| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Endocrinology and Reproduction, Faculty of Medicine and Health Sciences, Erasmus University Rotterdam, 3000 DR Rotterdam, The Netherlands
Address all correspondence and requests for reprints to: J. A. Visser, Department of Endocrinology and Reproduction, Faculty of Medicine and Health Sciences, Erasmus University Rotterdam, P.O. Box 1738, 3000 DR Rotterdam, The Netherlands. E-mail: visser{at}endov.fgg.eur.nl
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
It was observed that Müllerian duct regression was incomplete at E19 (19 days post coitum), upon DES administration during pregnancy from E9 through E16. Furthermore, analysis of earlier time points of fetal development revealed that the DES treatment had clearly delayed the onset of Müllerian duct formation by approximately 2 days; in untreated fetuses, Müllerian duct formation was complete by E13, whereas fully formed Müllerian ducts were not observed in DES-treated male fetuses until E15.
Using in situ hybridization, no change in the localization of AMH and AMHRII mRNA expression was observed in DES-exposed male fetuses. The mRNA expression was quantified using ribonuclease protection assay, showing an increased expression level of AMH and AMHRII mRNAs at E13 in DES-exposed male fetuses. Furthermore, the mRNA expression levels of Hoxa 11 and steroidogenic factor-1 (SF-1) were determined as a marker for fetal development. Prenatal DES exposure had no effect on Hoxa 11 mRNA expression, indicating that DES did not exert an overall effect on the rate of fetal development. In DES-exposed male fetuses, SF-1 showed a similar increase in mRNA expression as AMH, in agreement with the observations that the AMH gene promoter requires an intact SF-1 DNA binding site for time- and cell-specific expression, although an effect of DES on SF-1 expression in other tissues, such as the adrenal and pituitary gland, cannot be excluded. However, the increased expression levels of AMH and AMHRII mRNAs do not directly explain the decreased sensitivity of the Müllerian ducts to AMH. Therefore, it is concluded that prenatal DES exposure of male mice delays the onset of Müllerian duct development, which may result in an asynchrony in the timing of Müllerian duct formation, with respect to the critical period of Müllerian duct regression, leading to persistence of Müllerian duct remnants in male mice.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The cellular and molecular mechanisms by which AMH induces Müllerian duct regression are poorly understood. However, the identification and cloning of the AMH type II receptor (AMHRII) has contributed to the elucidation of this question (6, 7). AMHRII messenger RNA (mRNA) is expressed in the fetal gonads and in the mesenchymal cells located adjacent to the Müllerian duct epithelium, which corresponds to the sites of action of AMH (6, 7). Recent results have shown that AMH elicits its effect on the Müllerian duct epithelium via the surrounding mesenchymal cells, a process which may also involve induction of programmed cell death (4, 8).
AMHRII is a member of the transmembrane serine/threonine kinase receptor family, to which also the TGFß and activin receptors belong (9). Members of the TGFß superfamily exert their action through a heteromeric signaling complex consisting of a type I and a type II receptor (10). Failure in AMH action, as a result of a gene mutation leading to either inactive AMH or AMHRII, causes inhibition of Müllerian duct regression, resulting in a rare form of pseudohermaphroditism in man known as persistent Müllerian duct syndrome (11, 12). Gene knockout experiments in mice have confirmed that, in the absence of AMH or AMHRII, Müllerian ducts do not regress (13, 14).
In chickens, unilateral regression of Müllerian ducts occurs in the female. The left Müllerian duct is retained, whereas the right Müllerian duct regresses, because of the fact that, in contrast to mammalian species, AMH is also expressed by the fetal ovary (15). It has been suggested that estrogens protect the left duct from regression. This is supported by the observation that the concentration of estrogen receptor in the left duct is higher than that in the right duct (16). Furthermore, inhibition of estrogen production in female chick fetuses, by treatment with an aromatase inhibitor during egg incubation, resulted in regression of both ducts (17). Exposure to estrogen during egg incubation prevents Müllerian duct regression in both male and female chick fetuses (18, 19).
