Endocrinology Vol. 139, No. 12 4936-4944
Copyright © 1998 by The Endocrine Society
Identification of an Adipocyte-Specific Negative Glucose Response Region in the Cytosolic Aspartate Aminotransferase Gene1
Emmanuelle Plee-Gautier2,3,
Martine Aggerbeck,
Fadéla Beurton2,
Bénédicte Antoine,
Hélène Grimal,
Robert Barouki and
Claude Forest
Centre de Recherche sur lEndocrinologie Moléculaire et le
Développement (E.P.-G., H.G., C.F.), Centre National de la
Recherche Scientifique, 92190 Meudon, France; Institut National de la
Santé et de la Recherche Médicale Unité 490 (M.A.,
F.B., R.B.), Centre Universitaire des Saints-Pères, 75006 Paris,
France; Institut National de la Santé et de la Recherche
Médicale Unité 129 (B.A.), Institute Cochin de
Génétique Moléculaire, Centre Hospitalier
Universitaire Cochin, 75014 Paris, France
Address all correspondence and requests for reprints to: Dr. Claude Forest, Centre de Recherche sur lEndocrinologie Moléculaire et le Développement, CNRS, 9 rue Jules Hetzel, 92190 Meudon, France. E-mail: forest{at}cnrs-bellevue.fr
 |
Abstract
|
|---|
Cytosolic aspartate aminotransferase (cAspAT) participates in
gluconeogenesis in the liver and is expected to exert a glyceroneogenic
function in the adipose tissue when the supply of glucose is limited.
Here we demonstrate that adipose cAspAT messenger RNA (mRNA) is
increased when rats are fed a low carbohydrate diet. In the 3T3-F442A,
BFC-1 adipocyte cell lines and differentiated adipocytes in primary
culture, a 24 h glucose deprivation induces approximately a 4-fold
increase in cytosolic AspAT (cAspAT) mRNA, whereas mitochondrial AspAT
mRNA remains unchanged. cAspAT activity is also increased in a weaker
but reproducible manner. Addition of glucose within a physiological
range of concentrations reverses the increase of cAspAT mRNA in 8
h (EC50 = 1.25 g/liter). Such a regulation requires protein
synthesis and is specific for adipocytes differentiated in culture. It
does not occur in Fao or H4IIE hepatoma cells, in C2 muscle cells, or
in 293 kidney cells. 2-deoxyglucose mimicks glucose, while
3-orthomethyl-glucose has no effect, suggesting that
glucose-6-phosphate is the effector. cAspAT mRNA stability is not
affected by glucose deprivation. To ascertain the transcriptional
nature of the glucose effect, we have stably transfected 3T3-F442A
adipoblasts with constructs containing the chloramphenicol
acetyltransferase reporter gene under the control of either
5'-deletions of the cAspAT gene promoter or internal fragments in an
heterologous context. We demonstrate that a glucose response element(s)
is present in the region between -1838 and -1702 bp relative to the
translation start site. In this region, three DNA sequences bind
nuclear proteins from adipocytes as shown by footprinting experiments.
Our results indicate that cAspAT gene transcription is repressed by
glucose selectively in adipocytes.
 |
Introduction
|
|---|
GLUCOSE regulates the expression of several
genes that encode metabolic enzymes. It has been postulated that these
effects of glucose mediate the regulation of several genes by insulin.
Most studies have dealt with positive regulation as in the case of the
L-type pyruvate kinase (L-PK). In liver and in cultured hepatocytes,
glucose induces the expression of the L-PK gene via a glucose response
element (GlRE) present in the promoter of the gene (1, 2, 3, 4). This GlRE
consists of two palindromic binding sites for upstream stimulating
factor (USF) proteins separated by 5 bp (3). However, the implication
of this transcription factor in glucose regulation is controversial
(5). An element with a similar structure, termed carbohydrate response
element, has also been identified in the regulatory region of the spot
14 gene (6, 7). Conversely, glucose inhibits phosphoenolpyruvate
carboxykinase (GTP) (EC 4.1.1.32; PEPCK) gene expression in hepatocytes
(8), hepatoma cells (9) and cultured white adipose tissue (10) and
represses the stimulation of fatty acid-induced PEPCK messenger RNA
(mRNA) in adipocytes (11), through still undeciphered mechanisms. In
cultured adipose tissue, glucose stimulates fatty acid synthase and
acetyl-CoA carboxylase mRNAs (10, 12). Interestingly, all the genes of
these enzymes are also under multihormonal control (10, 13, 14). Hence,
the interplay of nutrients and hormones results in a fine tuning of
expression of these genes.
Cytosolic aspartate aminotransferase (cAspAT; EC 2.6.1.1) is a
metabolic enzyme which participates in an ubiquitous function, the
malate aspartate shuttle and in gluconeogenesis, a tissue-specific
regulated pathway. Regulation of cAspAT gene expression has been
extensively studied in liver and kidney. In these tissues cAspAT
activity is induced by a low carbohydrate diet, starvation, diabetes,
and hydrocortisone (15, 16, 17). In cultured Fao hepatoma cells,
glucocorticoids are strong stimulators of cAspAT activity, mRNA, and
gene transcription. cAMP potentiates the glucocorticoid effect, whereas
insulin inhibits it (18, 19). None of these effectors affects the
mitochondrial isoform of AspAT (mAspAT), showing that the hormonal
control is specific for cAspAT and consistent with the participation of
the latter enzyme in gluconeogenesis.
cAspAT is also expressed in adipose tissue in which its
physiological role is not clear. PEPCK, the rate limiting enzyme in
hepatic gluconeogenesis, which yields phosphoenolpyruvate from
oxaloacetate, is also expressed in adipose tissue where it performs a
glyceroneogenic function when glucose supply to the tissue and
glycolysis are low (20). Because cAspAT allows the generation of
oxaloacetate in the cytoplasm, it is postulated that it is also
involved in glyceroneogenesis in adipose tissue under conditions of
restrained glucose transport and utilization. We have previously shown
that the cAspAT gene expression in 3T3-F442A adipocytes is raised by
various conditions including glucose deprivation (21). Here we
demonstrate that adipose cAspAT mRNA is increased when rats are fed a
low carbohydrate diet, and we analyze the mechanism by which glucose
represses cAspAT gene expression in cultured 3T3-F442A adipocytes. This
regulation appears specific to adipocytes and is exerted in a
physiological range of glucose concentrations. In addition, we have
localized the region of the promoter that mediates the negative glucose
regulation of cAspAT gene expression.
 |
Materials and Methods
|
|---|
Animals and diets
Male Wistar rats bred in our laboratory were used. They were
housed in individual cages at a constant temperature of 24 C. Rats
weighing 180200 g were used by groups of six animals. The first group
received the high carbohydrate (HC) diet ad libitum for 11
days, the second group was fed the low carbohydrate (LC) diet for 11
days, and the third group received the LC diet for 10 days followed by
24 h of HC diet. The HC diet had the following composition (g/100
g of diet) sucrose (10), starch (60), casein (10), oil (8), vitamin
(1), mineral mixture (4), and cellulose (7). In the LC diet, sucrose
and starch were replaced by casein. The periepididymal fat pads were
removed, immediately frozen in liquid nitrogen and stored at -80 C for
subsequent RNA extraction.
