help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plee-Gautier, E.
Right arrow Articles by Forest, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plee-Gautier, E.
Right arrow Articles by Forest, C.
Endocrinology Vol. 139, No. 12 4936-4944
Copyright © 1998 by The Endocrine Society


ARTICLES

Identification of an Adipocyte-Specific Negative Glucose Response Region in the Cytosolic Aspartate Aminotransferase Gene1

Emmanuelle Plee-Gautier2,3, Martine Aggerbeck, Fadéla Beurton2, Bénédicte Antoine, Hélène Grimal, Robert Barouki and Claude Forest

Centre de Recherche sur l’Endocrinologie Moléculaire et le Développement (E.P.-G., H.G., C.F.), Centre National de la Recherche Scientifique, 92190 Meudon, France; Institut National de la Santé et de la Recherche Médicale Unité 490 (M.A., F.B., R.B.), Centre Universitaire des Saints-Pères, 75006 Paris, France; Institut National de la Santé et de la Recherche Médicale Unité 129 (B.A.), Institute Cochin de Génétique Moléculaire, Centre Hospitalier Universitaire Cochin, 75014 Paris, France

Address all correspondence and requests for reprints to: Dr. Claude Forest, Centre de Recherche sur l’Endocrinologie Moléculaire et le Développement, CNRS, 9 rue Jules Hetzel, 92190 Meudon, France. E-mail: forest{at}cnrs-bellevue.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytosolic aspartate aminotransferase (cAspAT) participates in gluconeogenesis in the liver and is expected to exert a glyceroneogenic function in the adipose tissue when the supply of glucose is limited. Here we demonstrate that adipose cAspAT messenger RNA (mRNA) is increased when rats are fed a low carbohydrate diet. In the 3T3-F442A, BFC-1 adipocyte cell lines and differentiated adipocytes in primary culture, a 24 h glucose deprivation induces approximately a 4-fold increase in cytosolic AspAT (cAspAT) mRNA, whereas mitochondrial AspAT mRNA remains unchanged. cAspAT activity is also increased in a weaker but reproducible manner. Addition of glucose within a physiological range of concentrations reverses the increase of cAspAT mRNA in 8 h (EC50 = 1.25 g/liter). Such a regulation requires protein synthesis and is specific for adipocytes differentiated in culture. It does not occur in Fao or H4IIE hepatoma cells, in C2 muscle cells, or in 293 kidney cells. 2-deoxyglucose mimicks glucose, while 3-orthomethyl-glucose has no effect, suggesting that glucose-6-phosphate is the effector. cAspAT mRNA stability is not affected by glucose deprivation. To ascertain the transcriptional nature of the glucose effect, we have stably transfected 3T3-F442A adipoblasts with constructs containing the chloramphenicol acetyltransferase reporter gene under the control of either 5'-deletions of the cAspAT gene promoter or internal fragments in an heterologous context. We demonstrate that a glucose response element(s) is present in the region between -1838 and -1702 bp relative to the translation start site. In this region, three DNA sequences bind nuclear proteins from adipocytes as shown by footprinting experiments. Our results indicate that cAspAT gene transcription is repressed by glucose selectively in adipocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GLUCOSE regulates the expression of several genes that encode metabolic enzymes. It has been postulated that these effects of glucose mediate the regulation of several genes by insulin. Most studies have dealt with positive regulation as in the case of the L-type pyruvate kinase (L-PK). In liver and in cultured hepatocytes, glucose induces the expression of the L-PK gene via a glucose response element (GlRE) present in the promoter of the gene (1, 2, 3, 4). This GlRE consists of two palindromic binding sites for upstream stimulating factor (USF) proteins separated by 5 bp (3). However, the implication of this transcription factor in glucose regulation is controversial (5). An element with a similar structure, termed carbohydrate response element, has also been identified in the regulatory region of the spot 14 gene (6, 7). Conversely, glucose inhibits phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32; PEPCK) gene expression in hepatocytes (8), hepatoma cells (9) and cultured white adipose tissue (10) and represses the stimulation of fatty acid-induced PEPCK messenger RNA (mRNA) in adipocytes (11), through still undeciphered mechanisms. In cultured adipose tissue, glucose stimulates fatty acid synthase and acetyl-CoA carboxylase mRNAs (10, 12). Interestingly, all the genes of these enzymes are also under multihormonal control (10, 13, 14). Hence, the interplay of nutrients and hormones results in a fine tuning of expression of these genes.

Cytosolic aspartate aminotransferase (cAspAT; EC 2.6.1.1) is a metabolic enzyme which participates in an ubiquitous function, the malate aspartate shuttle and in gluconeogenesis, a tissue-specific regulated pathway. Regulation of cAspAT gene expression has been extensively studied in liver and kidney. In these tissues cAspAT activity is induced by a low carbohydrate diet, starvation, diabetes, and hydrocortisone (15, 16, 17). In cultured Fao hepatoma cells, glucocorticoids are strong stimulators of cAspAT activity, mRNA, and gene transcription. cAMP potentiates the glucocorticoid effect, whereas insulin inhibits it (18, 19). None of these effectors affects the mitochondrial isoform of AspAT (mAspAT), showing that the hormonal control is specific for cAspAT and consistent with the participation of the latter enzyme in gluconeogenesis.

cAspAT is also expressed in adipose tissue in which its physiological role is not clear. PEPCK, the rate limiting enzyme in hepatic gluconeogenesis, which yields phosphoenolpyruvate from oxaloacetate, is also expressed in adipose tissue where it performs a glyceroneogenic function when glucose supply to the tissue and glycolysis are low (20). Because cAspAT allows the generation of oxaloacetate in the cytoplasm, it is postulated that it is also involved in glyceroneogenesis in adipose tissue under conditions of restrained glucose transport and utilization. We have previously shown that the cAspAT gene expression in 3T3-F442A adipocytes is raised by various conditions including glucose deprivation (21). Here we demonstrate that adipose cAspAT mRNA is increased when rats are fed a low carbohydrate diet, and we analyze the mechanism by which glucose represses cAspAT gene expression in cultured 3T3-F442A adipocytes. This regulation appears specific to adipocytes and is exerted in a physiological range of glucose concentrations. In addition, we have localized the region of the promoter that mediates the negative glucose regulation of cAspAT gene expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and diets
Male Wistar rats bred in our laboratory were used. They were housed in individual cages at a constant temperature of 24 C. Rats weighing 180–200 g were used by groups of six animals. The first group received the high carbohydrate (HC) diet ad libitum for 11 days, the second group was fed the low carbohydrate (LC) diet for 11 days, and the third group received the LC diet for 10 days followed by 24 h of HC diet. The HC diet had the following composition (g/100 g of diet) sucrose (10), starch (60), casein (10), oil (8), vitamin (1), mineral mixture (4), and cellulose (7). In the LC diet, sucrose and starch were replaced by casein. The periepididymal fat pads were removed, immediately frozen in liquid nitrogen and stored at -80 C for subsequent RNA extraction.

