| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Departments of Obstetrics and Gynecology (T.W.S., M.P.M.) and Biochemistry and Molecular Biology (T.W.S., M.P.M.), University of South Florida College of Medicine, Tampa, Florida 33606; and Department of Physiology and Biophysics (D.B.H., K.H.H.), University of Illinois at Chicago, Chicago, Illinois 60612
Address all correspondence and requests for reprints to: Dr. Mark P. McLean, Departments of Obstetrics and Gynecology, 4 Columbia Drive, Room 529 Tampa, Florida 33606.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Using mouse MA-10 Leydig tumor cells, Stocco and colleagues (6, 7, 8, 9, 10) have described a series of mitochondrial proteins at 37 kDa, 32 kDa, and 30 kDa that are synthesized in response to luteinizing hormone (LH), human CG (hCG), or with the cAMP analog, dibutyryl cAMP (dbcAMP) (11). Stocco and Sodeman (10) and Epstein and Orme-Johnson (12) have postulated that during the processing of the 37 kDa mitochondrial protein to the 32 and 30 kDa forms, cholesterol may be transferred from the outer to the inner mitochondrial membrane. Clark et al. (13) isolated, cloned, and sequenced the 30 kDa LH-induced mitochondrial protein from mouse MA-10 Leydig tumor cells and have referred to this protein as the steroidogenic acute regulatory protein or StAR. StAR has been shown to enhance the mitochondrial conversion of cholesterol into pregnenolone in COS-1 cells when cotransfected with vectors encoding P450scc and adrenodoxin (13, 14, 15). The strongest evidence that StAR is required for steroidogenesis was demonstrated by sequencing the StAR genes of individuals with congenital lipoid adrenal hyperplasia (lipoid CAH), an autosomal recessive disorder characterized by impaired synthesis of all adrenal and gonadal steroid hormones. This study demonstrated that the StAR gene in these individuals encoded either a truncated or nonfunctional StAR protein (14), thus supporting the indispensable role that StAR plays in normal adrenal and gonadal steroidogenesis.
Early studies demonstrated an absolute requirement for the synthesis of new proteins for the steroidogenic response to acute hormone stimulation (16), as well as a requirement for phosphorylation of a threonine residue (17); however, the role of transcription in steroidogenesis in response to hormone stimulation required further study. Ferguson and Morita (18) first demonstrated that adrenocorticoid synthesis in rat adrenal quarters was unaffected by treatment with the RNA synthesis inhibitor actinomycin D. Similar findings were reported by Garren et al. (16), which demonstrated that inhibition of de novo transcription using actinomycin D had no effect on the acute stimulation of steroid production in the adrenal gland. Studies by Vernikos-Danellis and Hall (19), however, demonstrated that while actinomycin D had essentially no effect on ACTH-stimulated adrenocorticosterone production after 30 min, steroid production was virtually abolished after 24 h. More recent studies by Clark et al. (20) have demonstrated that hormone-stimulated StAR protein synthesis and progesterone production are inhibited in MA-10 mouse Leydig tumor cells 1 h after actinomycin D administration. The inhibitory effects of actinomycin D on StAR protein synthesis are diminished by pretreatment of the cells with hCG, but continued synthesis persists only in the absence of actinomycin D and the presence of hCG. These results indicate that while the acute stimulation of steroidogenesis may not require new RNA synthesis, transcription of the StAR gene is essential for maintaining steroidogenesis in adrenal and MA-10 Leydig tumor cells.
To further characterize the mechanism by which gonadotropins exert their effects via intracellular cAMP levels, we have determined the sequence of the promoter region for the rat StAR gene and have demonstrated that StAR gene expression is regulated by the steroidogenic tissue-specific transcription factor, steroidogenic factor 1 (SF-1). Our results further demonstrate that SF-1 is responsible for mediating the enhanced transcriptional activation following cAMP administration. SF-1 was first identified as a transcription factor with limited tissue distribution that recognized a conserved regulatory motif in the proximal promoter regions of genes encoding the cytochrome P450 steroid hydroxylases (21, 22, 23). Targeted disruption of the SF-1 gene revealed broader roles for the SF-1 protein, including regulation of the hypothal-amic-pituitary-steroidogenic organ axis (24). SF-1 is also thought to be involved throughout the many stages of reproductive development. In fact, SF-1 has recently been shown to be involved with basal StAR gene transcription in the mouse and human genes (25, 26). Only in the human promoter, however, was cAMP able to augment the transcriptional response. These studies provide the first evidence that the rat StAR gene is regulated by SF-1 at the transcriptional level. These studies also characterize five SF-1 binding sites and their role in regulating the rat StAR gene. Our results demonstrate that both high and low affinity SF-1 motifs are used by SF-1 to mediate rat StAR gene transcription, both at a basal level and in response to stimulation with cAMP.
