help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dean, D. M.
Right arrow Articles by Sanders, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dean, D. M.
Right arrow Articles by Sanders, M. M.
Endocrinology Vol. 139, No. 12 4967-4975
Copyright © 1998 by The Endocrine Society


ARTICLES

A Winged-Helix Family Member Is Involved in a Steroid Hormone-Triggered Regulatory Circuit1

Diane M. Dean, Ryan R. Berger and Michel M. Sanders

Department of Biochemistry, Molecular Biology, and Biophysics, University of Minnesota, Minneapolis, Minnesota 55455

Address all correspondence and requests for reprints to: Michel M. Sanders, Department of Biochemistry, Molecular Biology, and Biophysics, University of Minnasota, 4–225 Millard Hall, 435 Delaware Street Southeast, Minneapolis, Minnesota 55455. E-mail: sande001{at}tc.umn.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A common theme emerging in eukaryotic gene regulation is that maximal gene induction requires several transcription factors acting in concert to regulate the activation of critical genes. Increasingly, nuclear receptors play key roles in orchestrating this regulation, often by integrating additional signaling pathways, through complex regulatory elements known as hormone response units. The ovalbumin gene contains one such unit, known as the steroid-dependent regulatory element. The binding of the chicken ovalbumin induced regulatory protein-I (Chirp-I) to this element occurs only in response to treatment with estrogen and glucocorticoid. Evidence presented herein demonstrates that Chirp-I has many features in common with the winged-helix (W-H) family of transcription factors. The binding sites for Chirp-I and for the W-H proteins have similar sequence recognition requirements. Northern blots establish that members of the W-H family are expressed in oviduct. Most convincing, the Chirp-I complex interacts with two different antibodies specific to W-H family members. The culmination of this work supports the hypothesis that Chirp-I is a member of the W-H family, and it lends credence to the idea that W-H proteins are essential components of some steroid hormone regulatory circuits.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE STEROID/THYROID receptor superfamily of transcription factors is involved in the regulation of many genes, both by direct and indirect mechanisms (for reviews, see Refs. 1, 2). This altered gene activity evokes a large number of physiological responses. Some of these responses may be established through a regulatory hierarchy similar to that described for the steroid hormone ecdysone in Drosophila (3). In such a model, the activated steroid receptor (SR) binds, or is tethered to, a limited number of target genes (4). A subset of these genes encodes transcription factors that, when activated, induce the transcription of additional steroid responsive genes, thereby amplifying the response to steroid hormone treatment.

The ovalbumin (Ov) gene has been extensively used to investigate the mechanism of action of steroid hormones. Although the initial induction of the Ov gene requires estrogen, it is subsequently induced to physiologically relevant levels, in response to treatment with any pair of the following steroid hormones: estrogen, progesterone, androgen, or glucocorticoid (5). However, there are no canonical binding sites (SREs) for the SRs within the 900 bp of 5' flanking DNA that is responsive to these four classes of steroids (6). Furthermore, the induction of the Ov gene is sensitive to protein synthesis inhibitors and is delayed for about 2 h (7). Therefore, the Ov gene presents an excellent model system for studying the indirect and possibly hierarchical regulation of transcription by steroid hormones. The steroid regulation of the chick Ov gene maps to a 112-bp hormone response unit called the steroid-dependent regulatory element (SDRE) that is nearly 1 kb upstream from the transcriptional start site (6, 8). Analysis of the SDRE indicates that it binds at least three cycloheximide-sensitive nuclear proteins (9). One of these, chicken Ov-induced regulatory protein-I (Chirp-I), binds in vivo only in response to treatment with estrogen and glucocorticoid (8). Therefore, the steroidal induction of the Ov gene is believed to be through the regulation of the assembly of essential transcription factors on the SDRE.

One way in which steroid hormone signal transduction pathways are integrated with other signaling pathways is through the binding of transcription factors other than the SRs, in response to steroid treatment or in conjunction with the SRs themselves. For instance, several examples of hepatocyte nuclear factor 3 (HNF-3) binding to glucocorticoid responsive units have been examined (10, 11, 12, 13, 14), leading to the conclusion that it serves as one of these integrating signaling molecules. In these models, the HNF-3 binding site is critical for the glucocorticoid response and seems to be involved in the regulation of both primary responses (13, 14) and secondary responses (12) to glucocorticoid treatment. Similarly, HNF-3 and another member of the winged-helix (W-H) family HFH-4 have been implicated in the estrogen modulation of the apolipoprotein AI gene (15, 16, 17). In this system, the estrogen receptor neither directly binds to the gene nor has any transcriptional effect alone. However, in the presence of either HFH-4 or HFH-4 and HNF-3ß, the estrogen receptor causes estrogen-dependent transactivation of the apolipoprotein AI gene (17). Because, as will be demonstrated in this manuscript, the Chirp-I binding site has a striking sequence similarity to W-H binding sites, we hypothesize that a member of the W-H family is involved in integrating the steroidal induction of the Ov gene.

HNF-3 is one of the founding members of the W-H family of transcription factors (18). Since its discovery in the 1980s, more than 80 members of this family have been cloned (Ref. 19 and references therein). When comparing members of this family from yeast to man, certain structural elements are highly conserved, but overall sequence similarities vary between 30 and 100% (19). The most highly conserved residues are within the helices of the DNA binding domain. Thus, most members recognize DNA binding sites with a conserved core sequence (Table 1Go). Differential DNA recognition is attributed to flanking sequences and to slight differences in the core sequences (19). Numerous studies indicate that the W-H family members are critically involved in integrating intricate gene networks. In addition to the complex glucocorticoid- and estrogen-responsive regulatory circuits mentioned above, W-H family members play central roles in development (19, 20, 21, 22, 23). Whether members of this family are involved in the early development and differentiation of the oviduct, remains to be determined.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of the Chirp-I binding site with HNF-3 binding sites

 
In the present work, we demonstrate that the Chirp-I transcription factor, which only binds to the Ov gene in response to steroid hormone treatment, recognizes a site that has a high degree of identity to the consensus binding site for W-H proteins. Furthermore, mutations in this site are consistent with mutational analyses of the HNF-3 sites. Northern blot analysis indicates that members of the W-H family are expressed in chick and laying-hen oviduct. Gel mobility shift assays (GMSAs) show that recombinant W-H family members bind to the Chirp-I site and that the protein(s) binding to the Chirp-I site from oviduct nuclear protein extracts interacts with two different antibodies to W-H proteins. These data, although circumstantial, are taken as evidence that Chirp-I is a member of the W-H family.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmid construction
Plasmids containing point mutations were constructed by using a primer with a HindIII restriction site on the 5' end and homology to Ov sequences between -900 and -876, except for the mutant bases. PCR was done between this primer and one outside of the SDRE homologous to Ov sequence -658 to -672. The plasmids were constructed by using an endogenous BglII site at -720 and the HindIII site created on the end of the primer and by ligating the PCR product in place of the wild-type sequence into pOvCAT-1.2. Thus, the mutants generated are comparable with pOvCAT-.900 (6) because they contain Ov sequences between -900 and +9, except for the mutated bases. A wild-type plasmid was similarly constructed to use as a control.