Cell culture and treatment
3T3-F442A and BFC-1 adipoblasts, C2.7 myoblasts, and 293 cells were cultured at 37 C in a humidified atmosphere of 10% CO2/90% air in DMEM containing 4.5 g/liter glucose, 200 IU/ml penicillin, 50 mg/liter streptomycin, 8 mg/liter biotin, 4 mg/liter pantothenate, 3.7 g/liter bicarbonate, and supplemented with 10% FCS (Medium A) for adipoblasts and 293 cells and with 20% FCS for myoblasts. Adipose differentiation was achieved in the same medium enriched with 0.02 µM insulin for 8 days. C2.7 myocytes were obtained by culturing confluent cells in medium containing 1% FCS for 3 days. Fao and H4IIE hepatoma cells were cultured in Ham’s F12 medium containing 1.26 g/liter glucose, 200 IU/ml penicillin, 50 mg/liter streptomycin, 3.7 g/liter bicarbonate and 10% FCS. Cells were shifted to serum-free, insulin-free medium for 24 h (or 48 h when indicated), during which treatment with effectors was performed for the indicated times before RNA extraction and assays of CAT or cAspAT activity. When glucose was omitted, medium was enriched with 1 mM pyruvate and 0.1 mM lactate. For primary cultures, inguinal adipose tissue from 3-day-old C57 BL/6J mice was cut in small fragments that were maintained at the bottom of a 60-mm diameter culture dish in 1 ml of medium A for 3 days to permit attachment. Explants were then cultured for 8 days in 4 ml of medium A to allow sufficient migration of the cells out the explants. Cells were then replated at a density of 3 x 105 cells/60-mm dish and cultured in a manner identical to the 3T3-F442A cell line.

RNA extraction and analysis
Cells from two 60-mm dishes were pooled, and RNA was extracted according to the method of Chomczynski and Sacchi (22). RNA extraction from adipose tissue was performed by the TriPure isolation reagent (Boehringer Mannheim) according to the manufacturer’s instructions. Total RNA was electrophoresed on a 1% agarose gel containing 2.2 M formaldehyde and blotted onto a nylon membrane. The integrity and relative amounts of RNA were assessed by methylene blue staining. Prehybridization and hybridization of the blots were performed according to Yang and colleagues (23). Membranes were hybridized overnight at 65 C in 0.27 M NaCl, 1.5 mM EDTA, 15 mM sodium phosphate (pH 7.7) containing 7% SDS, 10% polyethylene glycol 6000, 250 µg/ml sonicated salmon sperm DNA, 250 µg/ml heparin and 106 cpm/ml of complementary DNA (cDNA) labeled with [{alpha}32P] dCTP (Amersham) by random priming according to the manufacturer’s recommendation. Membranes were washed twice for 15 min at room temperature with 2 x SSC (1 x SSC is 0.3 M NaCl, 0.03 M sodium citrate, pH 7), 0.1% SDS and then for 30 min at 60 C with 0.1 x SSC, 0.1% SDS. Specific cDNA probes used were the cAspAT (4B21) (16), mAspAT (16), PEPCK (PC116) (24), S14 (PT76) (25) and ß-actin (pA21). An oligonucleotide specific for the 18S ribosomal RNA was 32P end-labeled and used as a control, as described previously (26). The mRNA signal was quantified by scanning densitometry and was corrected for differences in RNA loading by comparison with the signals generated by the ß-actin or the 18S rRNA probe.

Plasmid constructs
The p-2405/-26:CAT, p-1984/-26:CAT, p-1718/-26:CAT and p-300/-26:CAT were previously described (19). In these constructs the -26 bp is relative to the translation start site (19). The plasmid {Delta}MTV:CAT, derived from the plasmid MMTV:CAT by deletion of the sequence from position [mins]190 to -88 of the mouse mammary tumor virus long terminal repeat was a gift of Dr. R. Evans (San Diego, CA) and was described elsewhere (27). The plasmids -1984/-1702{Delta}MTV:CAT, p-1984/-1702TK:CAT and p-1838/-1702TK:CAT were obtained by subcloning fragments of the cAspAT gene promoter obtained by PCR into the HindIII site of the p{Delta}MTV:CAT vector or of the pTK:CAT, which contains -105 bp of the herpes simplex thymidine kinase promoter linked to the CAT gene. These fragments were amplified from the p-2405/-26:CAT plasmid, using the primers 5' TAGTAGAAGCTTAGGTCCAGGTTC 3' and 5' CTTCACAAGCTTAGGCAACAATGC 3' (for the -1984/-1702 fragment) and the primers 5' ATGTGCAAGCTTGTACCTAACTGAA 3' and 5' CTTCACAAGCTTAGGCAACAATGC 3' (for the -1838/-1702 fragment) which, all, contain a HindIII site for the subcloning step.

Stable transfection experiments
Exponentially growing 3T3-F442A preadipocytes (105 cells per 100 mm plates) were cotransfected by calcium phosphate-DNA coprecipitation (28) with 2 µg of pSV2-NEO (29), the expression of which confers resistance to the antibiotic geneticin together with 20 µg of CAT-expressing plasmid. Cells were treated as described (30). Transfection efficiency was about 5 x 10-5. After 2 weeks exposure to geneticin (0.4 mg/ml), several colonies of geneticin-resistant cells were isolated and analyzed. Cells from 90% of these colonies were still able to differentiate at a frequency similar to that of the parental line. About 70% of these expressed CAT. Fully differentiated adipocytes were shifted to serum-free medium and deprived or not of glucose for the last 24 h before CAT assay.

Assay of cAspAT and of CAT activities
For the separate determination of cAspAT and mAspAT, we have used the procedure of Parli et al. (31), which is based on the thermolability of mitochondrial but not cytosolic AspAT as previously described by Barouki et al. (18). Preparation of cell homogenates for CAT assays was performed as detailed (32). The method of Seed and Sheen (33) was used for CAT activity determination. One unit of CAT converts 1 µmol chloramphenicol to butyryl-chloramphenicol per minute at pH 7.8 and 37 C.