| Materials and Methods |
|---|
|
|
|---|
32P]-deoxy-CTP (3000 Ci/mmol) and
the Sequenase DNA sequencing kit were obtained from Amersham Corp. (Arlington Heights, IL). BioMax and XAR-5 films were
purchased from Eastman Kodak Co. (Rochester, NY). SeaKem
and SeaPlaque agarose were purchased from the FMC Corporation
(Rockland, ME). All restriction enzymes were obtained from
Boehringer Mannheim (Indianapolis, IN). The Wizard
Miniprep DNA purification systems and the Dual-Luciferase Reporter
Assay System were purchased from Promega Corp. (Madison,
WI). The TA cloning kit was purchased from Invitrogen (San
Diego, CA), and the Sephaglas BandPrep kit, the double-stranded nested
deletion kit, and poly(dI-dC)·poly(dI-dC) were obtained from
Pharmacia Biotech (Piscataway, NJ). Large-scale DNA
purification reagents for transfection studies were obtained from
Qiagen (Valencia, CA). The Quikchange site-directed
mutagenesis kit was purchased from Stratagene (La Jolla,
CA). The 5'-RACE system and cell culture reagents were purchased from
Gibco BRL (Grand Island, NY), and all PCR reagents were
purchased from Perkin Elmer (Branchburg, NJ). Synthetic
oligonucleotides were obtained from Integrated DNA Technologies, Inc.
(Coralville, IA). The SuperSignal ULTRA chemiluminescent substrate was
obtained from Pierce (Rockford, IL). The mouse Y1 adrenal
and human HTB9 cell lines were obtained from ATCC
(Rockville, MD). All other chemicals were reagent grade, and were
obtained from Fisher Scientific International, Inc.
(Norcross, GA) or Sigma Chemical Co.
Luteal cell dispersions
For luteal cell dispersions, 28-day-old female Sprague-Dawley
rats were injected with 8 IU PMSG to induce follicular development and
ovaries were collected 10 days postovulation for dispersion. Ovaries
from 10 animals were collected and dispersed in 5 ml of a solution
containing collagenase (0.45 mg/ml) and 5 ml of a solution containing
DNAse (0.12 mg/ml) and dispase (6.0 mg/ml). Ovaries were incubated in
collagenase-DNAse-dispase solution on a Biostir plate for 30 min
stirring gently. Enzyme solution was removed after 30 min and fresh
enzyme solution was added for an additional 30 min for a total of three
30-min periods. Cells from each of these aliquots were spun down and
resuspended in dispersion media before counting cells by Trypan Blue
exclusion. Cells were then plated out in 6-well plates for further
experiments.
RNA isolation and electrophoresis
RNA was prepared from ovaries using a modification of the
Chomczynski and Sacchi method (27) (TRI-Reagent Method, Molecular Research Center, Inc., Cincinnati, OH). This method
consistently yields 58 µg RNA/mg tissue. Cultured rat luteal cells
were homogenized in 1 ml of TRI-Reagent with a Polytron homogenizer
(Brinkmann Instruments, Inc., Westbury, NY), and RNA was
extracted by the addition of 0.2 ml of chloroform and centrifugation at
12,000 x g for 15 min at 4 C. RNA was precipitated
from the aqueous phase with isopropanol, and the RNA pellet was washed
in 75% ethanol. The RNA pellet was resuspended in Formazol and
quantitated by absorbance at 260 nm in a Beckman Coulter, Inc. DU-70 spectrophotometer (Palo Alto, CA).
For Northern blot analysis, total RNA (20 µg) was denatured at 65 C (15 min) and loaded onto 1% agarose gels containing 3% formaldehyde. Following size fractionation, RNA was blotted onto a nylon membrane (0.45-micron pore size) by capillary transfer and RNA was fixed to the membrane by UV cross-linking (0.3 J/cm2). Ethidium bromide staining of the gel confirmed that the ribosomal RNAs (18S and 28S subunits) were intact, and determined whether equal amounts of RNA were loaded in each lane.
