resulted from the use of gene expression
inhibitors. Firstly, they completely blocked the splicing
modulation induced by E2 and T, but they did
not modify the inhibitory effect of P on E2
treatment. This confirmed that P inhibition was probably maximal with
regard to D2 mRNA splicing regulation, and that this effect
probably involved modulation of the transcription of a splicing
regulatory factor. Secondly, and supporting this latter hypothesis,
gene expression inhibitors all tended to produce a
D2a/D2b ratio close to 1, indicating that when
a given splicing factor was not transcribed, the splicing mechanism of
the D2 receptor mRNA produces equal amounts of each of the
two mRNA isoforms. In addition, both mRNA isoforms were present in each
D2 receptor-expressing cell (with a ratio always higher
than or equal to 1), as shown by single cell PCR. The most parsimonious
conclusion that can be drawn from these data is that the default
mechanism of the D2 receptor mRNA splicing (in the absence
of newly transcribed splicing factors) gives equal chance to maturation
of the two mRNA isoforms and that the effect of sex steroid receptor
activation will be to either favor (estrogen and androgen receptors) or
inhibit (P receptor) the splicing mechanism by means of transcriptional
regulation of a regulatory factor.
The alternative splicing of the D2 receptor pre-mRNA can be assimilated to a choice among the splice sites located upstream or downstream from exon 6. When the upstream site is chosen, the long isoform of the D2 receptor mRNA is obtained (provided that intron 6 is also removed), whereas the choice of the downstream site skips exon 6 and leads to the short isoform. Therefore, based on our results, the role of the splicing factor regulated by sex steroids will be to favor the choice of the first splice site over the other. In agreement with this statement, we observed that only intron 5 (the intron upstream exon 6) exhibits cis-regulatory sequences able to be used for such a regulated mechanism. Two polypyrimidine stretches are found near the 3'-splice site of intron 5 in the rat and only one is present in the human. Such sequences have been shown to bind different splicing-modulating proteins when they are located close to the lariat branch point (the consensus sequence of which is UNYURAY) or nearby the 3'-splice site (the consensus sequence of which is YnNYAG/G). These proteins will either block the lariat formation or will impair accessibility of the 3'-splice site, therefore favoring one splice site over the other (for reviews, see Refs. 22, 23, 24). As the short isoform is more highly expressed in the human than in the rat (the long isoform still being predominant) (9), the absence of one of the lariat branch points upstream from the polypyrimidine tract of intron 5 could be the reason for the higher expression of the short isoform in the human.
Regulation of the selection of intron splice sites implicates factors such as the U1 small ribonucleoprotein particles, which pairs via its RNA components to the 5'-splice site; the U2AF factor, which binds to polypyrimidine stretches at the 3'-splice site (25); and the SR proteins. Members of the SR protein family have been shown to regulate splice site selection and could be among the factors implicated in the hormone-induced splicing regulation (26, 27, 28), although their target sequences are not yet fully identified (28, 29, 30).
To summarize, it can now be postulated that in MMQ cells, as previously observed in vivo, modulation of D2 mRNA splicing by sex steroid hormones depends on nuclear receptor activation that, in turn, regulates the expression of one or more splicing factors that bind to the polypyrimidine stretch of the D2 receptor pre-mRNA. Whether splicing regulation depends on stimulation or inhibition of splicing factor expression is unknown. However, conclusive evidence now shows that estrogen receptor activation facilitates the retention of exon 6 and produces the long isoform. In contrast, progestin receptor antagonizes the effect of estrogen receptor on the expression of splicing factors. In this case as well as when gene expression inhibitors are used, the choice of the splice site upstream from exon 6 is not favored, and the spliceosome equally produces each of the two mRNA isoforms.
Alternative splicing modifies the expression program of a large number of genes, and generally, this phenomenon generates different protein products with clearly separable functions (31). In the case of the D2 receptor, the situation has not been so clear to date. The splicing of the D2 receptor was proposed to change the efficiency or affinity of receptor coupling to G proteins. Accordingly, Guiramand et al. (32) showed that the long isoform of the D2 receptor is preferentially able to activate Gi2 protein, whereas the short isoform could be more efficient for G protein activation in cells that do not express Gi2 (33). However, in MMQ cells, the significant modulations of D2 receptor splicing promoted by sex steroid hormones were not accompanied by detectable changes in receptor-induced inhibition of adenylyl cyclase. Obviously, this functional parameter does not recapitulate all the effects that dopamine D2 receptors can elicit in MMQ PRL cells. More importantly, the very low levels of D2 receptors and coupled G proteins that are detected in MMQ cells (13) do not allow easy detection of functional changes depending on D2 receptor splicing in this cell model.