DNase I footprinting
A probe from the cAspAT gene promoter (nucleotides -1838 to -1702) was end-labeled using the Klenow fragment of DNA polymerase I. The standard reaction was performed according to Vaulont et al. (34) with some modifications (35). The nuclear proteins, 30–60 µg, prepared as mentioned previously (35) were incubated with about 1 ng of labeled probe (30,000 cpm) for 15 min on ice. After adjusting the concentration of CaCl2 to 2.5 mM and incubating for 1 min at 20 C, DNase I was added, and the digestion was carried out at 20 C for 1 min. Subsequent handling of the DNA was performed as described (34).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adipose cAspAT mRNA is increased by a low-carbohydrate diet in vivo and by glucose deprivation in 3T3-F442A cells
Cytosolic aspartate aminotransferase is expressed in vivo in all tissues analyzed so far. However, expression of the cAspAT gene has been mainly studied in liver and in cultured hepatoma cells in which it is under multihormonal control (16, 18, 36). We hypothesized that cAspAT would also be regulated in adipocytes and that nutritional conditions known to alter liver expression of cAspAT would also modify its adipose expression. To address that question, we fed rats with a diet containing either a high or a low proportion of carbohydrates and analyzed adipose cAspAT mRNA by Northern blot. Rats fed an LC diet presented a 2- to 3-fold higher concentration of cAspAT mRNA than the high carbohydrate (HC) fed rats (Fig 1AGo). Conversely, the change of regimen from LC to HC (LC/HC) for 24 h resulted in a significant lowering of cAspAT mRNA. Similar results could be observed when PEPCK was the target mRNA while S14 mRNA responded in an opposite manner (Fig. 1AGo) as expected (37, 38).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. Effect of nutrients and hormones on cAspAT mRNA in rat adipose tissue and in 3T3-F442A adipocytes. A, Three groups of six rats were fed ad libitum for 11 days by either an HC diet, an LC diet, or an LC diet for 10 days followed by 24 h of HC diet (LC/HC). RNA was extracted from periepidydimal adipose tissue and analyzed by Northern blot. Data obtained by scanning densitometry, was normalized for RNA loading using the ß-Actin mRNA signal. Data are expressed in percentage of HC diet taken as control. B, Differentiated 3T3-F442A adipocytes were cultured in medium A (CTL) then shifted for 24 h in glucose-free, serum-free medium (-glucose) or in serum-free medium supplemented with either 8-CPT-AMPc (500 µM), dexamethasone (100 nM), or insulin (1 µM). mAspAT and cAspAT mRNA were analyzed by Northern blot.

 
In addition to changes in glycemia, variations in the insulin/glucagon ratio and eventually in plasma glucocorticoids, occur between HC and LC fed rats (39). To determine which of these parameters could be the main regulator of cAspAT gene expression, we used the 3T3-F442A adipocyte cell line (40), a cell culture system widely used for gene regulation studies (41). When differentiated cells were deprived of glucose for 24 h, cAspAT mRNA was strongly elevated while it remained fairly constant when cells were treated with the cAMP analog 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP), the glucocorticoid analog dexamethasone or insulin, showing that glucose was the main effector (Fig. 1BGo).

The induction of cAspAT gene expression by glucose deprivation is specific to adipocytes
cAspAT is expressed in vivo in all cells analyzed so far in agreement with its ubiquitous function. To assess whether cells other than 3T3-F442A adipocytes would regulate cAspAT mRNA, we analyzed the glucose effect in a series of cultured cell systems. The BFC-1 adipose cell line (30) and primary adipocytes are two model systems of adipocytes for studying hormonal and nutritional controls of gene expression (41, 42). After differentiation, 3T3-F442A, BFC-1 or primary adipocytes were maintained for 24 h either in glucose-supplemented (25 mM) or in glucose-free medium before RNA isolation and Northern blot analysis with a cAspAT cDNA probe. A large increase in cAspAT mRNA occurred in glucose-starved cells (Fig. 2Go). This increase was specific to the cAspAT message because glucose deprivation did not notably affect mAspAT or actin mRNAs (Fig. 2Go). None of the nonadipose cell lines, the H4IIE and Fao hepatoma cells, the C2.7 differentiated myocytes or the 293 human transformed kidney cells, responded to glucose deprivation by a change in cAspAT mRNA (Fig. 2Go).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Effect of a 24 h glucose deprivation on cAspAT mRNA in various cell lines and in adipocytes in primary culture. 3T3-F442A and BFC-1 adipocytes, adipocytes in primary culture, subconfluent H4IIE and Fao hepatoma cells, C2.7 differentiated myocytes (muscle) or subconfluent 293 transformed kidney cells were deprived of glucose for 24 h before RNA analysis. Autoradiograms shown are representative of two experiments with identical results.

 
We next focused on 3T3-F442A adipocytes and analyzed the time course of glucose action. As shown in Fig. 3Go, cAspAT transcript raised in response to glucose deprivation in a time-dependent manner with a 4-fold increase attained at 48 h. This increase was followed by a parallel change in cAspAT enzymatic activity, which reached a specific activity of 75 mU/mg protein at 72 h, corresponding to an increase of about 2-fold above basal (Fig. 3Go). Glucose addition to the medium of cells deprived of glucose for 24 h repressed the cAspAT message with a maximal 80% decrease at 8 h, showing that the glucose effect was fully reversible (Fig. 3Go, inset). A treatment time of 8 h was chosen to investigate the dose dependence of the glucose effect. Glucose-induced decrease in cAspAT mRNA was dose dependent with a maximum reached at 4.5 g/liter and a half-maximum effect (EC50) attained at about 1.25 g/liter (Fig. 4Go).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Glucose-dependent level of cAspAT mRNA and activity in 3T3-F442A adipocytes. 3T3-F442A adipocytes were incubated in glucose-free medium for the indicated times or, as shown in inset, for 24 h before treatment with 25 mM glucose for the indicated times. RNA was analyzed by Northern hybridization with a labeled cAspAT cDNA probe. Data obtained by scanning densitometry, was normalized for RNA loading using the ß-Actin mRNA signal. Cytosolic AspAT activity was determined as described in Materials and Methods and normalized by measuring the protein concentration. Data are expressed as the percent of cAspAT signal from cells cultured in the presence of 25 mM glucose or, as shown in inset, in the absence of glucose. Each value represents the mean ± SEM of data obtained from at least three independent experiments with duplicate dishes.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Effect of glucose concentration on cAspAT mRNA in glucose-deprived 3T3-F442A adipocytes. Following 24 h of glucose deprivation, glucose was added to the culture medium at various concentrations. Eight hours later, RNA was analyzed by Northern hybridization with a labeled cAspAT cDNA probe. Data, obtained by scanning densitometry, was normalized for differences in RNA loading using the ß-Actin mRNA signal and expressed as the percent of cAspAT signal from control cells incubated 24 h in glucose-free medium. Data represent the mean of two independent experiments with duplicate dishes.