Northern blot analysis
Northern blot hybridizations were performed using the 867-bp rat
StAR cDNA (28). The cDNA inserts were labeled with
[
32P] deoxy-CTP using the random-primed DNA labeling
method. Northern blots were prehybridized at 62 C for at least 3 h
in a 1 M NaCl, 1% SDS solution containing Background
Quencher (Molecular Research Center, Inc.). Hybridization
was completed in a high-efficiency hybridization solution
(Molecular Research Center, Inc.) containing the
32P-labeled probe (1 x 106 dpm/ml;
SA = 2 x 108 dpm/µg DNA) at 62 C for at least
16 h. Blots were washed three times at RT (5 min) in 1 x
SSC/1% SDS and three times at RT (10 min) in 0.1 x SSC/0.1%
SDS. RNA:cDNA hybrids were visualized on BioMax film using two
intensifying screens and a 1248 h exposure period.
SDS-PAGE and electrotransfer
Cultured rat luteal cells were homogenized in 0.5 ml ice-cold
homogenization buffer, as previously described (29). Ovarian
homogenates were assayed for protein concentration by the method of
Bradford (30), using BSA as the standard. Ovarian proteins (50 µg
protein) were denatured at 100 C in loading buffer (29) for 10 min and
subjected to electrophoresis on 7.518% gradient SDS-polyacrylamide
gels according to the method of Laemmli (31). After electrophoresis,
samples were electroblotted onto nitrocellulose (0.2 µm pore) in
buffer containing 0.25 M Tris-base (pH 8.3), and 1.92
M glycine for 16 h at 4 C. To verify equal protein
loading, nitrocellulose sheets were stained with either 0.1% Ponceau S
(in 5% acetic acid) or 0.01% fast green (in 20% methanol and 7%
acetic acid) and destained in the same solution without fast green.
Immunoblotting
Ovarian StAR protein contents were estimated by incubating
transferred proteins in a 20 mM Tris base-buffered (pH 7.5)
sodium chloride (500 mM) solution (TB-NaCl) with 3% milk
and 0.05% Tween-20 for 1 h at RT. Buffer was replaced with
TB-NaCl containing rabbit polyclonal StAR antiserum diluted 1:1000 in
3% milk and incubated at 4 C for 16 h. Nitrocellulose blots were
washed in TB-NaCl containing 0.05% Tween-20 and then incubated in
TB-NaCl containing 3% milk and a 1:10,000 dilution of goat antirabbit
horseradish peroxidase for 1 h at RT. Blots were rinsed and soaked
in Pierces chemiluminescent super signal substrate for 10 min.
Differences in band density on autoradiograms were quantified
densitometrically with a Hoefer scanning densitometer (Hoefer
Instruments, San Francisco, CA) for statistical analysis.
Long-range PCR
The isolation and sequence determination of the rat StAR
promoter was carried out by engineering primers from the rat cDNA
sequence for use in screening multiple adaptor-ligated rat genomic
libraries by PCR. The StAR-specific primers (GSP1-StAR; GSP2-StAR) were
used with adaptor-specific primers to carry out PCRs from five separate
rat genomic libraries. The conditions for PCR were denaturation at 94 C
for 2 sec followed by a 3 min incubation at 72 C for 7 cycles, followed
by 40 cycles of denaturation at 94 C (2 sec) and elongation at 67 C for
3 min. Nested-PCR products were analyzed by 1.2% agarose/EtBr gel
electrophoresis. Nested-PCR yielded genomic DNA fragments of 0.4, 2.7,
and 4.0 kb. From these fragments, approximately 3.0 kb was sequenced
and examined for regulatory motifs using the MacVector program from
Oxford Molecular Group.
5'-Rapid amplification of cDNA ends (5'-RACE)
5'-RACE analysis was performed on StAR messenger RNA (mRNA)
using the 5'-RACE kit from Gibco BRL. One microgram of
ovarian poly A+ RNA was reverse-transcribed using a StAR-specific
primer and reverse transcriptase. The StAR-specific primer (GSP3-StAR)
was made to position 197 to 216 of the complementary strand of the rat
StAR cDNA. GSP3-StAR was used to reverse transcribe mRNA to cDNA. The
RNA was then degraded by the addition of RNase H. The single-stranded
cDNA was then tailed with terminal deoxynucleotide transferase and
dCTP. The tailed cDNA was then used as a template for PCR using
nested-PCR primers, GSP1-StAR (CACAGCTTGATGCCTCAGTCCTTTC) and the
abridged anchor primer (GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG). The
parameters for PCR were denaturation at 95 C for 5 min, followed by 35
cycles of denaturation at 95 C for 1 min, annealing at 55 C for 2 min,
and extension at 72 C for 3 min. The PCR product was then cloned into
the TA vector and sequenced to determine the transcription start
site.