Chirp thymidine kinase (TK) chloramphenicol acetyltransferase constructs were made by ligating an oligonucleotide consisting of three tandem copies of the Chirp-I site (single Chirp-I site, in bold, AATTCCCCGGGAAGCTTCTTTACTGTTTGTCAATTCCTTTACTGTTTGTCAATTCCTTTACTGTTTGTCAATTCAAGCTTCCCGGGT) into the pBLCAT-2 vector at the HindIII site (underlined). Similarly, the B1aTKCAT was constructed by cutting the B1a mutant with BglII using Klenow to fill in the BglII end and by ligating on a HindIII linker. This was then cut with HindIII, and the relevant piece was gel isolated using Qiagen Gel Extraction Kit (Qiagen, Santa Clarita, CA). The isolated fragment was ligated into pBLCAT-2 cut with HindIII. All constructs were confirmed by dideoxysequencing (24).

A plasmid containing the complete sequence of rat HNF-3{gamma} was kindly provided by Dr. James Darnell (Rockefeller University, New York, NY). Probes for the Northern blots were made from this plasmid by PCR amplification of the complete DNA binding domain.

Chick HNF-3ß was cloned from an estrogen-withdrawn oviduct complementary DNA (cDNA) library (R. R. Berger and M. M. Sanders, manuscript in preparation), although a partial cDNA has already been cloned from a chick stage 4 Hensen’s node cDNA library (25). Probes for the Southern blots were made by PCR amplification of the DNA binding domain of the chick HNF-3ß.

In vitro transcription and translation
Full-length proteins were made in vitro from the above described plasmids encoding chick HNF-3ß and rat HNF-3{gamma}, using the TNT kit (Promega Corp., Madison, WI), according to the manufacturer’s specifications.

Tubular gland cell culture and transfection
Tubular gland cells from sexually immature, estrogen-withdrawn chick oviducts were isolated and transfected by CaPO4 coprecipitation, as previously described (26). After transfection, all cells transfected with a given plasmid were pooled to reduce variations caused by transfection efficiency. All cells were plated into serum-free media containing either insulin (50 ng/ml) or insulin plus estrogen (10-7 M) and corticosterone (10-6 M) and were cultured for 24 h. The cells were harvested and lysed in Promega Corp. Multiple Assay Buffer. The number of independent experiments is indicated by the N values (see Fig. 2Go). Each DNA was transfected in duplicate, in each experiment, for each hormonal treatment. The data from separate experiments were pooled and analyzed by ANOVA after transformation, to equalize the variance between groups. The data are plotted and statistically analyzed as the percent of wild-type expression in the presence of steroid hormones (see Fig. 2Go). The data are plotted and analyzed as the percent conversion of chloramphenicol to the acetylated form (see Fig. 3Go). The SE of the mean is indicated by bars, and those samples that are statistically different from wild-type are identified by asterisks.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Functional analysis of point mutations in the Chirp-I site. Plasmids containing either wild-type Ov sequences or the indicated point mutations (lower case) in the -900 to +9 context were transfected into primary chick tubular gland cells. After transfection, the cells were cultured in the presence (black bars) or absence (white bars) of estrogen and glucocorticoid. The guanine residues, previously reported to be protected in vivo by steroid hormone treatment (8 ), are denoted by their position from the transcriptional start site. SE bars are included. n, Number of repeated experiments, each done in duplicate per treatment. Experimental values are compared with the activity of the wild-type construct when the cells were treated with estrogen and glucocorticoid, as described in the Materials and Methods. The data from all experiments were pooled and analyzed by ANOVA. Data from constructs that are significantly different from wild-type (at least P < 0.05) are denoted by asterisks.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Functional analysis of Chirp-I sites ligated to a heterologous promoter. Three tandem copies of the Chirp-I site were cloned upstream of the TK promoter, either in the forward (pBLCATChirp3F) or reverse (pBLCATChirp3R) orientation, as described in Materials and Methods. Constructs were transfected into primary chick tubular gland cells and analyzed as described in Materials and Methods. A representative experiment is depicted. All values are the result of duplicate dishes per treatment that were assayed independently and then averaged. ANOVA was done on the pooled data from two experiments, and no statistically significant differences were detected between the test constructs and pBLCAT-2.

 
Assays
Chloramphenicol acetyltransferase assays were performed as previously described (27), normalizing to protein concentration, as measured by Bradford assay.

GMSAs were performed using the following oligonucleotides, annealed to their complementary strands, where italics indicate restriction sites and lower case letters indicate mutations: GATCCTTCTTTACTGTTTGTCAATTCTATTG (wild-type Chirp-I site), GATCCT-TCTTTACTaagctTCAATTCTATTG (5-bp mutant Chirp-I site), GATCCTTCTTTACTtTTTaTCAATTCTATTG (2-bp mutant Chirp-I site), AGCTTTTTATGATTGTCCCTCGAACCATGAAA (SDRE fragment C), AGCTTCAGCAGGACTTGTTTGTTCTAGA (rat TAT HNF-3 s4 site) (14), AGCTTCAAATATGTTTGCACACATGCA (frog vitellogenin site C) (28), and AGCTTGTTTCTTTACTGTTTGTCAATTCTATTATTTCAATACAGAACAATAGA [SDRE fragment A containing the Chirp-I site (in bold)].