Although it is a large step from chicken to human, it is of interest to compare the data from the experiments with chickens with clinical data. In humans, intrauterine exposure to diethylstilbestrol (DES), a potent synthetic estrogen that has been administrated during pregnancy to prevent miscarriages, has led to an increased incidence of reproductive tract abnormalities. The effects of prenatal DES exposure in so-called DES-daughters, such as an increased risk of genital carcinoma, have been well documented (20). However, also the sons born from DES-controlled pregnancies have an increased incidence of genital tract abnormalities, including epididymal cysts, cryptorchidism, and the presence of Müllerian duct remnants (21, 22). This indicates that DES has an effect on male sex differentiation. To study the prenatal effects of DES on the developing genital tract in an animal model, McLachlan et al. (23) injected DES daily into pregnant mice during the phase of growth and differentiation of the fetal reproductive tract. Observations on the male offspring of these DES-treated mice indicated that the developing reproductive tract of the fetus is sensitive to DES exposure. Hypoplastic testes and Müllerian duct remnants were found (23, 24). It is, however, not clear how DES mediates its inhibitory effect on reproductive tract differentiation.
In a mouse organ culture system, after in vivo DES treatment, Newbold et al. (25) studied whether the inhibitory effect of DES on Müllerian duct regression results from suppression of fetal testicular AMH production or a change in responsiveness of the Müllerian ducts to AMH. Control Müllerian ducts regressed normally when cultured in the presence of control testes, whereas DES-exposed Müllerian ducts in the presence of DES-exposed testes did not regress. Combination of control Müllerian ducts and DES-exposed testes resulted in normal regression. However, in the reciprocal combination, DES-exposed ducts and control testes, only partial regression of the Müllerian ducts was observed. These results indicate that DES-exposed testes still produce bioactive AMH and that the effect of DES is caused mainly by a decrease in AMH responsiveness of the Müllerian ducts.
We hypothesized that the change in sensitivity of the Müllerian ducts to AMH may result from an effect of DES on the expression of AMHRII. In this paper, we describe the effects of DES exposure of mouse male fetuses on the Müllerian ducts; in particular, AMH and AMHRII mRNA expression during the period of reproductive tract differentiation. As a control for possible effects of DES exposure on general fetal development (26, 27), the expression of Hoxa 11 mRNA was measured. The mRNA expression level for steroidogenic factor-1 (SF-1) mRNA, an orphan nuclear receptor essential for the development of steroidogenic tissues (28), was measured as a control for possible effects of DES exposure on urogenital ridge development. The results of this study may contribute to our knowledge about the possible involvement of exposure to exogenous estrogenic compounds in the postulated increased incidence of reproductive tract disorders in wild-life and perhaps also in humans (29, 30).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In situ hybridization
A PstI fragment containing bp 1243–1640 of the rat
AMHRII complementary DNA (cDNA) and an NheI fragment
containing bp 38–400 of the rat AMH cDNA were subcloned in pBluescript
KS (Stratagene, Westburg, Leusden, The Netherlands) and used to
generate sense and antisense [35S]-uridine
5'-triphosphate (UTP)-labeled (Amersham, ‘s Hertogenbosch, The
Netherlands) transcripts in vitro. In situ
hybridization was performed as described by Zeller and Rogers (35),
with some modifications (6). Sections were mounted on slides that were
coated with 3-aminopropyl-ethoxysaline. After deparaffinization,
sections were treated with 0.2 M HCl (20 min),
treated with proteinase K (1 µg/ml in 0.2 M Tris (pH
7.5), 2 mM CaCl2; incubation for 15 min at 37
C), and postfixed in 4% paraformaldehyde in 0.1 M PBS.
After treatment with dithiothreitol and blocking of nonspecific binding
with 0.1 M triethanolamine, followed by 0.1 M
triethanolamine and acetic anhydride, sections were incubated with
[35S]-UTP-labeled antisense and sense AMH and AMHRII RNA
probes at a final concentration of 5 x 105 cpm/µl.
Hybridization was carried out as described previously (6). Sections
were exposed at 4 C for 1 week, developed, counterstained with
hematoxylin, and mounted.