Cell culture and treatment
3T3-F442A and BFC-1 adipoblasts, C2.7 myoblasts, and 293 cells
were cultured at 37 C in a humidified atmosphere of 10%
CO2/90% air in DMEM containing 4.5 g/liter glucose, 200
IU/ml penicillin, 50 mg/liter streptomycin, 8 mg/liter biotin, 4
mg/liter pantothenate, 3.7 g/liter bicarbonate, and supplemented with
10% FCS (Medium A) for adipoblasts and 293 cells and with 20% FCS for
myoblasts. Adipose differentiation was achieved in the same medium
enriched with 0.02 µM insulin for 8 days. C2.7 myocytes
were obtained by culturing confluent cells in medium containing 1% FCS
for 3 days. Fao and H4IIE hepatoma cells were cultured in Hams F12
medium containing 1.26 g/liter glucose, 200 IU/ml penicillin, 50
mg/liter streptomycin, 3.7 g/liter bicarbonate and 10% FCS. Cells were
shifted to serum-free, insulin-free medium for 24 h (or 48 h
when indicated), during which treatment with effectors was performed
for the indicated times before RNA extraction and assays of CAT or
cAspAT activity. When glucose was omitted, medium was enriched with 1
mM pyruvate and 0.1 mM lactate. For primary
cultures, inguinal adipose tissue from 3-day-old C57 BL/6J mice was cut
in small fragments that were maintained at the bottom of a 60-mm
diameter culture dish in 1 ml of medium A for 3 days to permit
attachment. Explants were then cultured for 8 days in 4 ml of medium A
to allow sufficient migration of the cells out the explants. Cells were
then replated at a density of 3 x 105 cells/60-mm
dish and cultured in a manner identical to the 3T3-F442A cell line.
RNA extraction and analysis
Cells from two 60-mm dishes were pooled, and RNA was extracted
according to the method of Chomczynski and Sacchi (22). RNA extraction
from adipose tissue was performed by the TriPure isolation reagent
(Boehringer Mannheim) according to the manufacturers
instructions. Total RNA was electrophoresed on a 1% agarose gel
containing 2.2 M formaldehyde and blotted onto a nylon
membrane. The integrity and relative amounts of RNA were assessed by
methylene blue staining. Prehybridization and hybridization of the
blots were performed according to Yang and colleagues (23). Membranes
were hybridized overnight at 65 C in 0.27 M NaCl, 1.5
mM EDTA, 15 mM sodium phosphate (pH 7.7)
containing 7% SDS, 10% polyethylene glycol 6000, 250 µg/ml
sonicated salmon sperm DNA, 250 µg/ml heparin and 106
cpm/ml of complementary DNA (cDNA) labeled with [
32P]
dCTP (Amersham) by random priming according to the manufacturers
recommendation. Membranes were washed twice for 15 min at room
temperature with 2 x SSC (1 x SSC is 0.3 M
NaCl, 0.03 M sodium citrate, pH 7), 0.1% SDS and then for
30 min at 60 C with 0.1 x SSC, 0.1% SDS. Specific cDNA probes
used were the cAspAT (4B21) (16), mAspAT (16), PEPCK (PC116) (24), S14
(PT76) (25) and ß-actin (pA21). An oligonucleotide specific for the
18S ribosomal RNA was 32P end-labeled and used as a
control, as described previously (26). The mRNA signal was quantified
by scanning densitometry and was corrected for differences in RNA
loading by comparison with the signals generated by the ß-actin or
the 18S rRNA probe.
Plasmid constructs
The p-2405/-26:CAT, p-1984/-26:CAT, p-1718/-26:CAT and
p-300/-26:CAT were previously described (19). In these constructs the
-26 bp is relative to the translation start site (19). The plasmid
MTV:CAT, derived from the plasmid MMTV:CAT by deletion of the
sequence from position [mins]190 to -88 of the mouse mammary tumor
virus long terminal repeat was a gift of Dr. R. Evans (San Diego, CA)
and was described elsewhere (27). The plasmids -1984/-1702
MTV:CAT,
p-1984/-1702TK:CAT and p-1838/-1702TK:CAT were obtained by subcloning
fragments of the cAspAT gene promoter obtained by PCR into the
HindIII site of the p
MTV:CAT vector or of the pTK:CAT,
which contains -105 bp of the herpes simplex thymidine kinase promoter
linked to the CAT gene. These fragments were amplified from the
p-2405/-26:CAT plasmid, using the primers 5' TAGTAGAAGCTTAGGTCCAGGTTC
3' and 5' CTTCACAAGCTTAGGCAACAATGC 3' (for the -1984/-1702 fragment)
and the primers 5' ATGTGCAAGCTTGTACCTAACTGAA 3' and 5'
CTTCACAAGCTTAGGCAACAATGC 3' (for the -1838/-1702 fragment) which,
all, contain a HindIII site for the subcloning step.
Stable transfection experiments
Exponentially growing 3T3-F442A preadipocytes (105
cells per 100 mm plates) were cotransfected by calcium phosphate-DNA
coprecipitation (28) with 2 µg of pSV2-NEO (29), the expression of
which confers resistance to the antibiotic geneticin together with 20
µg of CAT-expressing plasmid. Cells were treated as described (30).
Transfection efficiency was about 5 x 10-5. After 2
weeks exposure to geneticin (0.4 mg/ml), several colonies of
geneticin-resistant cells were isolated and analyzed. Cells from 90%
of these colonies were still able to differentiate at a frequency
similar to that of the parental line. About 70% of these expressed
CAT. Fully differentiated adipocytes were shifted to serum-free medium
and deprived or not of glucose for the last 24 h before CAT
assay.
Assay of cAspAT and of CAT activities
For the separate determination of cAspAT and mAspAT, we
have used the procedure of Parli et al. (31), which is based
on the thermolability of mitochondrial but not cytosolic AspAT as
previously described by Barouki et al. (18). Preparation of
cell homogenates for CAT assays was performed as detailed (32). The
method of Seed and Sheen (33) was used for CAT activity determination.