The oligonucleotides were labeled by Klenow fill-in reactions in the presence of radioactive deoxycycidine triphosphate to a specific activity of approximately 1 x 108 cpm/µg. GMSAs, using oviduct nuclear extracts, were performed as previously described (9, 27). Gels were run in Tris-glycine buffer, as described (29), or in low ionic strength buffer (9, 27). GMSAs with purified HNF-3{alpha} (kindly provided by Dr. Kenneth Zaret, Brown University, Providence, RI) and, with the in vitro transcribed and translated chick HNF-3ß and rat HNF-3{gamma}, were done as described (30). The general HNF-3 antibody studies were done using a monoclonal antibody (4C7) obtained from the Developmental Studies Hybridoma Bank (University of Iowa) that was directed to the 130 N-terminal amino acids of chick HNF-3ß. The nonspecific antibody D7 (31), used as a negative control in these experiments, was recommended by the Developmental Studies Hybridoma Bank (University of Iowa). Both in vitro synthesized proteins and the nuclear extracts were preincubated with the antibody for 30 min on ice before the binding reaction. In the antibody interaction studies (see Fig. 8Go) with the rat HNF-3{alpha}, ß, and {gamma} antibodies (kindly provided by Dr. James Darnell), they were added to the binding reactions simultaneously with the nuclear protein extract. Rat liver nuclear extracts (kindly provided by Dr. Howard Towle, University of Minnesota, Minneapolis, MN) (8 µg protein) were used as a control to confirm the specificity of the antibody interactions. Densitometric analysis of the shifted bands was determined using a Bio-Rad Densitometer (Bio-Rad Laboratories, Inc., Hercules, CA).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 8. GMSAs with antibodies to rat HNF-3 {alpha}, ß, and {gamma}. A, Rat TAT HNF3 binding site bound by rat nuclear extracts and competition with HNF3 antibodies. The shifted specific bands are noted {alpha}, ß, and {gamma}. Lane 1 is probe plus rat liver nuclear extract (kindly provided by Dr. Howard Towle) plus preimmune serum. Lane 2 is probe alone. Lanes 3, 4, and 5 are probe plus protein extract plus HNF-3{alpha}, ß, or {gamma} antibody, respectively (kindly provided by James Darnell). B, Chirp-I complexes with oviduct nuclear extract and antibodies to HNF3 proteins. Lane 1 is the fragment A Chirp-I probe alone. Lane 2 is probe plus laying-hen nuclear extract. Lane 3 is probe plus extract plus preimmune serum. Lanes 4, 5, and 6 are probe plus extract plus {alpha}, ß, or {gamma} antibody, respectively.

 
Southern and Northern blots
Total genomic DNA was isolated from chicken liver (32) and 25 µg was restricted with enzymes, according to the manufacturers’ specifications, at 37 C overnight. The digested DNA was separated on a 0.7% agarose gel at 30 V overnight. The Southern transfer was done as described (33). For hybridization, the complete DNA binding domain from the chick HNF-3ß gene (nucleotides 421–750, relative to the translational start site) was labeled to greater than 1 x 109 cpm/µg using a random priming kit (Stratagene, La Jolla, CA). The blot was washed at 37 C in wash solution (0.2x saline-sodium citrate (SSC), 0.1% SDS). The resulting blot was subjected to autoradiography for analysis.

Total RNA was extracted from estrogen-stimulated or -withdrawn chick oviduct or from laying-hen oviduct, using RNAzol, according to the manufacturer’s specifications (Tel-Test, Friendwood, TX). Northern blot assays were done with 2 µg poly A+-selected RNA (Poly-ATract kit, Promega Corp.) per lane run on a 6.7% formaldehyde gel. The RNA was transferred by capillary action onto Nytran (Schleicher & Schuell, Inc., Keene, NH) and was immobilized on the membrane by UV cross-linking in a Stratalinker (Stratagene). The membrane was prehybridized for 3 h at 42 C and hybridized overnight at 42 C in hybridization solution (5x SSC, 5x Denhart’s, 50% formamide, 1% SDS, 100 µg/ml salmon sperm DNA). For hybridization, the complete DNA binding domain from the rat HNF-3{gamma} gene was labeled to greater than 1 x 109 cpm/µg using a random priming kit (Stratagene). The blot was washed at 42 C in wash solution (0.2x SSC, 0.1% SDS). The resulting blot was subjected to autoradiography for analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The binding site for Chirp-I contains a consensus binding site for the W-H family
The SDRE consists of at least three cooperative DNA elements (A, B, and C, Fig. 1Go) (6, 8, 9, 27). In vivo footprinting (8) demonstrated steroid-dependent protection of guanine residues -889 and -885 and hypersensitivity of adenine residue -892 within site A (Fig. 1Go, underlined residues). Examination of the SDRE, with a computer algorithm designed to search for transcription factor signal sequences (34), revealed a binding site for the W-H family of transcription factors (Fig. 1Go, in bold, and Table 1Go). Interestingly, this site is encompassed in the in vivo footprint for Chirp-I (8). When this binding site was further examined, a 9-out-of-10-bp identity was found to the consensus sequence for the W-H family and a 7-out-of-7-bp identity was found to the core HNF-3 binding sequence of the rat tyrosine amino transferase (TAT) gene (Table 1Go).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Pictorial representation of the Ov locus. Numbers refer to the distance from the transcriptional start site. The sequence of the Chirp-I site is shown with the bases homologous to the W-H consensus highlighted in bold type and with the protected and hypersensitive residues underlined. NRE, Negative regulatory element.

 
To examine the possibility that Chirp-I is a member of this family, mutations in the Chirp-I site were compared with consensus sequences proposed for several members of this family. The first consensus site shown in Table 1Go (HNF-3a) was determined for HNF-3 by comparing sites from genes regulated by this factor (13). The second HNF-3 consensus site (HNF-3b) was derived from a comparison of the recognition site resulting from site selection by PCR to sites from genes regulated by HNF-3 (35). A similar binding site selection PCR procedure was used to determine the preferred binding sites for HFH-1 and HFH-2 (36), because no endogenous regulatory elements for them have been identified, as yet. Three Xenopus members of this family (XFD-1, -2, and -3) were also examined for binding specificity (37). An extensive study was done with these proteins using both a PCR-based protocol and affinity chromatography to determine their binding sites (Table 1Go). The authors of this study used all the gene sequences available for genes regulated by W-H members to determine an overall consensus site for the family (37). However, it should be noted that the vast majority of these genes are regulated by HNF-3. This fact may skew the consensus site toward the mammalian members of the family. The native Chirp-I site clearly fits the consensus site for either HNF-3 or for the W-H family. In fact, only one mismatch exists in the W-H consensus (W-H site, underlined T, Table 1Go).

To determine whether mutations in the Chirp-I site had functional effects comparable with analogous mutations in the W-H sites, single- or double-point mutants were made in the Chirp-I site. These mutations were transfected into primary oviduct cells and tested for their expression in the absence or presence of estrogen and corticosterone. This mutational analysis of the Chirp-I site demonstrated that certain base pair substitutions within the binding site were completely functional, whereas others had reduced function (Fig. 2Go). A substitution of a c at position -885 or of a t or an a at position -889 retained greater than 80% activity (Fig. 2Go, mutants B1b, B2a, and B2c). Conversely, less than 50% of the activity remained when either an a or a t was substituted into position -885 (Fig. 2Go, mutants A3 and B1a). Likewise, very minimal activity remained when a G-to-c mutation was made at -889 (Fig. 2Go, mutant B2b). Complete loss of function was observed when a double mutant was constructed: G(-885)c, G(-889)a (Fig. 2Go, mutant A4e) (8).