Protein expression and purification
The cDNA for the SF-1 DNA-binding domain was obtained from Keith
L. Parker (University of Texas, Southwestern Medical School, Dallas,
TX) as a fusion protein in the pGEX-1
T vector from
Pharmacia Biotech. The recombinant SF-1 fusion protein was
expressed in BL21s, a protease-deficient bacterial strain, by inducing
expression with the addition of IPTG at a final concentration of 0.1
mM and incubating the bacteria for 4 h at 37 C. After
4 h, the bacteria was spun down, resuspended in PBS, and
sonicated, before adding Triton X-100 to a final concentration of 1%.
The cells were incubated with the detergent for 30 min before
centrifuging the lysate at 12,000 x g for 10 min at 4
C. The lysate was then run over a glutathione sepharose column to
isolate the GST-SF-1 fusion protein. The column was washed three times
with 1 x PBS, and the fusion protein was eluted by the addition
of glutathione elution buffer (10 mM glutathione, 50
mM Tris-HCl, pH 8.0). The eluted protein was acetone
precipitated for 1 h at -20 C and protein concentration was
determined by the method of Bradford (30), using BSA as the
standard.
Electrophoretic mobility shift assays
Complementary oligonucleotides corresponding to the five
putative SF-1 elements identified within the rat StAR promoter were
synthesized and annealed. The five synthetic oligonucleotides were:
5'-GGGCAATCATTCCATCCTTGACCCTCTGCA-3' SFB-1
5'-GGGCCCCCTCCCACCTTGGTCAGCACTGC-3' SFB-2
5'-GGGCCAGGCTGGCCTTGAACTCAAGAGATC-3' SFB-3
5'-GGGCTGTGTAGTCCTTGCTGTCCTAGAACT-3' SFB-4
5'-GGGTACTCTCGGCCTTGAACGCTTACTGGA-3' SFB-5
that are located at -188, -225, -537, -575, and -846,
respectively, relative to the initiation codon. Annealing was performed
in annealing buffer (10 mM Tris-HCl, pH 7.5, 1
mM EDTA, 25 mM NaCl, 10 mM
MgCl2, and 1 mM DTT) by heating the reaction to
94 C for 3 min, followed by gradually decreasing the temperature until
the reaction came to room temperature. The annealed oligonucleotides
were phenol/chloroform extracted and labeled with
[
32P] deoxy-CTP using the Klenow fragment of DNA
polymerase. Annealed oligonucleotides obtained before labeling were
used as unlabeled oligonucleotide competitors.
In a typical binding reaction, 1 µg of purified GST-SF-1 was incubated with 2 µg of poly (dI-dC)·poly (dI-dC), and competitor or SF-1 polyclonal antisera as indicated. Incubation reactions were performed in 25 µl (total volume) of binding buffer containing the final concentrations: 12 mM HEPES, pH 7.9, 12% glycerol, 60 mM KCl, 1 mM EDTA, 1 mM DTT, and 4 mM Tris-HCl, pH 8.0. After incubation for 15 min at room temperature, 1 ng of labeled probe was added and the incubation was continued for 15 min at 30 C. Products were resolved by electrophoresis at 30 mA in high ionic strength Tris-glycine electrophoresis buffer (0.25 M Tris base, 1.9 M glycine, and 10 mM EDTA) in a 4% polyacrylamide gel. Gels were dried and autoradiographed. Protein:DNA complexes were visualized on BioMax film using two intensifying screens and a 1224 h exposure period.
Cell culture
Mouse Y1 adrenal tumor cells and human bladder carcinoma cells
(HTB9) were grown in DMEM with 10% FBS and incubated at 37 C with 5%
CO2 until needed for transfection studies. Cells were
passed with trypsin-EDTA, and the resulting suspension of cells was
centrifuged at 2500 x g for 5 min, followed by
resuspending cells in fresh media and adding to fresh flasks or 6-well
plates.
Transfections and luciferase assays
Cells were plated in six-well plates for use in luciferase
assays, and transfections were performed using the calcium phosphate
method. Fresh media were added to the cells the day of the
transfection. Five micrograms of each plasmid to be transfected was
added to the appropriate tube and precipitated with 0.1 volume of NaOAc
and three volumes of absolute ethanol. The samples were vortexed and
placed at -70 C for 1 h before centrifuging samples at top speed
in a microcentrifuge for 15 min at 4 C. The DNA was resuspended in 450
µl of sterile, distilled water before adding 50 µl of 2.5
M CaCl2. The resulting solution was then added
drop-wise to 500 µl of a 2 x HEPES-buffered saline solution
while bubbling with a 1-ml pipette. The sample was then vortexed for 5
sec and incubated for 20 min at RT before adding to the cells. The DNA
was incubated with the cells for 4 h at 37 C with 5%
CO2, followed by washing the cells twice with PBS. After
the cells were washed, fresh media were added, and the cells were
incubated for 48 h before measurement of luciferase activity.