Ribonuclease (RNase) protection assay
A mouse AMHRII DNA template for in vitro
transcription was generated by RT-PCR. The RT-PCR reaction was carried
out on 100–200 ng total RNA, extracted from 25-day-old mouse testis,
using random hexamers. A sample of the RT reaction product was used in
the PCR reaction using the primers 5'GCTCCGGAGCTCTTGGACAAG3' (forward
primer) and 5'CAGGCGCTGCTGCACACACTC3' (reverse primer) corresponding to
kinase subdomains VIII, IX, and X of the AMHRII gene
transcript. A 350-bp PCR product was subcloned in pBluescript KS and
used to generate [32P]-UTP-labeled antisense probe. The
AMH RNA probe was obtained using a 430-bp PstI fragment,
containing exon 1, of mouse genomic DNA. The SF-1 RNA probe was
obtained using a 252-bp HindIII-EcoRI fragment of
mouse SF-1 cDNA (36). The Hoxa 11 RNA probe was obtained using a 300-bp
BamHI-BglII fragment of the mouse Hoxa 11 cDNA
(26). The control glyceraldehyde 3-phosphate dehydrogenase (GAPD) RNA
probe was synthesized using a construct containing a 163-bp
AccI-Sau3AI fragment of the rat GAPD cDNA. RNase
protection assays of 50 µg total fetal RNA with these probes were
performed as described by Baarends et al. (6). GAPD was used
as a control for RNA loading. The relative amount of protected mRNA
band was quantified through exposure of the gels to a phosphor screen
(Molecular Dynamics, B and L Systems, Zoetermeer, The Netherlands),
followed by a calculation of the relative density of the obtained bands
using a phospho-imager and Image Quant (Molecular Dynamics) as computer
analysis software. The arbitrary units are expressed as the rations
after division by the corresponding GAPD values.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, 2, and 3).
Position I indicates the most cranial part of the ducts, at the level
of the fetal testes. Position II is at the level where the
Müllerian and Wolffian ducts cross each other. Position III
indicates the caudal part of the Müllerian ducts, near the
urogenital sinus.
|
|
|
, A–D).
In DES-exposed E13 fetuses, on the other hand, Müllerian ducts
were only found at position I (Fig. 1F). Caudally, at positions II and
III, the Müllerian ducts were not formed, indicating a delay in
their formation caused by the DES treatment (Fig. 1I, position
III).
At E15, differences in Müllerian duct regression between control
and DES-exposed fetuses were observed. In E15 control fetuses,
regression of the Müllerian ducts had started but was not
complete (Fig. 2, A–D). The regression of the Müllerian ducts
was initiated cranially at position I, and concomitantly, we observed
the characteristic presence of a whorl of mesenchymal cells surrounding
the Müllerian ducts (Fig. 2A). No signs of Müllerian duct
regression could be detected at positions II and III at E15, indicating
that degeneration of the Müllerian ducts is initiated cranially
and then progresses caudally (Fig. 2D). In contrast, regression of the
Müllerian ducts in the DES-exposed E15 fetuses was not initiated
at all three positions, as indicated by the absence of the typical
whorl of mesenchymal cells (Fig. 2, F–I). The appearance of the
Müllerian ducts in DES-exposed fetuses at E15 corresponds to that
of the Müllerian ducts in control fetuses at E13, implicating
that the onset of Müllerian duct regression is delayed by
approximately 2 days.
It was observed that regression of the Müllerian ducts in control
male fetuses resulted in their complete absence at E19 (Fig. 3A). In
the DES-exposed male fetuses at E19, regression of the cranial part of
the Müllerian ducts was complete at positions I and II, because
no Müllerian structures could be detected (results not shown).
However, more caudally, at position III, the Müllerian ducts were
still present (Fig. 3B). The epithelial and mesenchymal cells of the
Müllerian duct remnants, in DES-exposed male fetuses at E19 (Fig. 3B), were differentiated and had an appearance comparable with that
found in control female fetuses of the same developmental stage
(results not shown).
These results are schematically summarized in the top panelsof Figs. 1, 2, and 3.
Expression of AMH and AMHRII mRNAs
The expression of AMH and AMHRII mRNAs was studied by in
situ hybridization. AMH mRNA expression was localized in the
gonads of DES-exposed male fetuses, similar to control fetuses,
although differences in the quantitative level of expression were
detected. The testes of DES-exposed fetuses at E13 showed a marked
increase in AMH mRNA expression, compared with control testes (Fig. 1, C–H). This increase in AMH mRNA expression was also present on E15
(Fig. 2, C–H), whereas testicular expression of AMH mRNA could hardly
be detected in both control and DES-exposed E19 fetuses (results not
shown).