The results of the mutational analyses do not classify the Chirp-I site as belonging to any one of the consensus sites for W-H members listed in Table 1Go; however, all of the mutations are consistent with functional analyses done with this family. The mutations that are entirely consistent with Chirp-I being a W-H member are the G(-889)a mutation (B2c), the G(-889)c mutation (B2b), and the G(-885)t mutation (B1a). The G(-889)a mutation is consistent, because a number of the consensus sites can have either an adenine or a guanine residue at this position, and this mutant functions with nearly wild-type activity. Similarly, the G(-889)c mutation and the G(-885)t mutation should not function, because none of the consensus sites have these residues at the respective positions, and these point mutations had reduced function. The G(-885)a mutant (A3) is consistent with a number of W-H members that require a guanine residue in this position (18, 38, 39). Although many of the consensus sites can have either an adenine or a guanine residue at this position, some sites have a stricter requirement at this position (18). However, some ambiguity occurs with the point mutations G(-889)t (B2a) and G(-885)c (B1b) (Table 1Go, mt Chirp-I sites with underlined bases). Nonetheless, the effects of the substitution of a T at position -889 in the Chirp-I site differ, depending on what base is at position -885. Therefore, it is possible that this substitution is consistent with the consensus sites, because it is nonfunctional in the context of the A substitution at -885. In fact, only the C substitution at position -885 (mt B1b) differs with the consensus site for other W-H members. It is possible that this particular mutation creates a binding site for a different positive transcription factor. Overall, mutational analysis provides support for the contention that Chirp-I is a member of the W-H family.

Chirp-I sites cannot activate a heterologous promoter
Because the rat transthyretin (TTR) HNF-3 site can function when inserted as a concatemer upstream of the ß-globin promoter (40), Chirp-I concatemers containing the putative HNF-3 site were tested for the ability to activate the viral TK promoter. Three copies of the Chirp-I site were cloned juxtaposed to the TK promoter in pBLCAT-2. When tested in primary chick oviduct cells, the expression of constructs containing the Chirp-I concatemers linked to the TK promoter in either the forward (pBLCAT2Chirp3F) or the reverse (pBLCAT2Chirp3R) orientations was not statistically different from that of the TK promoter alone (Fig. 3Go).

Although the obvious interpretation of these results is that Chirp-I cannot modulate a heterologous promoter, we favor the alternative possibility that Chirp-I requires the native DNA context to function. Many HNF-3 binding sites are found in regulatory units that require several transcription factors for maximal induction (28, 41). Thus, although the TTR HNF-3 binding site can activate a heterologous promoter by itself (40), it is conceivable that HNF-3 sites that act in concert with sites for other transcription factors cannot. Interestingly, the TTR site used in the ß-globin study (40) differs significantly from the W-H consensus site, so the ability of this TTR element to activate a heterologous promoter may be atypical of W-H sites in general. Instead, W-H proteins may typically require the presence of one or more additional transcription factors for significant induction from the response unit (28, 41). Chirp-I may fit the more characteristic pattern of W-H family members, because all of the binding sites in the SDRE are required for it to function (6, 8, 27). Therefore, the most likely interpretation of the transfection data is that the SDRE is a response unit involving a W-H member.

The chicken genome encodes several W-H proteins
Numerous W-H genes have been cloned out of species as diverse as yeast and man (19), leading to the hypothesis that between 10 and 20 family members are conserved from invertebrates to humans (42). Southern blot analysis of chick genomic DNA was undertaken to get an estimate of the number of copies of W-H related genes in the chick genome. A standard genomic Southern blot was performed using the restriction enzymes listed in the legend to Fig. 4Go. The resulting blot was hybridized with the radiolabeled chick HNF-3ß DNA binding domain and was washed at moderate stringency. The digested samples of the chick genomic DNA (Fig. 4Go, lanes 1–4) generated between 8 and 10 discrete bands, whereas the human DNA samples (Fig. 4Go, lanes 5–8) generated between 5 and 10 discrete bands. Of the W-H genes that have been characterized, most, but not all, have the DNA binding domain encoded by a single exon (19). Thus, it is not possible to obtain a quantitative estimate of the number of W-H-related genes in the chick genome. However, because numerous members of this family have been cloned from human samples (19), the Southern blot analysis suggests that a similar number of genes encoding W-H proteins will need to be cloned from chickens before a complete understanding of their function in this organism can be determined.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 4. Southern blot analysis of chicken genomic DNA. Chick (lanes 1–4) and human (lanes 5–8) genomic DNA were restriction-digested overnight, electrophoresed through a 0.7% agarose gel, and transferred to Nytran by capillary action. The blot was probed with the DNA binding domain from the chicken HNF-3ß. The enzymes used are (from left to right) BamHI, EcoRI, HindIII, and PstI. The intact rat HNF-3{gamma} plasmid (170 pg) was used as a positive control (C).

 
Chick oviduct expresses RNAs homologous to the W-H family
To determine whether chick oviduct expresses any members of the W-H family, Northern blots were done. The rat HNF-3{gamma} DNA binding domain was used as a probe in the blot shown in Fig. 5Go, although comparable results were observed with the chick HNF-3ß DNA binding domain (data not shown). Two, or possibly three, different-sized RNA species are present in oviducts from both estrogen-withdrawn chicks (Fig. 5Go, W/D oviduct) and from estrogen-stimulated chicks (Fig. 5Go, Stim. Oviduct). However, only one of these species is seen in oviducts from laying hens, which seem to be expressing one or two additional messenger RNA (mRNA) species (Fig. 5Go, laying hen). Only one species of mRNA was detected in the chick liver (Fig. 5Go, W/D liver and Stim. liver). The size of this mRNA is different from any of the species detected in the oviduct tissue. Rat liver was examined as a control and, as expected, at least three species of RNA were detected (data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 5. Northern blot analysis of chick oviduct and liver mRNA. Poly A+ mRNA was isolated from oviduct, and liver tissue from estrogen-withdrawn chicks (W/D Oviduct or W/D Liver), from estrogen-stimulated chicks (Stim. Oviduct or Stim. Liver), or from laying-hen oviduct (laying hen). Two micrograms of poly A+ mRNA was loaded per lane and fractionated on a formaldehyde agarose gel. The resulting gel was transferred to Nytran and probed with the DNA binding domain from the rat HNF-3{gamma} cDNA. Comparable results were achieved with the chick HNF-3ß DNA binding domain (data not shown). The Northern blots were run at least four times with different RNA samples.