Although this question remains to be more properly addressed, the regulation of D2 receptor mRNA splicing provides a mechanism of cross-talk between steroids and dopamine receptors. In cell systems such as PRL cells or olfactory regions of the brain, these interactions are clearly physiologically relevant. They should operate with changes in hormonal status that occur periodically in the animal’s life, when circulating hormones modulate dopamine transmission in neuronal and endocrine cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received March 12, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-, ß2-adrenergic receptors:
delineation of domains involved in effector coupling and ligand
binding specificity. Science 240:1310–1316This article has been cited by other articles:
 |
|
 |
|
  L. V. Neto, E. d. O. Machado, R. M. Luque, G. F. Taboada, J. B. Marcondes, L. M. C. Chimelli, L. P. Quintella, P. Niemeyer Jr., D. P. de Carvalho, R. D. Kineman, et al. Expression Analysis of Dopamine Receptor Subtypes in Normal Human Pituitaries, Nonfunctioning Pituitary Adenomas and Somatotropinomas, and the Association between Dopamine and Somatostatin Receptors with Clinical Response to Octreotide-LAR in Acromegaly J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 1931 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Gillam, M. E. Molitch, G. Lombardi, and A. Colao Advances in the Treatment of Prolactinomas Endocr. Rev., August 1, 2006; 27(5): 485 - 534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Ben-Jonathan Dopamine and Transforming Growth Factor-{beta}1: An Odd Couple in Growth Inhibition of the Lactotrophs Endocrinology, October 1, 2005; 146(10): 4177 - 4178. [Full Text] [PDF]
|
|
|
|
 |
|
 H. Zhou, Y. Jiang, W. K W Ko, W. Li, and A. O L Wong Paracrine regulation of growth hormone gene expression by gonadotrophin release in grass carp pituitary cells: functional implications, molecular mechanisms and signal transduction J. Mol. Endocrinol., April 1, 2005; 34(2): 415 - 432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Y. Gevry, F. L. Lopes, S. Ledoux, and B. D. Murphy Aberrant Intracellular Cholesterol Transport Disrupts Pituitary and Ovarian Function Mol. Endocrinol., July 1, 2004; 18(7): 1778 - 1786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Gregory, J. Townsend, A. S. McNeilly, and D. J. Tortonese Effects of Prolactin on the Luteinizing Hormone Response to Gonadotropin- Releasing Hormone in Primary Pituitary Cell Cultures During the Ovine Annual Reproductive Cycle Biol Reprod, May 1, 2004; 70(5): 1299 - 1305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Iaccarino, T. A. Samad, C. Mathis, H. Kercret, R. Picetti, and E. Borrelli Control of lactotrop proliferation by dopamine: Essential role of signaling through D2 receptors and ERKs PNAS, October 29, 2002; 99(22): 14530 - 14535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fiorentini, N. Guerra, M. Facchetti, A. Finardi, L. Tiberio, L. Schiaffonati, P. Spano, and C. Missale Nerve Growth Factor Regulates Dopamine D2 Receptor Expression in Prolactinoma Cell Lines via p75NGFR-Mediated Activation of Nuclear Factor-{kappa}B Mol. Endocrinol., February 1, 2002; 16(2): 353 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ben-Jonathan and R. Hnasko Dopamine as a Prolactin (PRL) Inhibitor Endocr. Rev., December 1, 2001; 22(6): 724 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Prou, W.-J. Gu, S. Le Crom, J.-D. Vincent, J. Salamero, and P. Vernier Intracellular retention of the two isoforms of the D2 dopamine receptor promotes endoplasmic reticulum disruption J. Cell Sci., January 10, 2001; 114(19): 3517 - 3527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Freeman, B. Kanyicska, A. Lerant, and G. Nagy Prolactin: Structure, Function, and Regulation of Secretion Physiol Rev, October 1, 2000; 80(4): 1523 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Pasqualini, D. Guivarc’h, Y. v. Boxberg, F. Nothias, J.-D. Vincent, and P. Vernier Stage- and Region-Specific Expression of Estrogen Receptor {alpha} Isoforms during Ontogeny of the Pituitary Gland Endocrinology, June 1, 1999; 140(6): 2781 - 2789. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Hofmann, C. L. Lorson, S. Stamm, E. J. Androphy, and B. Wirth Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2) PNAS, August 15, 2000; 97(17): 9618 - 9623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. J. Davis, M. Gupta, S. M. Pogwizd, E. Bacha, V. Jeevanandam, and M. P. Gupta Increased expression of alternatively spliced dominant-negative isoform of SRF in human failing hearts Am J Physiol Heart Circ Physiol, April 1, 2002; 282(4): H1521 - H1533. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
, N medium; 
, O or hormone-depleted serum condition;
, E2 at 10-8 M in O medium;
, E2 and P at 10-8 M in O
medium; *, T at 10-8 M in O medium. Values
significantly different from the basal condition are indicated by
asterisks (**, P < 0.01; *,
P < 0.05). Steady state values for the
D2a/D2b ratio were reached after 48 h.