One unit of CAT converts 1 µmol chloramphenicol to
butyryl-chloramphenicol per minute at pH 7.8 and 37 C.
DNase I footprinting
A probe from the cAspAT gene promoter (nucleotides -1838 to
-1702) was end-labeled using the Klenow fragment of DNA polymerase I.
The standard reaction was performed according to Vaulont et
al. (34) with some modifications (35). The nuclear proteins,
3060 µg, prepared as mentioned previously (35) were incubated with
about 1 ng of labeled probe (30,000 cpm) for 15 min on ice. After
adjusting the concentration of CaCl2 to 2.5 mM
and incubating for 1 min at 20 C, DNase I was added, and the digestion
was carried out at 20 C for 1 min. Subsequent handling of the DNA was
performed as described (34).
 |
Results
|
|---|
Adipose cAspAT mRNA is increased by a low-carbohydrate diet in vivo
and by glucose deprivation in 3T3-F442A cells
Cytosolic aspartate aminotransferase is expressed in
vivo in all tissues analyzed so far. However, expression of the
cAspAT gene has been mainly studied in liver and in cultured hepatoma
cells in which it is under multihormonal control (16, 18, 36). We
hypothesized that cAspAT would also be regulated in adipocytes and that
nutritional conditions known to alter liver expression of cAspAT would
also modify its adipose expression. To address that question, we fed
rats with a diet containing either a high or a low proportion of
carbohydrates and analyzed adipose cAspAT mRNA by Northern blot. Rats
fed an LC diet presented a 2- to 3-fold higher concentration of cAspAT
mRNA than the high carbohydrate (HC) fed rats (Fig 1A
). Conversely, the change of regimen
from LC to HC (LC/HC) for 24 h resulted in a significant lowering
of cAspAT mRNA. Similar results could be observed when PEPCK was the
target mRNA while S14 mRNA responded in an opposite manner (Fig. 1A
) as
expected (37, 38).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 1. Effect of nutrients and hormones on cAspAT mRNA in
rat adipose tissue and in 3T3-F442A adipocytes. A, Three groups of six
rats were fed ad libitum for 11 days by either an HC
diet, an LC diet, or an LC diet for 10 days followed by 24 h of HC
diet (LC/HC). RNA was extracted from periepidydimal adipose tissue and
analyzed by Northern blot. Data obtained by scanning densitometry, was
normalized for RNA loading using the ß-Actin mRNA signal. Data are
expressed in percentage of HC diet taken as control. B, Differentiated
3T3-F442A adipocytes were cultured in medium A (CTL) then shifted for
24 h in glucose-free, serum-free medium (-glucose) or in
serum-free medium supplemented with either 8-CPT-AMPc (500
µM), dexamethasone (100 nM), or insulin (1
µM). mAspAT and cAspAT mRNA were analyzed by Northern
blot.
|
|
In addition to changes in glycemia, variations in the insulin/glucagon
ratio and eventually in plasma glucocorticoids, occur between HC and LC
fed rats (39). To determine which of these parameters could be the main
regulator of cAspAT gene expression, we used the 3T3-F442A adipocyte
cell line (40), a cell culture system widely used for gene regulation
studies (41). When differentiated cells were deprived of glucose for
24 h, cAspAT mRNA was strongly elevated while it remained fairly
constant when cells were treated with the cAMP analog
8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP), the glucocorticoid analog
dexamethasone or insulin, showing that glucose was the main effector
(Fig. 1B
).
The induction of cAspAT gene expression by glucose deprivation is
specific to adipocytes
cAspAT is expressed in vivo in all cells analyzed so
far in agreement with its ubiquitous function. To assess whether cells
other than 3T3-F442A adipocytes would regulate cAspAT mRNA, we analyzed
the glucose effect in a series of cultured cell systems. The BFC-1
adipose cell line (30) and primary adipocytes are two model systems of
adipocytes for studying hormonal and nutritional controls of gene
expression (41, 42). After differentiation, 3T3-F442A, BFC-1 or primary
adipocytes were maintained for 24 h either in glucose-supplemented
(25 mM) or in glucose-free medium before RNA isolation and
Northern blot analysis with a cAspAT cDNA probe. A large increase in
cAspAT mRNA occurred in glucose-starved cells (Fig. 2
). This increase was specific to the
cAspAT message because glucose deprivation did not notably affect
mAspAT or actin mRNAs (Fig. 2
). None of the nonadipose cell lines, the
H4IIE and Fao hepatoma cells, the C2.7 differentiated myocytes or the
293 human transformed kidney cells, responded to glucose deprivation by
a change in cAspAT mRNA (Fig. 2
).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 2. Effect of a 24 h glucose deprivation on
cAspAT mRNA in various cell lines and in adipocytes in primary culture.
3T3-F442A and BFC-1 adipocytes, adipocytes in primary culture,
subconfluent H4IIE and Fao hepatoma cells, C2.7 differentiated myocytes
(muscle) or subconfluent 293 transformed kidney cells were deprived of
glucose for 24 h before RNA analysis. Autoradiograms shown are
representative of two experiments with identical results.
|
|
We next focused on 3T3-F442A adipocytes and analyzed the time course of
glucose action. As shown in Fig. 3
, cAspAT transcript raised in response to glucose deprivation in a
time-dependent manner with a 4-fold increase attained at 48 h.
This increase was followed by a parallel change in cAspAT enzymatic
activity, which reached a specific activity of 75 mU/mg protein at
72 h, corresponding to an increase of about 2-fold above basal
(Fig. 3
). Glucose addition to the medium of cells deprived of glucose
for 24 h repressed the cAspAT message with a maximal 80% decrease
at 8 h, showing that the glucose effect was fully reversible (Fig. 3
, inset). A treatment time of 8 h was chosen to
investigate the dose dependence of the glucose effect. Glucose-induced
decrease in cAspAT mRNA was dose dependent with a maximum reached at
4.5 g/liter and a half-maximum effect (EC50) attained at
about 1.25 g/liter (Fig. 4
).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Glucose-dependent level of cAspAT mRNA and
activity in 3T3-F442A adipocytes. 3T3-F442A adipocytes were incubated
in glucose-free medium for the indicated times or, as shown in inset,
for 24 h before treatment with 25 mM glucose for the
indicated times. RNA was analyzed by Northern hybridization with a
labeled cAspAT cDNA probe. Data obtained by scanning densitometry, was
normalized for RNA loading using the ß-Actin mRNA signal. Cytosolic
AspAT activity was determined as described in Materials and
Methods and normalized by measuring the protein concentration.