 
Although the bands derived from the oviduct samples are diffuse, this is characteristic of the oviduct, because Northern blot analyses have been done at least four times with different mRNA samples and with DNA binding domains from two W-H family members as probes. Consistently, at least two discrete bands are observed with oviduct mRNA on the original films. This diffuse pattern is not seen in RNA samples from chick (Fig. 5Go) or rat liver (not shown) run on the same gel. However, this diffuse pattern is not unexpected if multiple W-H genes are expressed in oviduct, because the sizes of the mRNAs of W-H family members cluster between 2 and 3 kb (Ref. 19 and references therein). Although the number of W-H mRNA species in oviduct cannot be quantitatively determined from these Northern blots, the qualitative demonstration that they exist provides correlative support for the contention that Chirp-I is a member of the W-H family.

The Chirp-I and HNF-3 sites share many binding similarities
To further examine the possibility that the Chirp-I protein may be a member of the W-H family, GMSAs were undertaken using the Chirp-I site and purified recombinant HNF-3{alpha} (kindly provided by Dr. Kenneth Zaret). The binding reactions were done as described previously (30) using an oligomer homologous to the Chirp-I site. The Chirp-I site bound complexes of similar size, although of less intensity, to those seen bound to control oligomers homologous to the rat TAT site (43) or the frog vitellogenin site (28) (data not shown). The complexes that bind to the Chirp-I site are specific, because they compete off with a 20-fold molar excess of either self or the positive control DNAs (Fig. 6BGo, self, Rat TAT, frog vitellogenin). A negative control probe containing the 3' end of the SDRE (SDRE Frag. C, -820 to -796) did not bind HNF-3{alpha} (Fig. 6AGo, SDRE Frag. C) and did not compete for binding to the Chirp-I site (Fig. 6BGo, SDRE Frag. C). Reduced binding was consistently observed with two mutant Chirp-I sites. The 5-bp mutant (Mut.) obliterates the core of the HNF-3 recognition sequence and binds almost no recombinant HNF-3{alpha} (Fig. 6AGo, 5Go bp Mut.). The 2-bp mutant (G-889 a, G-885c), which was shown to be functionally incompetent (8), exhibits approximately 3-fold reduction in binding. These results demonstrate that the Chirp-I site is capable of specifically binding a member of the W-H family, albeit with slightly reduced intensity. Therefore, these data suggest that Chirp-I is a member of the W-H family with slightly different sequence recognition requirements than rat HNF-3{alpha}.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 6. GMSAs with recombinant rat HNF-3{alpha}. A, Radiolabeled oligonucleotides homologous to the SDRE fragment C (SDRE Frag. C), the wild-type Chirp-I site (WT Chirp-I), a 5-bp mutation through the HNF-3 core site (5 bp Mut.), or a 2-bp mutation (2 bp Mut.), as indicated, were incubated with purified recombinant rat HNF-3{alpha}. Both the 5-bp (8 ) and 2-bp (Fig. 2Go, A4e) mutations are nonfunctional in oviduct cells. B, The radiolabeled wild-type Chirp-I oligomer was incubated with recombinant rat HNF-3{alpha} and 20-fold molar excess of competitor DNA, as noted.

 
To determine whether one or more of the protein complexes binding to the Chirp-I site contain a member of the W-H family, GMSA supershift analyses were done. Only one antibody, anti-HNF-3ß (Developmental Studies Hybridoma Bank), is currently available that was raised against a member of the chick W-H family. However, the peptide fragment (amino acids 1–130) used to raise the monoclonal antibody extends about 30 amino acids into the highly conserved DNA binding domain, which raises the possibility that it would cross-react with many W-H family members, as well as the three HNF-3 proteins. Therefore, chick anti-HNF-3ß was tested with HNF-3{alpha}, ß, and {gamma} protein in GMSAs to determine its cross-reactivity (Fig. 7AGo). Recombinant rat HNF-3{alpha} and in vitro transcribed and translated chick HNF-3ß and rat HNF-3{gamma} all bind to the Chirp-I site (Fig. 7AGo, lanes indicated by minus signs). The binding of all three HNF-3 proteins was reduced by preincubation with anti-HNF-3ß (+Ab) but not with a nonspecific antibody (+NS). Thus, this antibody does recognize all three HNF3 proteins.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 7. GMSAs with a general antibody to HNF-3 proteins. A, Recombinant rHNF3{alpha} and in vitro synthesized cHNF-3ß and rHNF-3{gamma} were preincubated with the radiolabeled wild-type Chirp-I site with no antibody (-), an antichick HNF-3ß antibody (Ab), or a nonspecific antibody (NS). Binding reactions were set up as previously described (27 ). The resulting complexes were separated on a low ionic strength polyacrylamide gel. B, Oviduct nuclear protein extracts, preincubated with HNF-3ß antibody, were incubated with oligonucleotides homologous to the Chirp-I site (all lanes except 5) or the 5-bp mutant Chirp-I site (lane 5). Lanes are as follows: Chirp-I probe alone (lane 1); probe plus laying-hen nuclear protein extract (lane 2); probe, extract, and 100x unlabeled Chirp-I oligomer (lane 3); probe, extract, and 100x unlabeled nonspecific oligomer (lane 4); 5-bp mutant probe plus extract (lane 5); Chirp-I oligomer plus extract that has been preincubated with 280 ng of the HNF-3ß antibody (lane 6); probe plus extract that has been preincubated with 840 ng of the HNF-3ß antibody (lane 7); and probe plus extract that has been preincubated with 840 ng of the nonspecific antibody (lane 8). The resulting complexes were separated on a low-ionic-strength polyacrylamide gel. Specific oviduct nuclear protein complexes are noted by arrows.

 
Additional GMSAs were done to ascertain whether the HNF-3 antibody also attenuated binding with chick oviduct nuclear protein extracts (Fig. 7BGo). The incubation of the Chirp-I site with oviduct nuclear extracts results in the formation of two major specific complexes, as indicated by the arrows (Fig. 7BGo, compare lane 2 with lane 3). Competition with another region of the SDRE, Frag. C (Fig. 1Go) had no effect on these complexes (Fig. 7BGo, lane 4). The two major complexes did not form when the 5-bp mutant oligomer was used as the probe (Fig. 7BGo, lane 5). Thus, the two complexes are specific for the Chirp-I oligomer. Complex formation was reduced by preincubation of the nuclear protein extract with the monoclonal HNF-3 antibody (Fig. 7BGo, compare lane 2 with lanes 6 and 7) but not by preincubation with a nonspecific antibody (Fig. 7BGo, lane 8). These results suggest that the oviduct protein or protein complexes that bind to the Chirp-I site contain an epitope in common with the N-terminus of the HNF-3 proteins.