dbcAMP was added to the cells 24 h before the end of the
incubation period. At the end of the experiment, cells were washed once
with PBS and incubated in 0.5 ml of 1 x passive lysis buffer for
15 min at RT. The resulting lysate was frozen at -80 C until
luciferase activity was measured. For this, 20 µl of the lysate was
placed in a tube in the Turner Designs 20/20 luminometer (Sunnyvale,
CA) and 100 µl of the luciferase enzyme substrate was injected into
the tube and the luminescence measured. A control plasmid, which
encodes for the Renilla luciferase, a second luciferase protein, was
cotransfected into the cells to control for transfection efficiencies.
This luciferase enzymes activity was measured by injecting 100 µl
of a second substrate and luminescence measured. The ratio of these
readings was used to correct for differences in transfection
efficiencies.
Double-stranded nested deletions
Approximately 2 kb of the rat StAR promoter immediately upstream
of the StAR translation initiation codon was cloned into the
MluI and XhoI sites of the luciferase reporter
construct, pGL3-Basic (Promega Corp.), creating pGL3-StAR.
Deletions of the 2-kb rat StAR promoter were obtained using the
double-stranded nested deletion kit from Pharmacia Biotech
according to the manufacturers protocol. Briefly, 5 µg of pGL3-StAR
(50 µl of 0.1 µg/µl) was subjected to restriction digestion with
KpnI and MluI. After digestion was complete, the
DNA sample was heated for 10 min at 70 C to inactivate the enzymes. An
equal volume of 2 x exonuclease III buffer and 100 U of
exonuclease III was added to the linearized plasmid, which was then
incubated at 30 C while taking 2 µl aliquots every 4 min for analysis
of deletions. The different timed aliquots of digested DNA were then
incubated in S1 nuclease buffer with 1.5 U of S1 nuclease to remove all
single-stranded DNA regions. S1 nuclease digestion was stopped by
adding 1 µl of S1 stop solution and heating to 65 C for 10 min.
Deletions were recircularized by ligating linearized DNA samples in
1 x ligation buffer, 5% PEG, and 0.3 U of T4 DNA Ligase.
Appropriately sized deletions were used to transform competent JM109
bacteria to select clones with deletions of interest.
Site-directed mutagenesis
Site-directed mutants were obtained using the QuikChange
site-directed mutagenesis kit from Stratagene according to
the manufacturers protocol. Briefly, two complementary
oligonucleotides containing the desired mutations were synthesized and
PAGE-purified for the mutation reactions. The mutant oligonucleotides
for the SF-1 binding sites were:
5'-GCAATCATTCCATCCTCGACCCTCTGC-3' SFB-1 (knockout)
5'-CTGCCCCCTCCCAAATTGGTCAGCACTGC-3' SFB-2 (knockout)
5'-CTCCCACCTTGACTAGCACTGCAGTATGAG-3' SFB-2 (low to high)
Ten nanograms of the double-stranded DNA template was incubated with 125 ng of the appropriate primer and 1 µl of dNTPs in 50 µl of reaction buffer (100 mM KCl, 100 mM (NH4)2SO4, 200 mM Tris-HCl, pH 8.8, 20 mM MgSO4, 1% Triton X-100, and 1 mg/ml nuclease-free BSA). One microliter of Pfu DNA polymerase (2.5 U/µl) was added to the reaction, and each reaction was heated to 95 C for 30 sec followed by 35 cycles of denaturation at 95 C for 30 sec, annealing at 55 C for 1 min, and extension at 68 C for 12 min. After the cycling reaction, samples were subjected to digestion with DpnI for 1 h at 37 C to get rid of the parental DNA template. One microliter of the mutant samples was used to transform XL-1 Blues, and the resulting mutations were verified by sequencing.
Data analysis
Data from these individual parameters were compared by ANOVA
followed by Student-Newman-Keuls multiple comparison test when
applicable (32). All analysis was completed using the Statview program
with graphics (Abacus Concepts, Berkeley, CA) on a Macintosh Performa
6400/200 (Macintosh, Apple Computer, Inc., Cupertino, CA). A
P < 0.05 was considered significant for all tests.
| Results |
|---|
|
|
|---|
|
|
|
|
Further promoter sequence analysis using the MacVector sequence
analysis program revealed the presence of multiple regulatory elements
similar to the consensus sequences for the SF-1 binding site (CCTTG),
the estrogen receptor half-site (AGGTCA), and the AP-1 site (GTCGTCA).