Data are expressed as the percent of cAspAT signal from cells cultured
in the presence of 25 mM glucose or, as shown in
inset, in the absence of glucose. Each value represents
the mean ± SEM of data obtained from at least three
independent experiments with duplicate dishes.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4. Effect of glucose concentration on cAspAT mRNA in
glucose-deprived 3T3-F442A adipocytes. Following 24 h of glucose
deprivation, glucose was added to the culture medium at various
concentrations. Eight hours later, RNA was analyzed by Northern
hybridization with a labeled cAspAT cDNA probe. Data, obtained by
scanning densitometry, was normalized for differences in RNA loading
using the ß-Actin mRNA signal and expressed as the percent of cAspAT
signal from control cells incubated 24 h in glucose-free medium.
Data represent the mean of two independent experiments with duplicate
dishes.
|
|
Effects of various hexoses or glucose analogs on cAspAT gene
expression in 3T3-F442A adipocytes
To exclude the possibility that differences in
cAspAT gene expression were due to differences in osmotic pressure
between cells cultured in the presence and in the absence of glucose,
3T3-F442A adipocytes were treated with either 4.5 g/liter of
[scap[l-glucose or 4.5 g/liter of mannitol, two sugars that are
not transported into cells. Neither L-glucose nor mannitol
affected the cAspAT gene expression (Fig. 5
). Hence, the glucose- induced
inhibition of cAspAT gene expression was not due to an osmotic change
of the culture medium.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 5. Effect of sugars on cAspAT mRNA in 3T3-F442A
adipocytes. 3T3-F442A adipocytes were maintained for 24 h in
culture medium in which glucose was either omitted (CTL) or changed to
25 mM of the indicated sugars. RNA was analyzed by Northern
hybridization with a labeled cAspAT cDNA probe. Data obtained by
scanning densitometry, was normalized for RNA loading using the
ß-Actin mRNA signal. Data are expressed as the percent of cAspAT
signal from 24-h glucose-deprived cells. Each value represents the
mean ± SEM of data obtained from at least three
independent experiments with duplicate dishes. D-gluc,
D-glucose; L-gluc, L-glucose;
3-OMG, 3-orthomethyl glucose; 2-DOG, 2-deoxyglucose.
|
|
Next, we aimed at elucidating whether glucose or one of its metabolites
was responsible for the observed effect. We treated 3T3-F442A
adipocytes with various glucose analogs and analyzed the cAspAT mRNA
content. Galactose or 3-orthomethyl-glucose (3-OMG), two sugars that
are transported but not metabolized were inefficient (Fig. 5
). Fructose
or mannose reduced cAspAT mRNA with a magnitude equivalent to that
induced by D-glucose (6070%), showing that glucose
action required transport and metabolism (Fig. 5
). 2-deoxyglucose
(2-DOG), which is transported and phosphorylated into 2-deoxyglucose
6-phosphate but not further metabolized through the glycolytic pathway,
fully mimicked D-glucose, demonstrating that glucose
phosphorylation was necessary and sufficient for reducing cAspAT mRNA
content (Fig. 5
). 2-DOG-6-phosphate could be further metabolised in the
pentose phosphate pathway. Therefore, we tested xylitol, an
intermediate of the nonoxydative branch of the pentose phosphate
pathway, able to mimic glucose induction of L-pyruvate kinase gene
expression in hepatocytes (43). Xylitol at concentrations of either 25
mM (Fig. 5
), 10 mM or 0.5 mM (not
shown) did not affect cAspAT mRNA. These data indicated that
glucose-6-phosphate was the likely intermediate of glucose in
inhibiting cAspAT gene expression.
Mechanism of the regulation by glucose of cAspAT gene
expression
We wondered whether the glucose effect was direct or indirect.
Before glucose treatment, we treated glucose- deprived cells with
the protein synthesis inhibitor cycloheximide, at concentrations
previously shown to inhibit protein synthesis (11, 26). Cycloheximide
alone did not affect cAspAT mRNA, whereas it prevented almost totally
the glucose-elicited inhibition of cAspAT gene expression (Fig. 6A
). This glucose effect was also
prevented in the presence of anisomycin (not shown). We conclude that
glucose action did require protein synthesis.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 6. Influence of cycloheximide and of DRB on
glucose-induced inhibition of cAspAT mRNA in 3T3-F442A adipocytes.
3T3-F442A adipocytes were glucose-deprived for 24 h before
cycloheximide or DRB addition. A, Cells were incubated or not for 30
min with 10 µM of cycloheximide before treatment with 25
mM glucose. 8 h later, RNA was analyzed by Northern
hybridization with subsequently the cAspAT and the ß-actin cDNA
probes. Autoradiogram shown is representative of two independent
experiments with identical results. B, Cells were incubated with or
without 25 mM glucose in the presence of 100
µM DRB. Total RNA was prepared 2, 4, 6, and 8 h
later then analyzed by Northern hybridization with a labeled cAspAT
cDNA probe. Data obtained by scanning densitometry, was normalized for
RNA loading using the 18S rRNA signal. Data obtained by scanning
densitometry are expressed in % of maximum (t = 0). Data shown
are the mean ± SEM of three independent experiments
with duplicate plates.
|
|
Changes in steady-state mRNA concentrations can be the result of
variations in mRNA stability. To determine whether mRNA half-life could
be affected by glucose treatment, we incubated glucose-deprived
3T3-F442A adipocytes with or without glucose in the presence of 25
µg/ml of the transcription inhibitor 5,6-dichlorobenzimidazole
riboside (DRB) and evaluated the time-dependent cAspAT mRNA decrease by
Northern blot. As shown in Fig. 6B
, cAspAT mRNA degradation rate was
similar whether cells were incubated or not in the presence of glucose.
Thus, glucose did not change cAspAT mRNA half-life, strongly suggesting
that cAspAT gene transcription rate was the regulated step.
To determine whether the glucose effect was mediated by the promoter
region of the cAspAT gene, we used the p-2405/-26:CAT construct
previously shown to be hormone-responsive when transfected into Fao
hepatoma cells (19). This construct contains the -2405 to -26 bp
relative to the translation start site of the cAspAT gene fused to the
chloramphenicol acetyltransferase reporter gene. We cotransfected
3T3-F442A adipoblasts with p-2405/-26:CAT and pSV2-NEO which conferred
resistance of the transfected cells to the neomycin analog geneticin
(G418). Twelve individual clones were randomly selected. Eleven
retained the ability to differentiate into adipocytes. Among these
stably transfected clones, five expressed CAT at a substantial level,
with specific activities ranging from 2.4 to 35 mU/mg protein after
adipocyte differentiation (Fig. 7
). All
these clones responded to a 24-h glucose deprivation by an increase in
CAT activity although to a variable extent (1.4- to 6.2-fold) (Fig. 7
).
In contrast, two previously characterized stable transfectants bearing
-2100 to +69 bp of the phosphoenolpyruvate carboxykinase gene promoter
fused to the CAT gene (PEPCK-CAT) (44) did not respond to glucose
deprivation by a significant change in CAT gene expression (Fig. 7
).
Therefore, the 5'-flanking region of the cAspAT gene promoter
specifically contains a negative glucose-response region.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. Effect of glucose deprivation on CAT expression in
-2405/-26cAspAT-CAT/3T3-F442A and -2100/+69PEPCK-
CAT/3T3-F442A stable transfectants. Independent stable
transfectants were allowed to differentiate then cultured for 24 h
in serum-free medium with or without 25 mM glucose before
measurement of CAT activity. For each transfectant, result represents
the mean ± SEM of data obtained from three
independent experiments with duplicate dishes.
|
|
Identification of the negative glucose-response region in the
cAspAT gene promoter
We stably transfected 3T3-F442A cells with various 5' deletions of
the cAspAT gene promoter driving CAT. For each deletion, at least five
stable clones were analyzed for their response to a 24 h glucose
deprivation. Results in Fig. 8
are
presented as the mean increase in CAT activity by glucose deprivation.
A deletion from -1984 to -1718 bp of the promoter abolished glucose
response showing that a glucose-response element(s) was present in that
fragment of the promoter. Glucose response was also abolished with a
shorter construct (Fig. 8
).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 8. Effect of glucose deprivation on CAT expression in
cAspAT-CAT/3T3-F442A stable transfectants with various deletions of the
cAspAT gene promoter. 3T3-F442A cells were stably transfected with CAT
constructs containing various deletions of the cAspAT gene promoter.
For each construct, independent stable transfectants were allowed to
differentiate then cultured for 24 h in serum-free medium with or
without 25 mM glucose before measurement of CAT activity.
For each construct, selected transfectants expressed CAT activity at
1200 mU/mg protein in the presence of glucose. For each construct,
values represent the mean ± SEM of data obtained from
five independent clones. *, P < 0.05 (Students
t test for unpaired data) when compared with
p-300/-26:CAT.
|
|
The role of the glucose-responsive DNA fragment was further confirmed
by the construction of two plasmids bearing -1984 to -1702 bp of the
cAspAT gene at the 5'-end position of either the thymidine kinase (TK)
promoter or the
MTV promoter, which was deleted of the steroid
response region of the wild-type mouse mammary tumor virus long
terminal repeat. Stable transfectants were obtained and tested for
their glucose response. The p-1984/-1702
MTV:CAT and
p-1984/-1702TK:CAT both responded to glucose deprivation by a 1.7-fold
increase (P
0.05) in CAT activity, whereas
MTV
was unaffected and TK-driven CAT expression was slightly repressed
(data not shown). Such a blunted response when using a heterologous
promoter is a frequently observed phenomenon that can be due to the
difference in the positioning of the cis-element
relative to the transcription start site of the transgene. Similar
experiments were then carried out using a shorter fragment (-1838 to
-1702 bp) of the cAspAT gene placed at the 5'-end of the TK gene
(p-1838/-1702TK:CAT). Stable p-1838/-1702TK:CAT/3T3-F442A
transfectants responded to glucose deprivation by a 2.6-fold
increase in CAT activity. Hence, a glucose-response element(s) is
present in the fragment of the cAspAT gene promoter between -1838 and
-1702 bp. However, we cannot exclude that another region of the gene
also plays a role in the regulation by glucose.
Analysis of protein-DNA interactions in the glucose-response region
of the cAspAT gene promoter
The -1838/-1702 fragment of the cAspAT gene promoter was
analyzed by DNAseI footprinting using nuclear extracts from
glucose-treated or glucose-deprived cells. Several footprints were
observed showing that this region contains binding sites for adipocyte
nuclear proteins (Fig. 9
). The regions
spanning the sequence -1747/-1729 and -1720/-1702 were totally
protected. A large region extending from -1835 to -1759 was only
partially protected and included a hypersensitive site at -1799. A
similar pattern was observed on the noncoding strand. There was no
significant difference between the binding patterns of nuclear extracts
from glucose-treated or glucose-deprived cells. Such an absence of
modification is not entirely surprising because it has been reported
for either footprinting or gel retardation assays in several cases
(45, 46, 47, 48, 49). This suggests that glucose regulates the transactivation
properties of the transcription factor(s) rather than its binding
properties to DNA.

View larger version (85K):
[in this window]
[in a new window]
|
Figure 9. DNase I footprinting analysis of the rat cAspAT
gene promoter in the presence of nuclear extracts from 3T3-F442A
adipocytes. The probe used covers the sequence from -1838 to -1702.
It was labeled on the coding strand at the BamHI site
and on the noncoding strand at the EcoRI site.
Boxes to the left represent the observed footprints with
the numbers indicating their limits. Hypersensitive sites are indicated
by stars. G + A represents a Maxam and Gilbert reaction on the same
sequence.
|
|
 |
Discussion
|
|---|
Cytosolic AspAT has been shown to be regulated in liver by several
hormones and during development (19). These regulations are mediated by
the cAspAT gene promoter. Nutrients also play an important role in the
regulation of this gene, although the targeted tissue is different.
Indeed, physiological concentrations of glucose repress the cAspAT gene
expression in adipocytes but not in several other cell lines that we
have tested, including hepatoma cell lines. Thus, while the basal
expression of this gene is ubiquitous, its regulation by glucose
appears to be cell specific, at least within all the culture systems
that we tested, and in this respect is similar to its regulation by
hormones such as glucocorticoids and insulin. However, a major
difference between the two types of regulations is that the hormonal
effects are essentially hepatocyte-specific, whereas the glucose effect
is adipocyte-specific. Furthermore, both the hormonal and the glucose
effects are gene-specific, in that only the cytosolic isoform of AspAT
and not the mitochondrial one is regulated.
In adipocytes, cAspAT could contribute to glyceroneogenesis by
generating oxaloacetate in the cytoplasm. It is well known that a
carbohydrate-rich diet would tend to repress this metabolic pathway. In
the case of cAspAT, our results suggest that this may occur through
increased glycemia. The regulation of PEPCK, another enzyme involved in
glyceroneogenesis, is more complex as it has been shown to be repressed
by glucose in adipose tissue explants in culture (10), but not in
3T3-F442A adipocytes (11). Nevertheless, in the latter cells, glucose
inhibits fatty acid-induced PEPCK gene expression (11). Furthermore,
insulin represses induction of PEPCK mRNA by cAMP in these cells
(50).
We have found no evidence for the regulation of the cAspAT gene
expression by insulin in 3T3-F442A adipocytes. In contrast, this
hormone represses this gene in hepatic cells. Thus, increased glucose
intake has a negative effect on cAspAT gene expression in both liver
and adipocytes, but through different mechanisms. In the latter case,
it acts directly through a glucose metabolite, while in the former
case, it acts through the increase in insulin concentration that is
associated with it. In this respect, it is interesting to note that the
same promoter region contains elements responsible for the negative
effects of both insulin and glucose. It is not known yet whether
signaling by both compounds converge on the same DNA element or on the
same transcription factor, and we cannot exclude that glucose acts also
through other sequences.
Few other genes encoding metabolic enzymes have been shown to be
regulated by glucose in adipose tissue. The most studied ones are those
encoding fatty acid synthase and acetylCoA carboxylase. However, unlike
cAspAT, both genes are induced by glucose (10, 12). In hepatic cells,
L-pyruvate kinase, Spot 14, aldolase B, and glucose-6-phosphatase mRNAs
are induced by glucose (6, 7, 51, 52, 53). Among genes encoding metabolic
proteins, glucose has been shown to repress the Glut 1 glucose
transporter. However, unlike cAspAT, the repression of Glut 1 can be
observed in several different cell types (54). The mechanism of glucose
action has been investigated at least in the case of fatty acid
synthase in adipocytes and L-pyruvate kinase in liver cells. In both
cases, glucose-6-phosphate has been shown to mediate the glucose
effect. This is also what we have demonstrated for cAspAT gene
regulation (Fig 5
). Identically, our result suggests that
phosphorylation of glucose is critical for its transcriptional action
on the cAspAT gene. In contrast to what has been observed for
L-pyruvate kinase (43), glucose-6-phosphatase (55) and fatty acid
synthase and S14 genes (56) in hepatocytes, xylitol does not reproduce
glucose action on cAspAT gene expression in adipocytes. Thus, we have
no evidence that the pentose phosphate pathway may be involved in our
case.
The mechanism of action of phosphorylated glucose on the
inhibition of the cAspAT gene transcription is not likely the result of
the direct activation of a preexisting transcription factor because
gene inhibition is relatively delayed with respect to glucose addition
to the culture medium (6 h) and is blocked by protein synthesis
inhibitors. Further investigations will determine whether glucose
6-phosphate acts by itself on a primary responsive gene, mediating its
effect on cAspAT gene, or whether it interferes in some way with the
intracellular metabolism generating other metabolites that could be the
actual transcription activators.
The regulatory gene, gadd153 has been shown to be under negative
control by glucose in adipocytes (57). Gadd153, also referred to as
CHOP-10, is a dominant negative inhibitor of the transcription factors
CAAT/enhancer-binding protein (C/EBP) and the liver-enriched
transcriptional activator protein (LAP) (58). This could be of
particular interest with regard to the glucose regulation of the cAspAT
gene because its basal promoter is activated by C/EBP (35). However, we
have shown that the 300 bp proximal promoter fragment that contains
high affinity C/EBP sites is not regulated by glucose (Fig. 7
). The
region responsible for glucose regulation is distal (-1838 to -1702)
and contains consensus sequences for the activator protein 1 (AP1) and
the helix-loop-helix (HLH) family of transcription factors and
degenerated sequences for recognition of the octamer proteins,
hepatocyte nuclear factor 3 (HNF3) and C/EBP. As mentioned, this
complex region also mediates the hormonal regulation of cAspAT in
hepatocytic cells in addition to its nutritional regulation (19). We
are currently investigating the contribution of the various sites and
the possible convergence of the various regulations on the same
sites.
 |
Acknowledgments
|
|---|
We wish to thank Dr. Howard Green (Boston, MA) for providing us
with the 3T3-F442A cell line, Drs. Daryl Granner (Nashville, TN) and
Richard Planells (INSERM, Marseille, France) for PEPCK and S14
plasmids, respectively, and Dr. Jean Girard (CNRS, Meudon, France) for
helpful discussions. We are grateful to Martine Glorian (CNRS, Meudon,
France) for her help with primary cultures and to Dr Alena Leroux
(INSERM U.129) for her cooperation during in vivo
studies.
 |
Footnotes
|
|---|
1 This work was supported by Centre National de la Recherche
Scientifique, Institut National de la Santé et de la Recherche
Médicale, and the Université Paris-Val de Marne. 
2 Recipients of a fellowship from the French Ministère de
lEducation Nationale, de la Recherche et de la Technologie. 
3 1996 Laureate of the award of the Société de Nutrition
de Langue Française. 
Received April 1, 1998.
 |
References
|
|---|
-
Diaz Guerra MJM, Bergot MO, Martinez A, Cuif MH,
Kahn A, Raymondjean M 1993 Functional characterization of the
L-type pyruvate kinase gene glucose response complex. Mol. Cell Biol 13:77257733
-
Thompson HS, Towle HC 1991 Localisation of the
carbohydrate respone element of the rat L-type pyruvate kinase gene.
J Biol Chem 266:86798682[Abstract/Free Full Text]
-
Bergot MO, Diaz Guerra MJM, Puzenat N, Raymondjean M,
Kahn A 1992 Cis-regulation of the L-type pyruvate kinase gene
promoter by glucose, insulin and cyclic AMP. Nucleic Acids Res 20:18711878[Abstract/Free Full Text]
-
Liu Z, Thompson KS, Towle HC 1993 Carbohydrate
regulation of the rat L-type pyruvate kinase gene requires two nuclear
factors LF-A1 and a member of c-myc family. J Biol Chem 268:1278712795[Abstract/Free Full Text]
-
Kaytor EN, Shih H, Towle HC 1997 Carbohydrate
regulation of hepatic gene expression. J Biol Chem 272:75257531[Abstract/Free Full Text]
-
Shih H, Towle HC 1992 Definition of carbohydrate
response element of the rat S14 gene. J Biol Chem 267:1322213228[Abstract/Free Full Text]
-
Shih H, Towle HC 1994 Definition of the
carbohydrate response element of the rat S14 gene. J Biol Chem 269:93809387[Abstract/Free Full Text]
-
Meyer S, Höpnner W, Seitz HJ 1991 Transcriptional and post-transcriptionnal effects of glucose on liver
phosphoenolpyruvate carboxykinase gene expression. Eur J Biochem 202:985991[Medline]
-
Kahn RC, Lauris V, Koch S, Crettaz M, Granner DK 1989 Acute and chronic regulation of phosphoenolpyruvate carboxykinase
mRNA by insulin and glucose. Mol Endocrinol 3:840845[Abstract]
-
Foufelle F, Gouhot B, Perdereau D, Girard J, Ferre
P 1994 Regulation of lipogenic enzyme and phosphoenolpyruvate
carboxykinase gene expression in cultured white adipose tissue. Eur
J Biochem 223:893900[Medline]
-
Antras-Ferry J, Le Bigot G, Robin P, Robin D, Forest
C 1994 Stimulation of phosphoenolpyruvate carboxykinase gene
expression by fatty acids. Biochem Biophys Res Commun 203:385391[CrossRef][Medline]
-
Foufelle F, Gouhot B, Pégorier JP, Perdereau D,
Girard J 1992 Glucose stimulation of lipogenic enzyme gene
expression in cultured white adipose tissue. J Biol Chem 267:2054320546[Abstract/Free Full Text]
-
Moustaïd N, Sul HS 1991 Regulation of
expression of the fatty acid synthase gene in 3T3L1 cells by
differentiation and triiodothyronine. J Biol Chem 266:1855018554[Abstract/Free Full Text]
-
Moustaïd N, Sakamoto K, Clarke S, Beyer SR, Sul
HS 1993 Regulation of fatty acid synthase gene transcription.