To determine whether the Chirp-I protein(s) is structurally most related to HNF-3{alpha}, ß, or {gamma}, specific antibodies to the three rat HNF-3s were obtained from Dr. James Darnell. Each of these polyclonal antibodies was raised to a part of the protein that does not overlap with the region used to raise the chick HNF-3 antibody described above or with each other. As a control, the rat TAT site was incubated with normal rat liver extracts. As expected from previously published results (40), three specific complexes that migrate closely together are seen (Fig. 8AGo, lane 1). Each of these complexes specifically interacts with antibody to HNF-3{alpha}, ß, or {gamma}, respectively (Fig. 8AGo, lanes 3, 4, and 5). When these same antibodies were included in the binding reactions with the Chirp-I site and oviduct nuclear proteins, the HNF-3{gamma} antibody specifically reduced complex formation (Fig. 8BGo). Densitometric analysis indicated that the lower band was attenuated by 75% and the upper band by 50%. Thus, despite the species differences, chick Chirp-I seems to have an epitope in common with rat HNF-3{gamma}. Because binding of oviduct nuclear proteins to the Chirp-I site is specifically disrupted by two different antibodies raised to two different parts of HNF-3, it seems likely that Chirp-I is a member of the W-H family of transcription factors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The above data support the contention that Chirp-I is a member of the W-H family. The Chirp-I site, which was determined by functional and in vivo footprinting analyses (8), has a 9-out-of-10 identity to sites for other members of the W-H family. This is a striking homology for such a large site. The activities of all but one of the point mutations (Fig. 2Go) are consistent with W-H consensus sequences, as well as with a mutational analysis done on the hepatitis B viral enhancer (39). Numerous members of the W-H family are present in the chick genome (Fig. 4Go), and several are expressed in the oviduct (Fig. 5Go). The proteins or protein complexes shown to bind the Chirp-I site in vitro react with two different antibodies raised against different epitopes known to be specific for W-H family members (Figs. 7Go and 8Go). Lastly, the complexes observed in vitro have biological significance because their binding to wild-type and mutant oligomers is consistent with previous functional analysis (8). Based on these correlative (but, nonetheless, compelling) data, Chirp-I seems to be a member of the W-H family. Experiments are in progress to clone the W-H family members from the chick oviduct to determine whether Chirp-I is a previously described or novel W-H family member.

Very little is known about the natural binding sites for most of the eighty W-H family members. Analysis of genes regulated by the HNF-3 proteins gave rise to consensus sites in which several positions are not specific (13, 35). In fact, it was originally believed that two unique proteins were involved in the regulation of the rat TTR and TAT genes (43). Therefore, the slight additional diversity observed with the Chirp-I site is not surprising, because Chirp-I is from an avian species and from a developmentally different tissue than the HNF-3 proteins.

Although one or more W-H family members are expressed in a wide variety of tissues (19), only a few are actually expressed in reproductive tissues. These include HFH-11, which is expressed in the rat testes (44), and HFH-4, which is expressed in mouse ovary and oviduct (45). Of the HNF-3 proteins, only HNF-3{gamma} is expressed in reproductive tissues (46, 47), although we detect HNF-3ß (R. R. Berger and M. M. Sanders, manuscript in preparation) in the chick oviduct. Interestingly, in rat testes, the message for HNF-3{gamma} is considerably larger than the homologous message in liver (46), suggesting alternative splicing or a testes-specific W-H protein. This is particularly interesting, because an antibody raised to an HNF-3{gamma}-specific epitope recognizes Chirp-I (Fig. 8Go). Thus, these GMSAs data, in conjunction with the expression of HNF-3{gamma} in reproductive tissues, raise the possibility that Chirp-I is the chick homolog of HNF-3{gamma}.

Evidence is accruing that the W-H transcription factors are crucial for the regulation of steroid-responsive genes. The rat TAT gene and the albumin enhancer both have HNF-3 binding sites that are intimately involved in the response of these liver genes to glucocorticoid treatment (41, 43). HFH-4 is required for the development of reproductive epithelium (45), and Mf3 seems to be critical for the lactation response in mice (48). Therefore, the W-H family seems to be involved in many steroid-regulated signaling cascades. The regulation of the Ov gene by steroid hormone treatment through the Chirp-I protein may be yet another example of W-H involvement in steroid-mediated transcriptional events. However, it does not seem, in any of these cases, that the signal elicited by the steroid hormone alters the mass of the W-H protein or mRNA. Instead, the W-H member seems to be part of a complex response unit that requires several transcription factors for activity.

The mechanisms whereby the W-H family members act in concert with other transcription factors at any particular response unit seem to vary. For example, in the rat TAT hormone response unit, the glucocorticoid receptor binds first and seems to rearrange the chromatin such that HNF-3 can then bind to its site and subsequently activate transcription (43). However, in the albumin enhancer, HNF-3 alters the surrounding chromatin structure itself (41). The unifying theme, therefore, seems to be that the initial binding of one transcription factor alters the chromatin structure, such that other factors have access to their binding sites. This is consistent with our observations with Chirp-I. In vitro, Chirp-I binds to its site independently of steroid hormone treatment (9); yet, all of the functional data indicate that the sequence requirements for Chirp-I binding in vitro are identical to those for transcriptional activation (8). However, in vivo Chirp-I binds only after treatment with steroid hormones (8). Furthermore, the Chirp-I site, by itself, is insufficient to activate the TK promoter. Thus, Chirp-I seems to be an essential component of the transcriptional machinery that binds to the SDRE hormone response unit, in response to steroid hormone treatment.

Although a large number of W-H family members have been cloned, the roles of only a few have been investigated in detail. The founding members of the family, the HNF-3 proteins, are liver-enriched transcription factors (19), involved in the development of lung and liver (20, 22, 36, 46, 49, 50, 51). HNF-3{alpha} and ß seem to be critically important in the determination of endoderm differentiation (41, 50). The HNF-3 proteins are essential for the expression of several liver-specific genes, including the phosphoenolpyruvate carboxykinase (10), 6-phosphofructo-2-kinase ß (52), and the extremely well-characterized TAT (13, 14, 20, 28, 50, 53). Very little is understood about other members of this diverse family. The identification of a member of this family that is involved in the estrogen-initiated transcriptional circuit for the Ov gene would enhance the understanding both of the functions of the W-H family and of the indirect induction of gene transcription by estrogen.


    Acknowledgments
 
We are grateful to Drs. Howard Towle (University of Minnesota, Minneapolis, MN), Kenneth Zaret (Brown University, Providence, RI), and James Darnell (Rockefeller University, New York, NY) for providing us with nuclear protein extracts, purified protein, and antibodies, as noted in the text. We would like to especially thank Dr. Zaret for helpful comments and discussion during the progress of this work. Finally, we would like to acknowledge the technical assistance of Lyra Hernandez and Natalie Hayes.