These regulatory elements included five putative SF-1 binding sites at
positions -764 to -754, -493 to -483, -455 to -445, -143 to
-132, and -106 to -97, a putative estrogen receptor half-site at
position -137 to -132, a putative SP1 site at position -344 to
-339, and two putative AP-1 elements at positions -1561 to -1555 and
-187 to -181 (Fig. 4
). Although the rat StAR gene is regulated by
cAMP, sequence analysis of the rat StAR promoter for the presence of
cAMP response elements (CRE) did not reveal any regulatory motifs that
resembled the classical CRE.
To demonstrate that the steroidogenic tissue-specific transcription
factor, SF-1, could recognize and bind to the SF-1 elements identified
within the rat StAR promoter, mobility shift assays using
oligonucleotides corresponding to these sites were performed with and
without the partially purified DNA-binding domain of SF-1. The
DNA-binding domain of SF-1 was kindly provided as a GST fusion protein
in pGEX-1
T by Keith L. Parker (38). The rat aromatase promoter
contains an SF-1 binding site that activates transcription of the
aromatase gene. This element (designated RA) has been demonstrated to
bind SF-1 (38) and was used as a positive control for binding by the
GST-SF-1 fusion protein in lanes 13 (Fig. 5
). Lanes 1 and 2 contain the RA probe
incubated alone and with the GST-SF-1 fusion protein, respectively. The
incubation reaction in lane 3 contains SF-1-specific polyclonal
antisera, which supershifts the SF-1-containing protein complex. The
incubation reactions in lanes 46 contain the probe corresponding to
the low affinity SF-1 binding site located at position -143 to -132
in the rat StAR promoter. The weak complex formed in lane 4 is competed
out by the addition of excess unlabeled oligonucleotide competitor. The
incubation reactions for lanes 79 contain a probe corresponding to
the high affinity SF-1 binding site located at position -106 to -97.
The complex formed in lane 7 is competed out with excess unlabeled
oligonucleotide (lane 8), and complex formation is diminished in the
presence of SF-1-specific antisera (lane 9). Similar experiments were
performed using all five SF-1 binding sites identified within the rat
StAR promoter. The three high affinity sites are shown in Fig. 6
. These sites have been designated SF-1
binding sites 1, 3, and 5 (SFB-1, SFB-3, and SFB-5). The low affinity
SF-1 binding sites (SFB-2 and SFB-4) were bound by the purified
GST-SF-1 protein but complexes formed demonstrated relatively low
affinity of SF-1 for these two regulatory motifs (Fig. 5
and data not
shown).
|
|
|
|
C mutation in the core SF-1
binding motif (CCTTG
CCTCG) of the high
affinity SF-1 binding site, creating p-342 StAR M1. The results of the
luciferase activity in the HTB9 cells with and without cotransfection
of the SF-1 expression plasmid are shown in Fig. 9
|
CCACCTTGACTA; M3). The results
using mutant M3 demonstrated that the presence of two high affinity
SF-1 sites in close proximity can additively affect transcription. The
cells transfected with M3 alone had background levels of luciferase
activity. When the SF-1 expression plasmid was cotransfected into these
cells, luciferase activity increased 12-fold. Further stimulation of
the cells with dbcAMP caused luciferase activity to increase an
additional 10-fold. Both basal and cAMP-stimulated cultures
cotransfected with the M3 mutation expressed luciferase levels that
were 2-fold higher than the wild-type promoter-driven luciferase gene
(Fig. 9| Discussion |
|---|
|
|
|---|
In the past 3 yr, the mouse, rat, and human StAR genes have been isolated and sequenced. All three genes are comprised of seven exons and six introns that span 6.5, 7, and 8 kb for the mouse, rat, and human genes, respectively (39, 40, 41). The transcription start site for the rat StAR gene, as determined by 5'-RACE analysis, is similarly located within the promoter region as that determined for the mouse and human transcription start sites (25, 41). The rat, mouse, and human promoter regions, unlike many genes expressed in a highly regulated fashion, lack the canonical TATA box. While StAR transcription is positively regulated in response to cAMP stimulation, the rat, mouse, and human StAR promoters all lack a classical CRE. Thus, the mechanism whereby StAR transcription is activated by gonadotropins via cAMP has only recently been determined to be due in part to SF-1 activation. The presence of AP-1 sites, which traditionally recruit cJun/cFos heterodimers to positively regulate transcription is currently being characterized in our laboratory.