 
Effects of various hexoses or glucose analogs on cAspAT gene expression in 3T3-F442A adipocytes
To exclude the possibility that differences in cAspAT gene expression were due to differences in osmotic pressure between cells cultured in the presence and in the absence of glucose, 3T3-F442A adipocytes were treated with either 4.5 g/liter of [scap[l-glucose or 4.5 g/liter of mannitol, two sugars that are not transported into cells. Neither L-glucose nor mannitol affected the cAspAT gene expression (Fig. 5Go). Hence, the glucose- induced inhibition of cAspAT gene expression was not due to an osmotic change of the culture medium.



View larger version (89K):
[in this window]
[in a new window]
 
Figure 5. Effect of sugars on cAspAT mRNA in 3T3-F442A adipocytes. 3T3-F442A adipocytes were maintained for 24 h in culture medium in which glucose was either omitted (CTL) or changed to 25 mM of the indicated sugars. RNA was analyzed by Northern hybridization with a labeled cAspAT cDNA probe. Data obtained by scanning densitometry, was normalized for RNA loading using the ß-Actin mRNA signal. Data are expressed as the percent of cAspAT signal from 24-h glucose-deprived cells. Each value represents the mean ± SEM of data obtained from at least three independent experiments with duplicate dishes. D-gluc, D-glucose; L-gluc, L-glucose; 3-OMG, 3-orthomethyl glucose; 2-DOG, 2-deoxyglucose.

 
Next, we aimed at elucidating whether glucose or one of its metabolites was responsible for the observed effect. We treated 3T3-F442A adipocytes with various glucose analogs and analyzed the cAspAT mRNA content. Galactose or 3-orthomethyl-glucose (3-OMG), two sugars that are transported but not metabolized were inefficient (Fig. 5Go). Fructose or mannose reduced cAspAT mRNA with a magnitude equivalent to that induced by D-glucose (60–70%), showing that glucose action required transport and metabolism (Fig. 5Go). 2-deoxyglucose (2-DOG), which is transported and phosphorylated into 2-deoxyglucose 6-phosphate but not further metabolized through the glycolytic pathway, fully mimicked D-glucose, demonstrating that glucose phosphorylation was necessary and sufficient for reducing cAspAT mRNA content (Fig. 5Go). 2-DOG-6-phosphate could be further metabolised in the pentose phosphate pathway. Therefore, we tested xylitol, an intermediate of the nonoxydative branch of the pentose phosphate pathway, able to mimic glucose induction of L-pyruvate kinase gene expression in hepatocytes (43). Xylitol at concentrations of either 25 mM (Fig. 5Go), 10 mM or 0.5 mM (not shown) did not affect cAspAT mRNA. These data indicated that glucose-6-phosphate was the likely intermediate of glucose in inhibiting cAspAT gene expression.

Mechanism of the regulation by glucose of cAspAT gene expression
We wondered whether the glucose effect was direct or indirect. Before glucose treatment, we treated glucose- deprived cells with the protein synthesis inhibitor cycloheximide, at concentrations previously shown to inhibit protein synthesis (11, 26). Cycloheximide alone did not affect cAspAT mRNA, whereas it prevented almost totally the glucose-elicited inhibition of cAspAT gene expression (Fig. 6AGo). This glucose effect was also prevented in the presence of anisomycin (not shown). We conclude that glucose action did require protein synthesis.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Influence of cycloheximide and of DRB on glucose-induced inhibition of cAspAT mRNA in 3T3-F442A adipocytes. 3T3-F442A adipocytes were glucose-deprived for 24 h before cycloheximide or DRB addition. A, Cells were incubated or not for 30 min with 10 µM of cycloheximide before treatment with 25 mM glucose. 8 h later, RNA was analyzed by Northern hybridization with subsequently the cAspAT and the ß-actin cDNA probes. Autoradiogram shown is representative of two independent experiments with identical results. B, Cells were incubated with or without 25 mM glucose in the presence of 100 µM DRB. Total RNA was prepared 2, 4, 6, and 8 h later then analyzed by Northern hybridization with a labeled cAspAT cDNA probe. Data obtained by scanning densitometry, was normalized for RNA loading using the 18S rRNA signal. Data obtained by scanning densitometry are expressed in % of maximum (t = 0). Data shown are the mean ± SEM of three independent experiments with duplicate plates.

 
Changes in steady-state mRNA concentrations can be the result of variations in mRNA stability. To determine whether mRNA half-life could be affected by glucose treatment, we incubated glucose-deprived 3T3-F442A adipocytes with or without glucose in the presence of 25 µg/ml of the transcription inhibitor 5,6-dichlorobenzimidazole riboside (DRB) and evaluated the time-dependent cAspAT mRNA decrease by Northern blot. As shown in Fig. 6BGo, cAspAT mRNA degradation rate was similar whether cells were incubated or not in the presence of glucose. Thus, glucose did not change cAspAT mRNA half-life, strongly suggesting that cAspAT gene transcription rate was the regulated step.

To determine whether the glucose effect was mediated by the promoter region of the cAspAT gene, we used the p-2405/-26:CAT construct previously shown to be hormone-responsive when transfected into Fao hepatoma cells (19). This construct contains the -2405 to -26 bp relative to the translation start site of the cAspAT gene fused to the chloramphenicol acetyltransferase reporter gene. We cotransfected 3T3-F442A adipoblasts with p-2405/-26:CAT and pSV2-NEO which conferred resistance of the transfected cells to the neomycin analog geneticin (G418). Twelve individual clones were randomly selected. Eleven retained the ability to differentiate into adipocytes. Among these stably transfected clones, five expressed CAT at a substantial level, with specific activities ranging from 2.4 to 35 mU/mg protein after adipocyte differentiation (Fig. 7Go). All these clones responded to a 24-h glucose deprivation by an increase in CAT activity although to a variable extent (1.4- to 6.2-fold) (Fig. 7Go). In contrast, two previously characterized stable transfectants bearing -2100 to +69 bp of the phosphoenolpyruvate carboxykinase gene promoter fused to the CAT gene (PEPCK-CAT) (44) did not respond to glucose deprivation by a significant change in CAT gene expression (Fig. 7Go). Therefore, the 5'-flanking region of the cAspAT gene promoter specifically contains a negative glucose-response region.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Effect of glucose deprivation on CAT expression in -2405/-26cAspAT-CAT/3T3-F442A and -2100/+69PEPCK- CAT/3T3-F442A stable transfectants. Independent stable transfectants were allowed to differentiate then cultured for 24 h in serum-free medium with or without 25 mM glucose before measurement of CAT activity. For each transfectant, result represents the mean ± SEM of data obtained from three independent experiments with duplicate dishes.