    Footnotes
 
1 This work was supported by NIH Grants RO1-DK-40082 (to M.M.S.) and T32-DK-0703 (to D.M.D.). Back

Received February 10, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dean DM, Sanders MM 1996 Ten years after: reclassification of secondary response genes. Mol Endocrinol 10:1489–1495[Abstract]
  2. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  3. Thummel CS 1995 From embryogenesis to metamorphosis: the regulation and function of Drosophila nuclear receptor superfamily members. Cell 83:871–877[CrossRef][Medline]
  4. Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular receptors use a common mechanism to interpret the signaling information at response elements. Genes Dev 10:1271–1283[Abstract/Free Full Text]
  5. Sanders MM, McKnight GS 1985 Chicken egg white genes: multihormonal regulation in a primary cell culture system. Endocrinology 116:398–405[Abstract]
  6. Schweers LA, Frank DE, Weigel NL, Sanders MM 1990 The steroid-dependent regulatory element in the ovalbumin gene does not function as a typical steroid response element. J Biol Chem 265:7590–7595[Abstract/Free Full Text]
  7. McKnight GS, Palmiter RD 1979 Transcriptional regulation of the ovalbumin and conalbumin genes by steroid hormones in chick oviduct. J Biol Chem 254:9050–9058[Free Full Text]
  8. Dean DM, Jones PS, Sanders MM 1996 Regulation of the chick ovalbumin gene by estrogen and corticosterone requires a novel DNA element that binds a labile protein, Chirp-I. Mol Cell Biol 16:2015–2024[Abstract]
  9. Nordstrom LA, Dean DM, Sanders MM 1993 A complex array of double-stranded and single-stranded DNA-binding proteins mediates induction of the ovalbumin gene by steroid hormones. J Biol Chem 268:13193–13202[Abstract/Free Full Text]
  10. Wang J-C, Stromstedt P-E, O’Brien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the stimulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Mol Endocrinol 10:794–800[Abstract]
  11. Thomassin H, Bois-Joyeux B, Delille R, Ikonomova R, Danann J-L 1996 Chicken ovalbumin upstream promoter-transcription factor, hepatocyte nuclear factor 3, and CCAAT/enhancer binding protein control the far-upstream enhancer of the rat {alpha}-fetoprotein gene. DNA Cell Biol 15:1063–1074[Medline]
  12. Taylor AH, Raymond J, Dionne JM, Romney J, Chan J, Lawless DE, Wanke IE, Wong NCW 1996 Glucocorticoid increases rat apolipoprotein A-l promoter activity. J Lipid Res 37:2232–2243[Abstract]
  13. Roux J, Pictet R, Grange T 1995 Hepatocyte nuclear factor 3 determines the amplitude of glucocorticoid response of the rat tyrosine aminotransferase gene. DNA Cell Biol 14:385–396[Medline]
  14. Grange T, Roux J, Rigaud G, Pictet R 1990 Cell-type specific activity of two glucocorticoid responsive units of rat tyrosine aminotransferase gene is associated with multiple binding sites for C/EBP and novel liver-specific nuclear factor. Nucleic Acids Res 19:131–139[Abstract/Free Full Text]
  15. Taylor AH, Fox-Robichaud AE, Lawless DE, Raymond J, Wong NCW Estradiol decreases apolipoprotein AI expression in adult male rats. Program of the 79th Annual Meeting of The Endocrine Society, Minneapolis MN, 1997, p 84 (Abstract)
  16. Nakamura T, Taylor AH, Wong NCW Age related change in rat apolipoprotein AI expression. Program of the 79th Annual Meeting of The Endocrine Society, Minneapolis MN, 1997, p 200 (Abstract)
  17. Harnish DC, Malik S, Kilbourne E, Costa R, Karathanasis SK 1996 Control of apolipoprotein AI gene expression through synergistic interactions between hepatocyte nuclear factors 3 and 4. J Biol Chem 271:13621–13628[Abstract/Free Full Text]
  18. Sutton J, Costa R, Klug M, Field L, Xu D, Largaespada DA, Fletcher CF, Jenkins NA, Copeland NG, Klemsz M, Hromas R 1996 Genesis a winged helix transcriptional repressor with expression restricted to embryonic stem cells. J Biol Chem 271:23126–23133[Abstract/Free Full Text]
  19. Kaufmann E, Knochel W 1996 Five years on the wings of fork head. Mech Dev 57:3–20[CrossRef][Medline]
  20. Cereghini S 1996 Liver-enriched transcription factors and hepatocyte differentiation. FASEB J 10:267–282[Abstract]
  21. Kuzin B, Tillib S, Sedkov Y, Mizrokhi L, Mazo A 1994 The Drosophila trithorax gene encodes a chromosomal protein and directly regulates the region-specific homeotic gene fork head. Genes Dev 8:2478–2490[Abstract/Free Full Text]
  22. Hoch M, Pankratz MJ 1996 Control of gut development by fork head and cell signaling molecules in Drosophila. Mech Dev 58:3–14[CrossRef][Medline]
  23. Roberts DJ, Johnson RL, Burke AC, Nelson CE, Morgan BA, Tabin C 1995 Sonic hedgehog is an endodermal signal inducing BMP-4 and Hox genes during induction and regionalization of the chick hindgut. Development 121:3163–3174[Abstract]
  24. Sanger F, Nicklen S, Coulson A 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  25. Altaba ARi, Placzek M, Baldassare M, Dodd J, Jessell TM 1995 Early stages of notochord and floor plate development in the chick embryo defined by normal and induced expression of HNF-3ß. Dev Biol 170:299–313[CrossRef][Medline]
  26. Sanders MM, McKnight GS 1988 Positive and negative regulatory elements control the steroid-responsive ovalbumin promoter. Biochemistry 27:6550–6557[CrossRef][Medline]
  27. Schweers LA, Sanders MM 1991 A protein with a binding specificity similar to NF-{kappa}B binds to the steroid-dependent regulatory element in the ovalbumin gene. J Biol Chem 266:10490–10497[Abstract/Free Full Text]
  28. Cardinaux J-R, Chapel S, Wahli W 1994 Complex organization of CTF/NF-I, C/EBP and HNF3 binding sites within the promoter of the liver-specific vitellogenin gene. J Biol Chem 269:32947–32956[Abstract/Free Full Text]
  29. Chodosh LA 1988 Mobility shift DNA-binding assay using gel electrophoresis. In: Ausubel FA, Brent R, Kingston RE, Moore DD, Smith JG, Struhl K (eds) Current Protocols in Molecular Biology. John Wiley and Sons Inc., New York, pp 12.2.6–12.2.7