AMHRII mRNA expression was also studied at the three positions
indicated in Fig. 1. Expression of AMHRII mRNA in DES-exposed fetuses
was found in the same tissues as in control fetuses, the fetal gonads
and the mesenchymal cells surrounding the Müllerian ducts (Fig. 1, B–G). It is important to note that, although the formation of the
Müllerian ducts was not complete by E13 in DES-exposed fetuses,
AMHRII mRNA was already expressed. More caudally, at positions II and
III, the Müllerian ducts were absent in DES-exposed fetuses;
hence, expression of AMHRII mRNA could not be detected at these sites
(Fig. 1J). In control fetuses, AMHRII mRNA was expressed along the
whole axis of the Müllerian ducts, although expression decreased
caudally (Fig. 1B/E).
In control fetuses at E15, expression of AMHRII mRNA could no longer be
detected in the mesenchymal cells surrounding the Müllerian
ducts, at all three positions studied (Fig. 2B/E). The mesenchymal
cells of the cranial Müllerian ducts in DES-exposed E15 fetuses
did still express AMHRII mRNA (Fig. 2G), although the expression was
lower, compared with that in E13 DES-exposed fetuses. Caudally, at
position III, expression could not be detected (Fig. 2J). In the testes
of control fetuses, AMHRII mRNA was only weakly expressed, whereas the
testes of DES-exposed fetuses at E15 still showed a clear AMHRII mRNA
expression (Fig. 2B/G). An increase in testicular AMH mRNA expression
in DES-exposed fetuses, compared with control fetuses, was still
observed at E15 (Fig. 2C/H).
At E19, testicular AMHRII mRNA expression was equally low in both control and DES-exposed fetuses. AMHRII mRNA expression in the mesenchymal cells of the Müllerian ducts could not be detected in control and DES-exposed fetuses, although the Müllerian ducts were still present in DES-exposed male fetuses near the urogenital sinus (results not shown).
Expression levels of AMH and AMHRII mRNAs were quantified more
precisely using an RNase protection assay (Fig. 4A). Furthermore, the expression of SF-1
mRNA was included as a marker for urogenital ridge development. The
results of the RNase protection showed that the expression patterns of
AMH and AMHRII mRNAs mimic the expression pattern of SF-1 mRNA (Fig. 4B). In DES-exposed male fetuses at E13 the expression of SF-1 mRNA is
strongly increased, compared with control fetuses. A similar increase
in AMH mRNA expression was measured in DES-exposed male fetuses, as was
observed with in situ hybridization. An increase of AMHRII
mRNA expression was found, using RNase protection assay in DES-exposed
fetuses at E13, although this increase was less evident, compared with
AMH and SF-1 mRNAs expression. At E14 and E15, DES-exposed fetuses
showed a higher expression of SF-1, AMH, and AMHRII mRNAs than control
fetuses, although less pronounced than at E13. From E15 onwards,
changes in mRNA expression of SF-1, AMH, and AMHRII were limited to a
slight increase at E19.
|
), indicating similar rates of general fetal
development in the two treatment groups. Furthermore, no differences in
length, width, or digit differentiation were observed between control
and DES-treated fetuses during fetal development (results not
shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In addition to the appearance of Müllerian duct remnants, we
observed that DES exposure resulted in a delay in Müllerian duct
formation of approximately 2 days. In control fetuses, the complete
Müllerian ducts were present at E13, whereas in DES-exposed
fetuses fully formed Müllerian ducts were not found before E15.