 
Identification of the negative glucose-response region in the cAspAT gene promoter
We stably transfected 3T3-F442A cells with various 5' deletions of the cAspAT gene promoter driving CAT. For each deletion, at least five stable clones were analyzed for their response to a 24 h glucose deprivation. Results in Fig. 8Go are presented as the mean increase in CAT activity by glucose deprivation. A deletion from -1984 to -1718 bp of the promoter abolished glucose response showing that a glucose-response element(s) was present in that fragment of the promoter. Glucose response was also abolished with a shorter construct (Fig. 8Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 8. Effect of glucose deprivation on CAT expression in cAspAT-CAT/3T3-F442A stable transfectants with various deletions of the cAspAT gene promoter. 3T3-F442A cells were stably transfected with CAT constructs containing various deletions of the cAspAT gene promoter. For each construct, independent stable transfectants were allowed to differentiate then cultured for 24 h in serum-free medium with or without 25 mM glucose before measurement of CAT activity. For each construct, selected transfectants expressed CAT activity at 1–200 mU/mg protein in the presence of glucose. For each construct, values represent the mean ± SEM of data obtained from five independent clones. *, P < 0.05 (Student’s t test for unpaired data) when compared with p-300/-26:CAT.

 
The role of the glucose-responsive DNA fragment was further confirmed by the construction of two plasmids bearing -1984 to -1702 bp of the cAspAT gene at the 5'-end position of either the thymidine kinase (TK) promoter or the {Delta}MTV promoter, which was deleted of the steroid response region of the wild-type mouse mammary tumor virus long terminal repeat. Stable transfectants were obtained and tested for their glucose response. The p-1984/-1702{Delta}MTV:CAT and p-1984/-1702TK:CAT both responded to glucose deprivation by a 1.7-fold increase (P <= 0.05) in CAT activity, whereas {Delta}MTV was unaffected and TK-driven CAT expression was slightly repressed (data not shown). Such a blunted response when using a heterologous promoter is a frequently observed phenomenon that can be due to the difference in the positioning of the cis-element relative to the transcription start site of the transgene. Similar experiments were then carried out using a shorter fragment (-1838 to -1702 bp) of the cAspAT gene placed at the 5'-end of the TK gene (p-1838/-1702TK:CAT). Stable p-1838/-1702TK:CAT/3T3-F442A transfectants responded to glucose deprivation by a 2.6-fold increase in CAT activity. Hence, a glucose-response element(s) is present in the fragment of the cAspAT gene promoter between -1838 and -1702 bp. However, we cannot exclude that another region of the gene also plays a role in the regulation by glucose.

Analysis of protein-DNA interactions in the glucose-response region of the cAspAT gene promoter
The -1838/-1702 fragment of the cAspAT gene promoter was analyzed by DNAseI footprinting using nuclear extracts from glucose-treated or glucose-deprived cells. Several footprints were observed showing that this region contains binding sites for adipocyte nuclear proteins (Fig. 9Go). The regions spanning the sequence -1747/-1729 and -1720/-1702 were totally protected. A large region extending from -1835 to -1759 was only partially protected and included a hypersensitive site at -1799. A similar pattern was observed on the noncoding strand. There was no significant difference between the binding patterns of nuclear extracts from glucose-treated or glucose-deprived cells. Such an absence of modification is not entirely surprising because it has been reported for either footprinting or gel retardation assays in several cases (45, 46, 47, 48, 49). This suggests that glucose regulates the transactivation properties of the transcription factor(s) rather than its binding properties to DNA.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 9. DNase I footprinting analysis of the rat cAspAT gene promoter in the presence of nuclear extracts from 3T3-F442A adipocytes. The probe used covers the sequence from -1838 to -1702. It was labeled on the coding strand at the BamHI site and on the noncoding strand at the EcoRI site. Boxes to the left represent the observed footprints with the numbers indicating their limits. Hypersensitive sites are indicated by stars. G + A represents a Maxam and Gilbert reaction on the same sequence.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytosolic AspAT has been shown to be regulated in liver by several hormones and during development (19). These regulations are mediated by the cAspAT gene promoter. Nutrients also play an important role in the regulation of this gene, although the targeted tissue is different. Indeed, physiological concentrations of glucose repress the cAspAT gene expression in adipocytes but not in several other cell lines that we have tested, including hepatoma cell lines. Thus, while the basal expression of this gene is ubiquitous, its regulation by glucose appears to be cell specific, at least within all the culture systems that we tested, and in this respect is similar to its regulation by hormones such as glucocorticoids and insulin. However, a major difference between the two types of regulations is that the hormonal effects are essentially hepatocyte-specific, whereas the glucose effect is adipocyte-specific. Furthermore, both the hormonal and the glucose effects are gene-specific, in that only the cytosolic isoform of AspAT and not the mitochondrial one is regulated.

In adipocytes, cAspAT could contribute to glyceroneogenesis by generating oxaloacetate in the cytoplasm. It is well known that a carbohydrate-rich diet would tend to repress this metabolic pathway. In the case of cAspAT, our results suggest that this may occur through increased glycemia. The regulation of PEPCK, another enzyme involved in glyceroneogenesis, is more complex as it has been shown to be repressed by glucose in adipose tissue explants in culture (10), but not in 3T3-F442A adipocytes (11). Nevertheless, in the latter cells, glucose inhibits fatty acid-induced PEPCK gene expression (11). Furthermore, insulin represses induction of PEPCK mRNA by cAMP in these cells (50).