  30. Zaret K, Stevens K 1995 Expression of a highly unstable and insoluble transcription factor in Escherichia coli: purification and characterization of the fork head homolog HNF3{alpha}. Protein Expr Purif 6:821–825[CrossRef][Medline]
  31. Hunter DD, Shah V, Merlie JP, Sanes JR 1989 A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction. Nature 338:229–233[CrossRef][Medline]
  32. Strass WM 1994 Preparation of genomic DNA from mammalian tissues. In: Ausubel FA, Brent R, Kingston RE, Moore DD, Smith JG, Struhl K (eds) Current Protocols in Molecular Biology. John Wiley and Sons Inc., New York, pp 2.2.1–2.2.3
  33. Brown T 1993 Analysis of DNA sequences by blotting and hybridization. In: Ausubel FA, Brent R, Kingston RE, Moore DD, Smith JG, Struhl K (eds) Current Protocols in Molecular Biology. John Wiley and Sons Inc., New York, pp 2.9.1–2.9.19
  34. Prestridge DS 1996 Signal Scan 4.0: additional database and sequence formats. Comput Appl Biosci 12:157–160[Abstract/Free Full Text]
  35. Overdier DG, Porcella A, Costa RH 1994 The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino acid residues adjacent to the recognition helix. Mol Cell Biol 14:2755–2766[Abstract/Free Full Text]
  36. Clevidence DE, Overdier DG, Tao W, Qian X, Pani L, Lai E, Costa R 1993 Identification of nine tissue-specific transcription factors of the hepatocyte nuclear factor 3/forkhead DNA-binding-domain family. Proc Natl Acad Sci USA 90:3948–3952[Abstract/Free Full Text]
  37. Lef J, Clement JH, Oschwald R, Koster M, Knochel W 1994 Spatial and temporal transcription pattern of the forkhead related XHD-2/XFD-2' genes in Xenopus laevis embryos. Mech Dev 45:117–126[CrossRef][Medline]
  38. Welsheimer T, Newbold JE 1996 A functional hepatocyte nuclear factor 3 binding site is a critical component of the duck hepatitis B virus major surface antigen promoter. J Virol 70:8813–8820[Abstract]
  39. Li M, Xie Y, Wu X, Kong Y, Wang Y 1995 HNF3 binds and activates the second enhancer, ENII, of Hepatitis B virus. Virology 214:371–378[CrossRef][Medline]
  40. Costa RH, Grayson DR, Darnell Jr JE 1989 Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and a1-antitrypsin genes. Mol Cell Biol 9:1415–1425[Abstract/Free Full Text]
  41. McPherson CE, Shim E-Y, Friedman DS, Zaret KS 1993 An active tissue-specific enhancer and bound transcription factors existing in a precisely positioned nucleosomal array. Cell 75:387–398[CrossRef][Medline]
  42. Knochel S, Lef J, Clement J, Klocke B, Hille S, Koster M, Knochel W 1992 Activin A induced expression of a fork head related gene in posterior chordamesoderm (notochord) of Xenopus laevis embryos. Mech Dev 38:157–165[CrossRef][Medline]
  43. Rigaud G, Roux J, Pictet R, Grange T 1991 In vivo footprinting of rat TAT gene: dynamic interplay between the glucocorticoid receptor and a liver-specific factor. Cell 67:977–986[CrossRef][Medline]
  44. Ye H, Kelly TF, Samadani U, Lim L, Rubio S, Overdier DG, Roebuck KA, Costa RH 1997 Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating epithelial and mesenchymal cells of embryonic and adult tissues. Mol Cell Biol 17:1626–1641[Abstract]
  45. Hackett BP, Brody SL, Liang M, Zeitz ID, Bruns LA, Gitlin JD 1995 Primary structure of hepatocyte nuclear factor/forkhead homologue 4 and characterization of gene expression in the developing respiratory and reproductive epithelium. Proc Natl Acad Sci USA 92:4249–4253[Abstract/Free Full Text]
  46. Lai E, Prezioso VR, Tao W, Chen WS, Darnell JJE 1991 Hepatocyte nuclear factor 3{alpha} belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev 5:416–427[Abstract/Free Full Text]
  47. Kastner KH, Hiemisch H, Luckow B, Schutz G 1994 The HNF-3 gene family of transcription factors in mice: gene structure, cDNA sequence, and mRNA distribution. Genomics 20:377–385[CrossRef][Medline]
  48. Labosky PA, Winnier GE, Jetton TL, Hargett L, Ryan AK, Rosenfeld MG, Parlow AF, Hogan BLM 1997 The winged helix gene, Mf3 is required for normal development of the diencephalon and midbrain, postnatal growth and the milk-ejection reflex. Development 124:1263–1274[Abstract]
  49. Ikeda K, Shaw-White JR, Wert SE, Whitsett JA 1996 Hepatocyte nuclear factor 3 activates transcription of thyroid transcription factor 1 in respiratory epithelial cells. Mol Cell Biol 16:3626–3636[Abstract]
  50. Ang S-L, Wierda A, WongD, Stevens KA, Cascio S, Rossant J, Zaret KS 1993 The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/fork head proteins. Development 119:1301–1315[Abstract]
  51. Sawaya PL, Luse DS 1994 Two members of the HNF-3 family have opposite effects on a lung transcription element; HNF-3{alpha} stimulates and HNF-3ß inhibits activity of region I from clara cell secretory protein (CCSP) promoter. J Biol Chem 269:22211–22216[Abstract/Free Full Text]
  52. Zimmermann PL, Pierreux CE, Rigaud G, Rousseau GG, Lemaigre FP 1997 In vivo protein-DNA interactions on a glucocorticoid response unit of a liver-specific gene: hormone-induced transcription factor binding to constituitively open chromatin. DNA Cell Biol 16:713–723[Medline]
  53. Szapary D, Oshima H, Simons JSS 1993 A new cis-acting element involved in tissue-selective glucocorticoid inducibility of tyrosine aminotransferase gene expression. Mol Endocrinol 7:941–952AU: What is supposed to be underlined? Only those 2 letters? The copy we received was hard to read. Please make sure all letters appear correctly.[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. Chaudhary, R. Mosher, G. Kim, and M. K. Skinner
Role of Winged Helix Transcription Factor (WIN) in the Regulation of Sertoli Cell Differentiated Functions: WIN Acts as an Early Event Gene for Follicle-Stimulating Hormone
Endocrinology, August 1, 2000; 141(8): 2758 - 2766.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dean, D. M.
Right arrow