In addition, DES-exposed fetuses were born 1 day later, compared with
control fetuses. These observations suggest that DES causes a delay in
general embryonic development. Also, in rats, exposure to estrogens
during pregnancy leads to a prolonged gestation (38), but this is
explained by an inhibiting effect of DES on the onset of uterine
contraction. Cesarean sections, performed to rescue the litter,
revealed no difference in size of fetuses from control and DES-treated
mothers (38). Transgenic mice, overexpressing the estrogen receptor 
(ER), have similar problems with birth, with gestation lengths
prolonged up to 4 days (39). Exposure to DES in neonatal mice results
in an increase of ER mRNA expression in uterine cells (40),
suggesting that the longer gestation time in DES-exposed mice may be a
phenocopy of the change in pregnancy in ER transgenic mice, and this
reflects a maternal effect rather than a delay in fetal development. No
differences in body size or digit differentiation were observed between
control and DES-treated fetuses during fetal development (results not
shown). Furthermore, the expression of Hoxa 11 mRNA was studied as a
marker for general fetal development (26, 27). Hoxa 11 mRNA is
expressed in the limbs, in the kidneys, and in the stromal cells
surrounding the Müllerian and Wolffian ducts, and this expression
is detected at E10 several days before reproductive tract
differentiation (26). In the present study, no difference in Hoxa 11
mRNA expression between control and DES-exposed fetuses was observed,
at all embryonic stages studied. This indicates that the rate of
general fetal development is not affected but that DES elicits a
specific effect on reproductive tract development. The variation in the
results with the Hoxa 11 probe is caused by the large differences in
specific activity of the probe in different experiments.
The anlagen of the reproductive tract, the Wolffian and Müllerian
ducts, are formed separately. The Wolffian duct is formed as an
excretory duct of the mesonephros and is recognizable before the gonads
are formed. At the time of gonad formation, the Müllerian ducts
develop in a cranial-to-caudal direction along the Wolffian ducts,
which function as a guiding structure for early growth of the
Müllerian ducts (Ref. 41 , and references therein). The genes
involved in Müllerian duct formation have not been identified
yet. It has been suggested that the Wolffian ducts release epithelial
cells, which contribute to the developing Müllerian ducts (42).
It has also been suggested that the growth of Müllerian ducts is
autonomous (43). In our studies, DES treatment affects the formation of
the Müllerian ducts rather than formation of the Wolffian ducts,
because DES was administered after completion of Wolffian duct
formation. However, an effect of estrogens on Wolffian duct formation
cannot be ruled out. It has been observed that the Wolffian ducts are
affected by exogenous estrogen exposure, resulting in several
abnormalities, such as seminal vesicle tumors and prostate inflammation
(44). Also in female fetuses, the Wolffian ducts are a target for DES
action. Retention of Wolffian ducts, postnatally, was observed in
females, both in humans and in mice (45, 46). These effects of DES on
Wolffian and Müllerian duct differentiation may point to a common
mechanism in the development of these duct systems. Both Wolffian and
Müllerian ducts can respond to estrogens, because the ER is
present in both structures during development (47). The identification
of a novel estrogen receptor, ERß (48), may contribute to our
understanding of the mechanism of DES action. Recently, it was reported
that ER and ERß, when activated by estradiol, signal in opposite
ways from an AP1 site (49). DES, therefore, may cause different
effects, depending on the tissue studied. ERß is highly expressed in
prostate and ovary, whereas ER shows a higher expression in the
uterus (50). Studying the effects of prenatal DES exposure in
ER, ERß, or double-knockout mice,
will reveal which ER type is mainly involved in DES action.
In previous studies, it has been proposed that incomplete regression of
the Müllerian ducts in fetuses exposed to exogenous estrogens is
a result of a change in sensitivity of the ducts to AMH (25).
Therefore, we have studied the effect of DES on AMHRII mRNA expression.
The expression of AMH and AMHRII mRNAs was studied by in
situ hybridization, and the expression levels in total fetuses
were quantified by RNase protection. With in situ
hybridization, a strong increase in AMH mRNA expression in the fetal
testes of DES-exposed fetuses was evident. Quantification of the
expression revealed a 2-fold increase of AMH mRNA expression in
DES-exposed fetuses, compared with controls. This increase was most
significant at E13. Nevertheless, this higher AMH mRNA expression did
not result in complete Müllerian duct regression. This is in
agreement with the observations in in vitro studies that
addition of a relatively high dose of AMH did not result in full
regression of Müllerian ducts from DES-exposed fetuses (Newbold
et al., personal communication). The DES-induced increase in
AMH mRNA expression implies a direct effect of estrogens on the
regulation of AMH mRNA expression. Indeed, a 13-bp palindromic
sequence, nearly identical to the estrogen response element (ERE), has
been identified in the AMH gene promoter (51). In
footprinting experiments, this site was shown to bind ER.