SF-1 was first shown to be an essential regulator of the cytochrome P450 steroid hydroxylase gene (21, 22, 23) and was subsequently linked to the expression of the gene encoding Müllerian-inhibiting substance (42, 43). SF-1 is an orphan member of the nuclear receptor superfamily and is thought to bind to the consensus sequence PyCAAGGPyCPu (38). This study and studies using the human StAR promoter (26) have demonstrated that SF-1 binds to regulatory elements containing a CCTTG motif, which is the complement of the SF-1 consensus sequence shown above. SF-1 is thought to activate transcription of its target genes upon binding these sequence motifs within the promoter regions. Analysis of the StAR promoter region in the rat, mouse, and human has revealed the presence of multiple SF-1 binding sites. Two sequence motifs that match the known requirements for binding of SF-1 were found in the mouse promoter region at positions -135 to -128 (CCACCTTGG) and at -46 to -42 relative to the transcriptional start site (25). While approximately 3 kb of the 5'-flanking region of the mouse StAR gene was sequenced and analyzed for DNA regulatory motifs, only two SF-1 binding sites were found, both of which were located within the first 200 bp of the promoter. The primary site (-135) was able to bind SF-1 by mobility shift analysis, and mutation of this site was able to decrease basal levels of transcription, but neither site influenced cAMP stimulation of transcription. The human StAR promoter contained three SF-1 binding sites at positions -926 to -918 (TGACCTTGA), -105 to -95, and -42 to -35 relative to the transcription start site (26). Mutation of the distal or proximal cis-elements substantially reduced SF-1-supported StAR promoter activity. In the rat StAR promoter, however, five potential SF-1 sites have been identified within the first kb of the transcription start site. Three sites exhibit high affinity for SF-1 binding and two sites exhibit relatively low affinity; however, all sites seem to be required for maximal activation of rat StAR gene transcription.
These studies have also demonstrated that SF-1 is involved in cAMP responsiveness of the rat StAR promoter using cotransfection studies and luciferase assays. Studies in a nonsteroidogenic cell line have demonstrated that SF-1 alone was capable of stimulating transcription of the reporter gene. The rat StAR promoter was unable to activate transcription of the reporter gene in the nonsteroidogenic human bladder carcinoma cell line HTB9. Cotransfection of the SF-1 cDNA in the correct orientation (cSF-1) activated transcription of the reporter gene over 100-fold. Cotransfection of the SF-1 cDNA in the reverse orientation (rSF-1) had no effect on luciferase activity, which remained at background levels. Cotransfection of the correct and reverse SF-1 cDNAs also demonstrated the fact that SF-1 is involved with cAMP-responsiveness of the rat StAR promoter. dbcAMP administration to cells transfected with the cSF-1 cDNA resulted in increased luciferase activity compared with unstimulated cSF-1 transfected controls. However, luciferase activity in cells transfected with the rSF-1 cDNA and stimulated with cAMP remained at background levels indicating that SF-1 was required to mount a transcriptional response.
There is the possibility that ubiquitous transcription factors necessary for assembling the transcriptional machinery are involved with this transcriptional activation. Recent studies have demonstrated that SP1 and SF-1 can interact in vivo and direct regulation of a CYP11A promoter-linked luciferase reporter gene in a cooperative manner (44). Consistent with this hypothesis, an SP1 site was identified within the rat StAR promoter at position -344 to -339. Further studies are required to characterize the role SP1 may play in regulating StAR gene expression.
Promoter deletion studies and site-directed mutagenesis were used to determine which SF-1 binding sites within the StAR promoter region were important for transcriptional activation. Analysis of the rat StAR promoter region (2 kb) identified three high affinity SF-1 binding sites as determined by electrophoretic mobility shift analysis. The promoter was then subjected to deletion analysis to yield promoter fragments with one, two, or all three high affinity SF-1 binding sites to determine which sites were critical for StAR gene transcription. Deletion experiments in Y1 adrenal tumor cells demonstrated that as each high affinity SF-1 site was deleted, luciferase levels were decreased. Minor differences in the rat StAR promoter deletion data between the HTB9 cells and the Y1 adrenal tumor cells stem from the fact that the HTB9 cells are a nonsteroidogenic cell line and lack steroidogenic tissue-specific factors necessary for transcriptional activation of the reporter gene. On the other hand, the Y1 cells are a steroidogenic cell line that synthesize large amounts of steroids and possess the necessary proteins required for regulation of genes encoding proteins involved in steroidogenesis.