We have found no evidence for the regulation of the cAspAT gene expression by insulin in 3T3-F442A adipocytes. In contrast, this hormone represses this gene in hepatic cells. Thus, increased glucose intake has a negative effect on cAspAT gene expression in both liver and adipocytes, but through different mechanisms. In the latter case, it acts directly through a glucose metabolite, while in the former case, it acts through the increase in insulin concentration that is associated with it. In this respect, it is interesting to note that the same promoter region contains elements responsible for the negative effects of both insulin and glucose. It is not known yet whether signaling by both compounds converge on the same DNA element or on the same transcription factor, and we cannot exclude that glucose acts also through other sequences.

Few other genes encoding metabolic enzymes have been shown to be regulated by glucose in adipose tissue. The most studied ones are those encoding fatty acid synthase and acetylCoA carboxylase. However, unlike cAspAT, both genes are induced by glucose (10, 12). In hepatic cells, L-pyruvate kinase, Spot 14, aldolase B, and glucose-6-phosphatase mRNAs are induced by glucose (6, 7, 51, 52, 53). Among genes encoding metabolic proteins, glucose has been shown to repress the Glut 1 glucose transporter. However, unlike cAspAT, the repression of Glut 1 can be observed in several different cell types (54). The mechanism of glucose action has been investigated at least in the case of fatty acid synthase in adipocytes and L-pyruvate kinase in liver cells. In both cases, glucose-6-phosphate has been shown to mediate the glucose effect. This is also what we have demonstrated for cAspAT gene regulation (Fig 5Go). Identically, our result suggests that phosphorylation of glucose is critical for its transcriptional action on the cAspAT gene. In contrast to what has been observed for L-pyruvate kinase (43), glucose-6-phosphatase (55) and fatty acid synthase and S14 genes (56) in hepatocytes, xylitol does not reproduce glucose action on cAspAT gene expression in adipocytes. Thus, we have no evidence that the pentose phosphate pathway may be involved in our case.

The mechanism of action of phosphorylated glucose on the inhibition of the cAspAT gene transcription is not likely the result of the direct activation of a preexisting transcription factor because gene inhibition is relatively delayed with respect to glucose addition to the culture medium (6 h) and is blocked by protein synthesis inhibitors. Further investigations will determine whether glucose 6-phosphate acts by itself on a primary responsive gene, mediating its effect on cAspAT gene, or whether it interferes in some way with the intracellular metabolism generating other metabolites that could be the actual transcription activators.

The regulatory gene, gadd153 has been shown to be under negative control by glucose in adipocytes (57). Gadd153, also referred to as CHOP-10, is a dominant negative inhibitor of the transcription factors CAAT/enhancer-binding protein (C/EBP) and the liver-enriched transcriptional activator protein (LAP) (58). This could be of particular interest with regard to the glucose regulation of the cAspAT gene because its basal promoter is activated by C/EBP (35). However, we have shown that the 300 bp proximal promoter fragment that contains high affinity C/EBP sites is not regulated by glucose (Fig. 7Go). The region responsible for glucose regulation is distal (-1838 to -1702) and contains consensus sequences for the activator protein 1 (AP1) and the helix-loop-helix (HLH) family of transcription factors and degenerated sequences for recognition of the octamer proteins, hepatocyte nuclear factor 3 (HNF3) and C/EBP. As mentioned, this complex region also mediates the hormonal regulation of cAspAT in hepatocytic cells in addition to its nutritional regulation (19). We are currently investigating the contribution of the various sites and the possible convergence of the various regulations on the same sites.


    Acknowledgments
 
We wish to thank Dr. Howard Green (Boston, MA) for providing us with the 3T3-F442A cell line, Drs. Daryl Granner (Nashville, TN) and Richard Planells (INSERM, Marseille, France) for PEPCK and S14 plasmids, respectively, and Dr. Jean Girard (CNRS, Meudon, France) for helpful discussions. We are grateful to Martine Glorian (CNRS, Meudon, France) for her help with primary cultures and to Dr Alena Leroux (INSERM U.129) for her cooperation during in vivo studies.


    Footnotes
 
1 This work was supported by Centre National de la Recherche Scientifique, Institut National de la Santé et de la Recherche Médicale, and the Université Paris-Val de Marne. Back

2 Recipients of a fellowship from the French Ministère de l’Education Nationale, de la Recherche et de la Technologie. Back

3 1996 Laureate of the award of the Société de Nutrition de Langue Française. Back