Furthermore, 39 ERE half-sites were identified in the 5' flanking
sequences of the AMH gene (52). Clusters of half-sites or
degenerate palindromic sites can be effective, as was shown in
vitro, where several ERE half-sites can act synergistically to
control expression of the ovalbumin gene (53). However, the
functionality of the ERE half-sites in the AMH gene has not
been proven. Recent papers have shown that AMH expression is dependent
on SF-1 (54, 55). SF-1, an orphan nuclear receptor expressed in
adrenals, gonads, and the gonadotrophes of the pituitary gland, was
characterized as a transcription factor that regulates several genes,
such as genes encoding steroidogenic enzymes (36). SF-1
knockout mice lack gonads and adrenals, revealing an essential role for
SF-1 in sexual differentiation and formation of primary steroidogenic
tissues (28). In in vivo experiments, it was demonstrated
that the proximal AMH gene promoter requires an intact
binding site for SF-1 for time- and cell-specific expression (55). We
observed a strong increase in SF-1 mRNA expression in DES-exposed
fetuses, which was most significant at E13 and decreased toward E17.
The increased expression of AMH mRNA in DES-exposed mice was found to
have a similar temporal pattern as the SF-1 mRNA expression,
corresponding with the role of SF-1 in regulation of AMH gene
expression. These data suggest that DES has an effect on fetal gonadal
gene expression. An effect of prenatal exposure to estrogenic compounds
on SF-1 mRNA expression has been reported previously, although the
described effect is a down-regulation of SF-1 mRNA expression (56). In
that study by Majdic et al. (56), DES or the estrogenic
compound 4-octylphenol were injected twice during pregnancy (E11 and
E15), and expression of SF-1 mRNA was measured in the fetal testis at
E17 (56). The disagreement between their and our results may be
explained by the animal model, the experimental procedure, and the time
points at which expression was determined.
In the present study, expression of AMHRII mRNA was also found to be increased at E13 in DES fetuses, although this increase was less obvious and could not be detected by in situ hybridization. In in vitro studies, no direct regulation of the AMHRII promoter by estrogens was found (Visser et al., unpublished results). Therefore, it is likely that DES influences AMHRII mRNA expression indirectly. In the DNA sequence of both the human and mouse AMHRII gene promoter, a SF-1 response element was identified (Ref. 12 , and results not shown). Although regulation of AMHRII mRNA expression by SF-1 has not been reported, the increased AMHRII mRNA expression in DES-exposed fetuses might be a consequence of an increased SF-1 level. In accordance with developmental changes in SF-1 and AMH mRNA expression, the most pronounced increase in AMHRII mRNA expression was found at E13, and this increase becomes less evident in older fetuses.
The increased mRNA expression levels of AMH and AMHRII do not directly explain the decreased sensitivity of the Müllerian ducts to AMH. However, a DES-induced effect on factors downstream of AMHRII, such as a type I receptor or Smad proteins, cannot be excluded. One can hypothesize that a DES-induced inhibition of downstream signaling factors influences a negative feedback loop, resulting in an increased expression of AMH and AMHRII mRNA, although the existence of such a feedback system for AMH has not been reported yet. Furthermore, whether the increase mRNA expression levels result in higher protein levels remains to be studied.
The in situ hybridization demonstrated that AMHRII mRNA expression can be detected along the entire axis of the Müllerian ducts in control fetuses at E13, but it decreases in caudal direction toward the urogenital sinus. At E15, expression of AMHRII mRNA could not be detected in the regressed cranial part of the Müllerian ducts. However, also in the caudal part of the Müllerian ducts, AMHRII mRNA expression could hardly be detected. These observations suggest that the onset of the critical period for AMH sensitivity of the Müllerian ducts (E13) is at the time point when Müllerian ducts are completed and express the AMHRII, whereas the end of this critical period (E15) is demarcated by disappearance of the receptor. In DES-exposed fetuses at E13, AMHRII mRNA expression was found in the cranial part of the Müllerian ducts. The caudal parts have not been formed, and expression could not be detected at this site, suggesting that AMHRII mRNA expression is dependent on the presence of a formed Müllerian duct. At E15, a time point at which the Müllerian ducts have completely formed in the DES-exposed fetuses, AMHRII mRNA expression was detectable in the cranial ducts, although expression was much lower, compared with E13. Caudally, expression could hardly be detected, comparable with expression in control E15 fetuses. In DES-exposed mice just before birth (E19), the Müllerian duct remnants had lost expression of AMHRII mRNA and, therefore, are unable to respond to AMH at this late developmental time point. Although the formation of the Müllerian ducts is delayed in DES-treated fetuses, the timing of AMHRII mRNA expression is not delayed. This probably leads to a temporal asynchrony between the presence of the Müllerian ducts and the onset of the critical period of Müllerian duct regression.