Biochem J 292:767772
-
Katunuma N, Okada M, Nishh Y 1966 Regulation of the
urea cycle and TCA cycle by ammonia. Adv Enzyme Regul 4:317335[CrossRef][Medline]
-
Pavé-Preux M, Ferry N, Bourguet J, Hanoune J,
Barouki R 1988 Nucleotide sequence and glucocorticoid regulation
of the mRNAs for isoenzymes of rat aspartate aminotransferase. J
Biol Chem 263:1745917466[Abstract/Free Full Text]
-
Sharma R, Patnaik SK 1987 Regulation of aspartate
aminotransferase isoenzymes by hydrocortisone in the liver of aging
rats. Arch Gerontol Geriatr 6:2732[CrossRef][Medline]
-
Barouki R, Pavé-Preux M, Bousquet-Lemercier B, Pol
S, Bouguet J, Hanoune J 1989 Regulation of cytosolic aspartate
aminotransferase mRNAs in the Fao rat hepatoma cell line by
dexamethasone, insulin and cyclic AMP. Eur J Biochem 186:7985[Medline]
-
Aggerbeck M, Garlatti M, Feilleux-Duché S,
Veyssier C, Daheshia M, Hanoune J, Barouki R 1993 Regulation of
the cytosolic aspartate aminotransferase housekeeping gene promoter by
glucocorticoids, cAMP, and insulin. Biochemistry 32:90659072[CrossRef][Medline]
-
Reshef L, Hanson RW, Ballard JF 1970 A possible
physiological role for glyceroneogenesis in rat adipose tissue. J
Biol Chem 245:59795984[Abstract/Free Full Text]
-
Plee-Gautier E, Grimal H, Aggerbeck M, Barouki R, Forest
C 1998 Cytosolic aspartate aminotransferase gene is a member of
the glucose-regulated protein gene family in adipocytes. Biochem J 329:3740
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Yang H, McLeese J, Weisbart M, Dionne JL, Lemaire I,
Aubin RA 1993 Simplified high throughput protocol for Northern
hybridization. Nucleic Acids Res 21:33373338[Free Full Text]
-
Beale EG, Chrapkiewicz NB, Scoble HA, Metz RJ, Quick DP,
Noble RL, Donelson JE, Biemann K, Granner DK 1985 Rat hepatic
cytosolic phosphoenolpyruvate carboxykinase (GTP). J Biol Chem 260:1074810760[Abstract/Free Full Text]
-
Planells R, Peyrol N, deGroot LJ, Henry M, Cartouzou G,
Torresani J 1991 Production of rat Spot14 protein in
Escherichia coli. Gene 99:205209[CrossRef][Medline]
-
Plée-Gautier E, Grober J, Duplus E, Langin D,
Forest C 1996 Inhibition of hormone-sensitive lipase gene
expression by cAMP and phorbol esters in 3T3F442A and BFC-1
adipocytes. Biochem J 318:10571063
-
Umesono K, Giguere V, Glass CK, Rosenfeld MG, Evans
RM 1988 Retinoic acid and thyroid hormone induce gene expression
through a common responsive element. Nature 336:262265[CrossRef][Medline]
-
Franckhauser S, Antras-Ferry J, Robin P, Robin D, Forest
C 1994 Glucocorticoids antagonize retinoic acid stimulation of
PEPCK gene transcription in 3T3F442A adipocytes. Cell Mol Biol
-
Southern PJ, Berg P 1982 Transformation of
mammalian cells to antibiotic resistance with a bacterial gene under
control of SV40 early region promoter. J Mol Appl Genet 1:327341[Medline]
-
Forest C, Doglio A, Ricquier D, Ailhaud G 1987 A
preadipocyte clonal line from mouse brown adipose tissue. Short- and
long-term responses to insulin and. Exp Cell Res 168:21832[CrossRef][Medline]
-
Parli JA, Godfrey DA, Ross CD 1987 Separate
enzymatic microassays for aspartate aminotransferase isoenzymes.
Biochim Biophys Acta 925:175184[Medline]
-
Forest CD, Obrien RM, Lucas PC, Magnuson MA, Granner
DK 1990 Regulation of phosphoenolpyruvate carboxykinase gene
expression by insulin. Use of the stable transfection approach to
locate an insulin responsive sequence (IRS). Mol Endocrinol 4:13021310[Abstract]
-
Seed B, Sheen JY 1988 A simple phase-extraction
assay for chloramphenicol acetyltransferase activity. Gene 67:271277[CrossRef][Medline]
-
Vaulont S, Puzenat N, Levrat F, Cognet M, Kahn A,
Raymondjean M 1989 Proteins binding to the liver-specific pyruvate
kinase gene promoter. A unique combination of known factors. J Mol Biol 209:205219[CrossRef][Medline]
-
Garlatti M, Tchesnokov V, Daheshia M,
Feilleux-Duché S, Hanoune J, Aggerbeck M, Barouki R 1993 CCAAT/Enhancer-binding protein-related proteins bind to the unusual
promoter of the aspartate aminotransferase housekeeping gene. J
Biol Chem 268:65676574[Abstract/Free Full Text]
-
Horio Y, Tanaka T, Taketoshi M, Uno T, Wada H 1988 Rat cytosolic aspartate aminotransferase regulation of its mRNA and
contribution to gluconeogenesis. J Biochem 103:805808[Abstract/Free Full Text]
-
Botion LM, Kettelhut IC, Migliorini RH 1995 Increased adipose tissue glyceroneogenesis in rats adapted to a high
protein, carbohydrate-free diet. Horm Metab Res 27:310313[Medline]
-
Clarke SD, Jump DB 1994 Dietary polyunsaturated
fatty acid regulation of gene transcription. Annu Rev Nutr 14:8398[CrossRef][Medline]
-
Peret J, Foustock S, Chanez M, Bois-Joyeux B, Assan
R 1981 Plasma glucagon and insulin concentrations and hepatic
phosphoenolpyruvate carboxykinase and pyruvate kinase activities during
and upon adaptation of rats to a high protein diet. J Nutr 111:11731184
-
Green H, Kehinde O 1976 Spontaneous heritable
changes leading to increased adipose conversion in 3T3 cells. Cell 7:105113[CrossRef][Medline]
-
Cornelius P, MacDougald OA, Lane MD 1994 Regulation
of adipocyte development. Annu Rev Nutr 14:99129[CrossRef][Medline]
-
Okuno M, Caraveo VE, Goodman DS, Blaner WS 1995 Regulation of adipocyte gene expression by retinoic acid and hormones
effects on the gene encoding cellular retinol-binding protein. J Lipid
Res 36:137147[Abstract]
-
Doiron B, Cuif MH, Chen R, Kahn A 1996 Transcriptional glucose signaling through the glucose response element
is mediated by the pentose phosphate pathway. J Biol Chem 271:53215324[Abstract/Free Full Text]
-
Antras-Ferry J, Franckhauser S, Robin D, Robin P,
Granner DK, Forest C 1994 Expression of the phosphoenolpyruvate
carboxykinase gene in 3T3F442A adipose cells effects of retinoic acid
and differentiation. Biochem J 302:943948
-
Mitanchez D, Doiron B, Chen R, Kahn A 1997 Glucose-stimulated genes and prospects of gene therapy for type I
diabetes. Endocr Rev 18:520540[Abstract/Free Full Text]
-
Daniel S, Zhang S, DePaoli-Roach A, Kim K 1996 Dephosphorylation of Sp1 by protein phosphatase 1 is involved in the
glucose-mediated activation of the acetyl-CoA carboxylase gene. J
Biol Chem 271:1469214697[Abstract/Free Full Text]
-
Faber S, OBrien RM, Imai E, Granner DK, Chalkley
R 1993 Dynamic aspects of DNA/protein interactions in the
transcriptional initiation complex and the hormone-responsive domains
of the phosphoenolpyruvate carboxykinase promoter in vivo.
J Biol Chem 268:2497624985[Abstract/Free Full Text]
-
OBrien RM, Lucas PC, Forest CD, Magnuson MA, Granner
DK 1990 Identification of a sequence in the PEPCK gene that
mediates a negative effect of insulin on transcription. Science 249:533537[Abstract/Free Full Text]
-
Suwanickul A, Morris SL, Powell DR 1993 Identification of an insulin- responsive element in the promoter of
the human gene for insulin-like growth factor binding protein-1. J
Biol Chem 268:1706317068[Abstract/Free Full Text]
-
Beale EG, Tishler E J 1992 Expression and
regulation of cytosolic phosphoenolpyruvate carboxykinase in 3T3L1
adipocytes. Biochem Biophys Res Commun 189:925930[CrossRef][Medline]
-
Decaux JF, Marcillat O, Pichard AL, Henry J, Kahn A 1991 Glucose-dependent and independent effect of insulin on gene
expression. J Biol Chem 266:34323438[Abstract/Free Full Text]
-
Argaud D, Kiby TL, Newgard CB, Langes AL 1997 Stimulation of glucose-6-phosphatase gene expression by glucose and
fructose-2,6-bisphosphate. J Biol Chem 272:1285412861[Abstract/Free Full Text]
-
Vaulont S, Kahn A 1994 Transcriptional control of
metabolic regulation genes by carbohydrates. FASEB J 8:2835[Abstract]
-
Wertheimer E, Sasson S, Cerasi E, Ben-Neriah Y 1991 The ubiquitous glucose transporter GLUT-1 belongs to the
glucose-related protein family of stress-inducible proteins. Proc Natl
Acad Sci USA 88:25252529[Abstract/Free Full Text]
-
Massillon D, Chen W, Barzilai N, Prus-Wertheimer D,
Hawkins M, Liu R, Taub R, Rossetti L 1998 Carbon flux via the
pentose phosphate pathway regulates the hepatic expression of the
glucose-6-phosphatase and phosphoenolpyruvate carboxykinase genes in
conscious rats. J Biol Chem 273:228234[Abstract/Free Full Text]
-
Mourrieras F, Foufelle F, Foretz M, Morin J, Bouche S,
Ferré P 1997 Induction of fatty acid synthase and S14 gene
expression by glucose, xylitol and dihidroxyacetone in cultured rat
hepatocytes is closely correlated with glucose-6-phosphate
concentrations. Biochem J 326:345349
-
Carlson SG, Fawcett TW, Bartlett JD, Bernier M, Holbrook
NJ 1993 Regulation of the C/EBP-related gene gadd153 by glucose
deprivation. Mol Cell Biol 13:47364744[Abstract/Free Full Text]
-
Ron D, Habener JF 1992 CHOP, a novel
developmentally regulated nuclear protein that dimerizes with
transcription factors C/EBP and LAP and functions as a
dominant-negative inhibitor of gene transcription. Genes Dev 6:439453[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. Tordjman, S. Leroyer, G. Chauvet, J. Quette, C. Chauvet, C. Tomkiewicz, C. Chapron, R. Barouki, C. Forest, M. Aggerbeck, et al.
Cytosolic Aspartate Aminotransferase, a New Partner in Adipocyte Glyceroneogenesis and an Atypical Target of Thiazolidinedione
J. Biol. Chem.,
August 10, 2007;
282(32):
23591 - 23602.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Khazen, E. Distel, M. Collinet, V. E. Chaves, J.-P. M'Bika, C. Chany, A. Achour, C. Benelli, and C. Forest
Acute and Selective Inhibition of Adipocyte Glyceroneogenesis and Cytosolic Phosphoenolpyruvate Carboxykinase by Interferon {gamma}
Endocrinology,
August 1, 2007;
148(8):
4007 - 4014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Hittel, W. E. Kraus, C. J. Tanner, J. A. Houmard, and E. P. Hoffman
Exercise training increases electron and substrate shuttling proteins in muscle of overweight men and women with the metabolic syndrome
J Appl Physiol,
January 1, 2005;
98(1):
168 - 179.
[Abstract]
[Full Text]
[PDF]
|
 |
|