To determine whether the luciferase activity generated by the smallest deletion (p-342 StAR) was due to the presence of SF-1 sites, the p-342 StAR promoter fragment was then subjected to site-directed mutagenesis to further characterize SF-1 interaction with and regulation of the minimal rat StAR promoter. The wild-type p-342 StAR promoter construct activated luciferase gene expression one-tenth as much as the full-length StAR promoter. This data suggests that multiple SF-1 sites within the StAR promoter may act cooperatively to regulate transcription of the StAR gene. The p-342 StAR M1 mutant with the high affinity SF-1 binding site altered by a single base change in the core region of the proposed SF-1 binding site, reduced SF-1 transcriptional activation to approximately one quarter of wild-type luciferase levels in unstimulated and dbcAMP-treated cultures, respectively. This study reflects the importance of the high affinity SF-1 binding site in the regulation of the StAR gene, however, the mutation of the single high affinity site does not completely inhibit reporter gene expression. This may be due to the presence of a low affinity SF-1 binding site, which has been demonstrated to bind SF-1.
When the low affinity SF-1 binding site alone was mutated, luciferase levels fell significantly, but not as dramatically as the high affinity SF-1 binding site mutant. The fact that mutating the low affinity SF-1 binding site resulted in decreased luciferase activity suggests that this low affinity SF-1 site is important for maximal regulation of the StAR gene at the transcriptional level. To determine if these two SF-1 sites were completely responsible for the increase in reporter gene expression, both sites were knocked out by site-directed mutagenesis. The luciferase levels in the unstimulated cultures were reduced to control levels. The cAMP-stimulated luciferase levels were not increased significantly compared with the unstimulated cells and were reduced to less than 10% of dbcAMP-stimulated p-342 StAR wild-type control levels.
To determine whether the SF-1 transcriptional response might be enhanced by changing the low affinity SF-1 binding site into a high affinity SF-1 site, we altered the low affinity site to more closely resemble the SF-1 consensus sequence for binding. The presence of two high affinity SF-1 sites in close proximity additively affected transcription. The fact that both basal and cAMP-stimulated cultures cotransfected with the M3 mutation expressed luciferase levels that were twice as high as the wild-type promoter-driven luciferase gene, sheds some insight into the binding characteristics of SF-1. All five SF-1 elements within the rat StAR promoter share the core CCTTG nucleotides; however, the three high affinity sites and the mutated low affinity site all contain the additional adenosine residue following the guanosine residue (CCTTGA).
The results of this investigation indicate that cAMP administration to rat luteal cells enhances expression of rat StAR mRNA and protein levels in a time and dose-dependent manner. Furthermore this study indicates that SF-1 binds to five regulatory motifs within the rat StAR promoter and activates StAR gene transcription at a basal level and in response to cAMP administration. These studies are the first to demonstrate that the rat StAR promoter is regulated by SF-1 and that SF-1 alone confers cAMP-responsiveness to the rat StAR promoter.
| Acknowledgments |
|---|
T by Keith L. Parker at the University of
Texas, Southwestern Medical School, Dallas, TX (38). Dr. Parker
also provided the full-length SF-1 cDNA in the pCMV expression plasmid
in both the correct (cSF-1) and the reverse (rSF-1) orientation (22).
We acknowledge Dr. Xia Liu for her technical assistance. | Footnotes |
|---|
Received April 3, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y.-J. Chen, M.-T. Lee, H.-C. Yao, P.-W. Hsiao, F.-C. Ke, and J.-J. Hwang Crucial Role of Estrogen Receptor-{alpha} Interaction with Transcription Coregulators in Follicle-Stimulating Hormone and Transforming Growth Factor {beta}1 Up-Regulation of Steroidogenesis in Rat Ovarian Granulosa Cells Endocrinology, September 1, 2008; 149(9): 4658 - 4668. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Castillo, B. Castellana, L. Acerete, J. V Planas, F. W Goetz, S. Mackenzie, and L. Tort Stress-induced regulation of steroidogenic acute regulatory protein expression in head kidney of Gilthead seabream (Sparus aurata) J. Endocrinol., February 1, 2008; 196(2): 313 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sugawara, E. Nomura, and N. Hoshi Cholesterol sulphate affects production of steroid hormones by reducing steroidogenic acute regulatory protein level in adrenocortical cells J. Endocrinol., December 1, 2007; 195(3): 451 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Kuhl, S. M. Ross, and K. W. Gaido CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis Endocrinology, December 1, 2007; 148(12): 5851 - 5864. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] |