The present observation on the DES-induced delay in Müllerian duct formation contributes to our understanding of the diversity of developmental defects in affected DES-sons. In humans, exposure of mothers to DES during early pregnancy results in a 2-fold increase in the prevalence of malformations in their sons (57). The formation of the Müllerian ducts is completed before the 11th week of gestation, and Müllerian duct regression is initiated at the 11th week. Exposure to DES after this period results in less abnormalities, whereas exposure before the 11th week results in a higher incidence of Müllerian duct remnants in the DES-sons (57). This is in concordance with the present observations in mice, and we suggest that, also in humans, administration of DES during early pregnancy causes an asynchrony between Müllerian duct formation and the critical period of Müllerian duct regression.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received January 23, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  Y. Ikeda, H. Tanaka, and M. Esaki Effects of Gestational Diethylstilbestrol Treatment on Male and Female Gonads during Early Embryonic Development Endocrinology, August 1, 2008; 149(8): 3970 - 3979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wijgerde, M. Ooms, J. W. Hoogerbrugge, and J. A. Grootegoed Hedgehog Signaling in Mouse Ovary: Indian Hedgehog and Desert Hedgehog from Granulosa Cells Induce Target Gene Expression in Developing Theca Cells Endocrinology, August 1, 2005; 146(8): 3558 - 3566. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Fielden, R. G. Halgren, C. J. Fong, C. Staub, L. Johnson, K. Chou, and T. R. Zacharewski Gestational and Lactational Exposure of Male Mice to Diethylstilbestrol Causes Long-Term Effects on the Testis, Sperm Fertilizing Ability in Vitro, and Testicular Gene Expression Endocrinology, August 1, 2002; 143(8): 3044 - 3059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. L. Durlinger, M. J. G. Gruijters, P. Kramer, B. Karels, H. A. Ingraham, M. W. Nachtigal, J. Th. J. Uilenbroek, J. A. Grootegoed, and A. P. N. Themmen Anti-Mullerian Hormone Inhibits Initiation of Primordial Follicle Growth in the Mouse Ovary Endocrinology, March 1, 2002; 143(3): 1076 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. McLachlan Environmental Signaling: What Embryos and Evolution Teach Us About Endocrine Disrupting Chemicals Endocr. Rev., June 1, 2001; 22(3): 319 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Visser, R. Olaso, M. Verhoef-Post, P. Kramer, A. P. N. Themmen, and H. A. Ingraham The Serine/Threonine Transmembrane Receptor ALK2 Mediates Mullerian Inhibiting Substance Signaling Mol. Endocrinol., June 1, 2001; 15(6): 936 - 945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. T. MacLaughlin, J. Teixeira, and P. K. Donahoe Perspective: Reproductive Tract Development--New Discoveries and Future Directions Endocrinology, June 1, 2001; 142(6): 2167 - 2172. [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Couse, S. C. Hewitt, D. O. Bunch, M. Sar, V. R. Walker, B. J. Davis, and K. S. Korach Postnatal Sex Reversal of the Ovaries in Mice Lacking Estrogen Receptors and Science, December 17, 1999; 286(5448): 2328 - 2331. [Abstract] [Full Text]
|
|
|
|
 |
|
 E. Rajpert-De Meyts, N. Jorgensen, N. Gram, J. Muller, R. L. Cate, and N. E. Skakkebak Expression of Anti-Mullerian Hormone during Normal and Pathological Gonadal Development: Association with Differentiation of Sertoli and Granulosa Cells J. Clin. Endocrinol. Metab., October 1, 1999; 84(10): 3836 - 3844. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