Received April 1, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Diaz Guerra MJM, Bergot MO, Martinez A, Cuif MH, Kahn A, Raymondjean M 1993 Functional characterization of the L-type pyruvate kinase gene glucose response complex. Mol. Cell Biol 13:7725–7733
  2. Thompson HS, Towle HC 1991 Localisation of the carbohydrate respone element of the rat L-type pyruvate kinase gene. J Biol Chem 266:8679–8682[Abstract/Free Full Text]
  3. Bergot MO, Diaz Guerra MJM, Puzenat N, Raymondjean M, Kahn A 1992 Cis-regulation of the L-type pyruvate kinase gene promoter by glucose, insulin and cyclic AMP. Nucleic Acids Res 20:1871–1878[Abstract/Free Full Text]
  4. Liu Z, Thompson KS, Towle HC 1993 Carbohydrate regulation of the rat L-type pyruvate kinase gene requires two nuclear factors LF-A1 and a member of c-myc family. J Biol Chem 268:12787–12795[Abstract/Free Full Text]
  5. Kaytor EN, Shih H, Towle HC 1997 Carbohydrate regulation of hepatic gene expression. J Biol Chem 272:7525–7531[Abstract/Free Full Text]
  6. Shih H, Towle HC 1992 Definition of carbohydrate response element of the rat S14 gene. J Biol Chem 267:13222–13228[Abstract/Free Full Text]
  7. Shih H, Towle HC 1994 Definition of the carbohydrate response element of the rat S14 gene. J Biol Chem 269:9380–9387[Abstract/Free Full Text]
  8. Meyer S, Höpnner W, Seitz HJ 1991 Transcriptional and post-transcriptionnal effects of glucose on liver phosphoenolpyruvate carboxykinase gene expression. Eur J Biochem 202:985–991[Medline]
  9. Kahn RC, Lauris V, Koch S, Crettaz M, Granner DK 1989 Acute and chronic regulation of phosphoenolpyruvate carboxykinase mRNA by insulin and glucose. Mol Endocrinol 3:840–845[Abstract/Free Full Text]
  10. Foufelle F, Gouhot B, Perdereau D, Girard J, Ferre P 1994 Regulation of lipogenic enzyme and phosphoenolpyruvate carboxykinase gene expression in cultured white adipose tissue. Eur J Biochem 223:893–900[Medline]
  11. Antras-Ferry J, Le Bigot G, Robin P, Robin D, Forest C 1994 Stimulation of phosphoenolpyruvate carboxykinase gene expression by fatty acids. Biochem Biophys Res Commun 203:385–391[CrossRef][Medline]
  12. Foufelle F, Gouhot B, Pégorier JP, Perdereau D, Girard J 1992 Glucose stimulation of lipogenic enzyme gene expression in cultured white adipose tissue. J Biol Chem 267:20543–20546[Abstract/Free Full Text]
  13. Moustaïd N, Sul HS 1991 Regulation of expression of the fatty acid synthase gene in 3T3–L1 cells by differentiation and triiodothyronine. J Biol Chem 266:18550–18554[Abstract/Free Full Text]
  14. Moustaïd N, Sakamoto K, Clarke S, Beyer SR, Sul HS 1993 Regulation of fatty acid synthase gene transcription. Biochem J 292:767–772
  15. Katunuma N, Okada M, Nishh Y 1966 Regulation of the urea cycle and TCA cycle by ammonia. Adv Enzyme Regul 4:317–335[CrossRef][Medline]
  16. Pavé-Preux M, Ferry N, Bourguet J, Hanoune J, Barouki R 1988 Nucleotide sequence and glucocorticoid regulation of the mRNAs for isoenzymes of rat aspartate aminotransferase. J Biol Chem 263:17459–17466[Abstract/Free Full Text]
  17. Sharma R, Patnaik SK 1987 Regulation of aspartate aminotransferase isoenzymes by hydrocortisone in the liver of aging rats. Arch Gerontol Geriatr 6:27–32[CrossRef][Medline]
  18. Barouki R, Pavé-Preux M, Bousquet-Lemercier B, Pol S, Bouguet J, Hanoune J 1989 Regulation of cytosolic aspartate aminotransferase mRNAs in the Fao rat hepatoma cell line by dexamethasone, insulin and cyclic AMP. Eur J Biochem 186:79–85[Medline]
  19. Aggerbeck M, Garlatti M, Feilleux-Duché S, Veyssier C, Daheshia M, Hanoune J, Barouki R 1993 Regulation of the cytosolic aspartate aminotransferase housekeeping gene promoter by glucocorticoids, cAMP, and insulin. Biochemistry 32:9065–9072[CrossRef][Medline]
  20. Reshef L, Hanson RW, Ballard JF 1970 A possible physiological role for glyceroneogenesis in rat adipose tissue. J Biol Chem 245:5979–5984[Abstract/Free Full Text]
  21. Plee-Gautier E, Grimal H, Aggerbeck M, Barouki R, Forest C 1998 Cytosolic aspartate aminotransferase gene is a member of the glucose-regulated protein gene family in adipocytes. Biochem J 329:37–40
  22. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  23. Yang H, McLeese J, Weisbart M, Dionne JL, Lemaire I, Aubin RA 1993 Simplified high throughput protocol for Northern hybridization. Nucleic Acids Res 21:3337–3338[Free Full Text]
  24. Beale EG, Chrapkiewicz NB, Scoble HA, Metz RJ, Quick DP, Noble RL, Donelson JE, Biemann K, Granner DK 1985 Rat hepatic cytosolic phosphoenolpyruvate carboxykinase (GTP). J Biol Chem 260:10748–10760[Abstract/Free Full Text]
  25. Planells R, Peyrol N, deGroot LJ, Henry M, Cartouzou G, Torresani J 1991 Production of rat Spot14 protein in Escherichia coli. Gene 99:205–209[CrossRef][Medline]
  26. Plée-Gautier E, Grober J, Duplus E, Langin D, Forest C 1996 Inhibition of hormone-sensitive lipase gene expression by cAMP and phorbol esters in 3T3–F442A and BFC-1 adipocytes. Biochem J 318:1057–1063
  27. Umesono K, Giguere V, Glass CK, Rosenfeld MG, Evans RM 1988 Retinoic acid and thyroid hormone induce gene expression through a common responsive element. Nature 336:262–265[CrossRef][Medline]
  28. Franckhauser S, Antras-Ferry J, Robin P, Robin D, Forest C 1994 Glucocorticoids antagonize retinoic acid stimulation of PEPCK gene transcription in 3T3–F442A adipocytes. Cell Mol Biol
  29. Southern PJ, Berg P 1982 Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of SV40 early region promoter. J Mol Appl Genet 1:327–341[Medline]
  30. Forest C, Doglio A, Ricquier D, Ailhaud G 1987 A preadipocyte clonal line from mouse brown adipose tissue. Short- and long-term responses to insulin and. Exp Cell Res 168:218–32[CrossRef][Medline]
  31. Parli JA, Godfrey DA, Ross CD 1987 Separate enzymatic microassays for aspartate aminotransferase isoenzymes. Biochim Biophys Acta 925:175–184[Medline]
  32. Forest CD, O’brien RM, Lucas PC, Magnuson MA, Granner DK 1990 Regulation of phosphoenolpyruvate carboxykinase gene expression by insulin. Use of the stable transfection approach to locate an insulin responsive sequence (IRS). Mol Endocrinol 4:1302–1310[Abstract/Free Full Text]
  33. Seed B, Sheen JY 1988 A simple phase-extraction assay for chloramphenicol acetyltransferase activity. Gene 67:271–277[CrossRef][Medline]
  34. Vaulont S, Puzenat N, Levrat F, Cognet M, Kahn A, Raymondjean M 1989 Proteins binding to the liver-specific pyruvate kinase gene promoter. A unique combination of known factors. J Mol Biol 209:205–219[CrossRef][Medline]
  35. Garlatti M, Tchesnokov V, Daheshia M, Feilleux-Duché S, Hanoune J, Aggerbeck M, Barouki R 1993 CCAAT/Enhancer-binding protein-related proteins bind to the unusual promoter of the aspartate aminotransferase housekeeping gene. J Biol Chem 268:6567–6574[Abstract/Free Full Text]
  36. Horio Y, Tanaka T, Taketoshi M, Uno T, Wada H 1988 Rat cytosolic aspartate aminotransferase regulation of its mRNA and contribution to gluconeogenesis. J Biochem 103:805–808[Abstract/Free Full Text]
  37. Botion LM, Kettelhut IC, Migliorini RH 1995 Increased adipose tissue glyceroneogenesis in rats adapted to a high protein, carbohydrate-free diet. Horm Metab Res 27:310–313[Medline]
  38. Clarke SD, Jump DB 1994 Dietary polyunsaturated fatty acid regulation of gene transcription. Annu Rev Nutr 14:83–98[CrossRef][Medline]
  39. Peret J, Foustock S, Chanez M, Bois-Joyeux B, Assan R 1981 Plasma glucagon and insulin concentrations and hepatic phosphoenolpyruvate carboxykinase and pyruvate kinase activities during and upon adaptation of rats to a high protein diet. J Nutr 111:1173–1184
  40. Green H, Kehinde O 1976 Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells. Cell 7:105–113[CrossRef][Medline]
  41. Cornelius P, MacDougald OA, Lane MD 1994 Regulation of adipocyte development. Annu Rev Nutr 14:99–129[CrossRef][Medline]
  42. Okuno M, Caraveo VE, Goodman DS, Blaner WS 1995 Regulation of adipocyte gene expression by retinoic acid and hormones effects on the gene encoding cellular retinol-binding protein. J Lipid Res 36:137–147[Abstract]
  43. Doiron B, Cuif MH, Chen R, Kahn A 1996 Transcriptional glucose signaling through the glucose response element is mediated by the pentose phosphate pathway. J Biol Chem 271:5321–5324[Abstract/Free Full Text]
  44. Antras-Ferry J, Franckhauser S, Robin D, Robin P, Granner DK, Forest C 1994 Expression of the phosphoenolpyruvate carboxykinase gene in 3T3–F442A adipose cells effects of retinoic acid and differentiation. Biochem J 302:943–948
  45. Mitanchez D, Doiron B, Chen R, Kahn A 1997 Glucose-stimulated genes and prospects of gene therapy for type I diabetes. Endocr Rev 18:520–540[Abstract/Free Full Text]
  46. Daniel S, Zhang S, DePaoli-Roach A, Kim K 1996 Dephosphorylation of Sp1 by protein phosphatase 1 is involved in the glucose-mediated activation of the acetyl-CoA carboxylase gene. J Biol Chem 271:14692–14697[Abstract/Free Full Text]
  47. Faber S, O’Brien RM, Imai E, Granner DK, Chalkley R 1993 Dynamic aspects of DNA/protein interactions in the transcriptional initiation complex and the hormone-responsive domains of the phosphoenolpyruvate carboxykinase promoter in vivo. J Biol Chem 268:24976–24985[Abstract/Free Full Text]
  48. O’Brien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK 1990 Identification of a sequence in the PEPCK gene that mediates a negative effect of insulin on transcription. Science 249:533–537[Abstract/Free Full Text]
  49. Suwanickul A, Morris SL, Powell DR 1993 Identification of an insulin- responsive element in the promoter of the human gene for insulin-like growth factor binding protein-1. J Biol Chem 268:17063–17068[Abstract/Free Full Text]
  50. Beale EG, Tishler E J 1992 Expression and regulation of cytosolic phosphoenolpyruvate carboxykinase in 3T3–L1 adipocytes. Biochem Biophys Res Commun 189:925–930[CrossRef][Medline]
  51. Decaux JF, Marcillat O, Pichard AL, Henry J, Kahn A 1991 Glucose-dependent and independent effect of insulin on gene expression. J Biol Chem 266:3432–3438[Abstract/Free Full Text]
  52. Argaud D, Kiby TL, Newgard CB, Langes AL 1997 Stimulation of glucose-6-phosphatase gene expression by glucose and fructose-2,6-bisphosphate. J Biol Chem 272:12854–12861[Abstract/Free Full Text]
  53. Vaulont S, Kahn A 1994 Transcriptional control of metabolic regulation genes by carbohydrates. FASEB J 8:28–35[Abstract]
  54. Wertheimer E, Sasson S, Cerasi E, Ben-Neriah Y 1991 The ubiquitous glucose transporter GLUT-1 belongs to the glucose-related protein family of stress-inducible proteins. Proc Natl Acad Sci USA 88:2525–2529[Abstract/Free Full Text]
  55. Massillon D, Chen W, Barzilai N, Prus-Wertheimer D, Hawkins M, Liu R, Taub R, Rossetti L 1998 Carbon flux via the pentose phosphate pathway regulates the hepatic expression of the glucose-6-phosphatase and phosphoenolpyruvate carboxykinase genes in conscious rats. J Biol Chem 273:228–234[Abstract/Free Full Text]
  56. Mourrieras F, Foufelle F, Foretz M, Morin J, Bouche S, Ferré P 1997 Induction of fatty acid synthase and S14 gene expression by glucose, xylitol and dihidroxyacetone in cultured rat hepatocytes is closely correlated with glucose-6-phosphate concentrations. Biochem J 326:345–349
  57. Carlson SG, Fawcett TW, Bartlett JD, Bernier M, Holbrook NJ 1993 Regulation of the C/EBP-related gene gadd153 by glucose deprivation. Mol Cell Biol 13:4736–4744[Abstract/Free Full Text]
  58. Ron D, Habener JF 1992 CHOP, a novel developmentally regulated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominant-negative inhibitor of gene transcription. Genes Dev 6:439–453[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Tordjman, S. Leroyer, G. Chauvet, J. Quette, C. Chauvet, C. Tomkiewicz, C. Chapron, R. Barouki, C. Forest, M. Aggerbeck, et al.
Cytosolic Aspartate Aminotransferase, a New Partner in Adipocyte Glyceroneogenesis and an Atypical Target of Thiazolidinedione
J. Biol. Chem., August 10, 2007; 282(32): 23591 - 23602.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. Khazen, E. Distel, M. Collinet, V. E. Chaves, J.-P. M'Bika, C. Chany, A. Achour, C. Benelli, and C. Forest
Acute and Selective Inhibition of Adipocyte Glyceroneogenesis and Cytosolic Phosphoenolpyruvate Carboxykinase by Interferon {gamma}
Endocrinology, August 1, 2007; 148(8): 4007 - 4014.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. S. Hittel, W. E. Kraus, C. J. Tanner, J. A. Houmard, and E. P. Hoffman
Exercise training increases electron and substrate shuttling proteins in muscle of overweight men and women with the metabolic syndrome
J Appl Physiol, January 1, 2005; 98(1): 168 - 179.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plee-Gautier, E.
Right arrow Articles by Forest, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plee-Gautier, E.
Right arrow Articles by Forest, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals