help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Papadopoulos, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Papadopoulos, V.
Endocrinology Vol. 139, No. 12 4991-4997
Copyright © 1998 by The Endocrine Society


ARTICLES

Peripheral-Type Benzodiazepine Receptor Function in Cholesterol Transport. Identification of a Putative Cholesterol Recognition/Interaction Amino Acid Sequence and Consensus Pattern1

Hua Li and Vassilios Papadopoulos2

Departments of Cell Biology and Pharmacology, Georgetown University Medical Center, Washington, DC 20007

Address all correspondence and requests for reprints to: Dr. V. Papadopoulos, Department of Cell Biology, Georgetown University Medical Center, 3900 Reservoir Road, Washington, D.C. 20007. E-mail: papadopv{at}gunet.georgetown.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
In steroid-synthesizing cells, like the MA-10 mouse tumor Leydig cells, the peripheral-type benzodiazepine receptor (PBR) is an outer mitochondrial membrane protein involved in the regulation of cholesterol transport from the outer to the inner mitochondrial membrane, the rate-determining step in steroid biosynthesis. Expression of PBR in Escherichia coli DE3 cells, which have no PBR, no cholesterol, and do not make steroids, induced the ability to take up cholesterol in a time-dependent, temperature-sensitive, and energy- independent manner. These cells took up no other steroids tested. Addition of the high affinity PBR ligand PK 11195 to cholesterol-loaded membranes, obtained from cells transfected with PBR, resulted in the release of the uptaken cholesterol. Expression in DE3 cells of mutant PBRs demonstrated that deletions in the cytoplasmic carboxy-terminus dramatically reduced the cholesterol uptake function of PBR, although it retained full capacity to bind PK 11195. Site-directed mutagenesis in the carboxy-terminal region of PBR demonstrated that bacteria expressing the mutant PBR proteins PBR(Y153S) and PBR(R156L) do not accumulate cholesterol, suggesting that amino acids Y153 and R156 are involved in the interaction of the receptor with cholesterol. Considering these results, we postulate the existence of a common cholesterol recognition/interaction amino acid consensus pattern (–L/V-(X)1–5-Y-(X)1–5-R/K-). Indeed, we found this amino acid consensus pattern in all proteins shown to interact with cholesterol. In conclusion, these data suggest that the expression of PBR confers the ability to take up and release, upon ligand activation, cholesterol. Considering the widespread occurrence of this protein and its tissue and cell specific subcellular localization, these results suggest a more general role of PBR in intracellular cholesterol transport and compartmentalization.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
THE PRIMARY POINT of control in the acute stimulation of steroidogenesis by hormones involves the first step in this biosynthetic pathway where cholesterol is converted to pregnenolone by the C27 cholesterol side chain cleavage cytochrome P-450 enzyme (P-450scc) and auxiliary electron transferring proteins, localized on inner mitochondrial membranes (IMM) (1, 2). More detailed studies have shown that the reaction catalyzed by P-450scc is not the rate-limiting step in the synthesis of steroid hormones. Rather, the rate-limiting step is the transport of the precursor, cholesterol, from intracellular sources to the IMM. This hormone-dependent transport mechanism was shown to be localized in the mitochondrion (1, 2).

The peripheral-type benzodiazepine receptor (PBR) was originally discovered because it binds the benzodiazepine diazepam with relatively high affinity (3). Benzodiazepines are among the most highly prescribed drugs due to their pharmacological actions in relieving anxiety mediated through modulating the activity of {gamma}-aminobutyric acid receptors in the central nervous system (4). PBR is another class of binding sites for benzodiazepines distinct from the aforementioned neurotransmitter receptors. Further studies demonstrated that in addition to benzodiazepines, PBR binds other classes of organic compounds with high affinity (3). PBR, although present in all tissues examined, was found to be particularly high in steroid producing tissues, where it was primarily localized in the outer mitochondrial membrane (OMM) (5). An 18 kDa isoquinoline-binding protein was identified as PBR, cloned and expressed (6). It was then demonstrated that PBR is a functional component of the steroidogenic machinery (6, 7) mediating cholesterol delivery from the outer to the inner mitochondrial membrane (8). Further studies demonstrated that pharmacologically induced reduction of adrenal PBR levels in vivo resulted in decreased circulating glucocorticoid levels (6). In addition, targeted disruption of the PBR gene in Leydig cells resulted in the arrest of cholesterol transport into mitochondria and steroid formation; transfection of the mutant cells with a PBR complementary DNA (cDNA) rescued steroidogenesis (9).

Based on the known amino acid sequence of the human and mouse 18 kDa PBR protein a three dimensional model of this receptor protein was developed using molecular dynamics simulations (10, 11). The receptor model developed, where the five transmembrane domains of PBR were modeled as five {alpha} helices, was tested as a cholesterol carrier, and it was shown that both the human and mouse PBR can accommodate cholesterol and function as a channel. However, this is a hypothetical model that needs to be tested.

In the present paper, we identify a cholesterol recognition amino acid sequence on PBR, common to all proteins shown to interact with cholesterol, and demonstrate that PBR functions as a cholesterol channel-like structure, mediating cholesterol transport across membranes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
MA-10 Leydig cells
MA-10 mouse Leydig tumor cells were maintained as we previously described (7). For the cholesterol uptake assays, mitochondria were isolated as we described (7, 8) and resuspended in buffer A (250 mM Sucrose, 20 mM KCl, 15 mM trietholamine hydrochloride [pH 7.0], 10 mM K3PO4 and 10 mM MgCl2) at 1 mg/ml total protein concentration (12). Mitochondria were then incubated with [1,2-3H]-cholesterol (0.127 µCi/100 nmol) in 0.3 ml buffer A at 37 C (or the indicated temperature) for the indicated time period. At the end of the incubation, steroids were extracted and 3H-pregnenolone formed was isolated by TLC and quantified (13).

Construction of the mouse PBR expression vector (pET15bPBR) and expression of recombinant PBR in bacteria
The pET system (Novagen, Madison, WI) was used to express the MA-10 mouse PBR (mPBR) recombinant protein. The insert containing full length coding sequence as well as the NdeI and XhoI site extensions at the 5' and 3' ends were generated by PCR using the following primers: ATATATACATATGCCTGAATCCT-GGGTG and ATACTCGAGTGGGTGCCTTCACTCTG, respectively. The MA-10 full length PBR cDNA (14) was used as template. This mPBR fragment was inserted into pET15b vector and linearized with NdeI and XhoI downstream of the T7lac promoter. Recombinant mPBR expression vector was used to transform the BL21(DE3) Escherichia coli strain where the expression of recombinant mPBR protein was induced by 1 mM isopropyl-1-thiol-ß-D-galactopyranoside (IPTG). PBR protein expression was monitored by SDS-PAGE followed by Coomassie Blue staining or immunoblot analysis using anti-PBR antiserum (13). Binding specificity of the IPTG-induced PBR in Escherichia coli was determined in binding studies where specific binding of 3H-PK 11195 (1.0 nM) was measured in the presence of the indicated concentrations of the indicated ligands.

3H-Cholesterol uptake by E. coli cells was examined using the indicated concentrations of control or IPTG-treated transformed bacteria incubated in the presence of 6.7 nM 3H-cholesterol (50.0 Ci/mmol) for 60 min at 37 C. Specific cholesterol uptake is defined as IPTG-induced minus basal values. Escherichia coli protoplasts were prepared from cells grown in LB at 37 C to the logarithmic phase of growth and centrifuged at 10,000 x g for 5 min. The cells were washed twice in 10 mM Tris-HCl buffer, pH 8.0, and the pellet was resuspended in a solution containing 20% (wt/wt) sucrose and 0.1 M Tris-HCl, pH 8.0. The cells were then suspended in 1 ml of buffer per 10 OD450 and mixed. Within 1 min, lysozyme was added from a 2 mg/ml stock solution in distilled water to a final concentration of 100 µg/ml at 37 C, and stirring was continued for the next 12 min. The cell suspension was diluted 1:10 with 0.1 M Na2EDTA prewarmed to 37 C. Continuous stirring and slow dilution over 2.5 min prevented cell lysis. More than 99% of the cells became spherical within 10 min (15). Protoplasts (100 µg in 0.3 ml final volume) were then incubated in the presence of 6.7 nM 3H-cholesterol (50.0 Ci/mmol) for 60 min at 37 C for cholesterol uptake assays. 3H-Cholesterol-labeled membranes of IPTG-induced transformed bacteria, incubated with 30 nM 3H-cholesterol, were treated with PK 11195 or clonazepam, and the 3H-cholesterol released was quantified by liquid scintillation spectrometry.

Site-directed mutagenesis
Mutations were performed using the QuikChange Site-Directed Mutagenesis kit from Stratagene (La Jolla, CA). Briefly, miniprep pET-PBR plasmid dsDNA was used as template. Synthetic oligonucleotide primer pairs containing A147T, Y153S, R155L point mutations and PBR deletions, {Delta}5–20, {Delta}41–51, {Delta}108–119, {Delta}120–133, {Delta}141–152, {Delta}153–169, each complementary to the opposing strand of the vector, were extended during temperature cycling by pfu DNA polymerase. Upon incorporation of the oligonucleotide primers, mutated plasmids containing staggered nicks were generated. After temperature cycling, the products were treated with DpnI is used to digest the parental DNA template and select for the generated mutation. The nicked vector DNAs containing the desired mutations were then transformed into Escherichia coli. The mutated plasmids were prepared by ABI Prism Miniprep Kit. The generated mutations and deletions were confirmed by sequencing using the ABI Prism Dye Terminator Cycle Sequencing ready reaction kit (Perkin Elmer Corp., PE Applied Biosystems, Foster City, CA). DNA sequencing was performed at the Lombardi Cancer Center Sequencing Core Facility (Georgetown University).

Radioligand binding assays
3H-1-(2-chlorophenyl)-N-methyl-N-(1-methyl-propyl)-3-isoquinolinecarboxamide (PK 11195) binding studies were performed as we previously described (7, 14). The dissociation constant (Kd) and the number of binding sites (Bmax) were determined by Scatchard plot analysis of the data using the LIGAND program (Biosoft, Ferguson, MO) (16).

Protein measurement
Microgram amounts of protein were quantified using the dye-binding assay of Bradford (17) using BSA as the standard.

Statistics
The results shown represent the means ± SD or SEM from two to six independent experiments. Statistical analysis was performed by ANOVA followed by the Student-Newman-Keuls test or the Dunnett multiple comparisons test using the Instat (version 2.04) package from GraphPad, Inc. (San Diego, CA).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
A three-dimensional model of human PBR was built using molecular dynamics simulations and shown to accommodate a cholesterol molecule within its five helices (10). Despite differences in the primary amino acid sequence between the human and mouse PBR, similar data were obtained when the mouse 18 kDa PBR protein was submitted to the same analysis (17), further suggesting that PBR may function as a channel for cholesterol. To test this hypothetical model, we used two cell model systems: 1) the MA-10 Leydig cells, a steroidogenic cell model that expresses high levels of PBR (~40 pmol/mg protein; 7), and as all eukaryotic cells contains endogenous cholesterol; and 2) the Escherichia coli DE3 cells which do not express PBR (this study), do not have endogenous cholesterol (18) and do not form steroids. Thus, using these cell models we attempted to correlate PBR expression with the cholesterol transport function. In addition, we used a method with radiolabeled cholesterol (12) to quantify cholesterol movement. This method allows for the distinction between the exogenously supplied cholesterol and the endogenous cholesterol, permitting an easy quantification, and direct measurement of the pregnenolone formed, in the case of the steroidogenic cells where cholesterol transported to IMM is cleaved by the P450scc to generate pregnenolone. Data shown in Fig. 1Go validate the use of this method. Figure 1Go shows that in the steroidogenic Leydig cells, 3H-cholesterol uptake by the mitochondria and transport from OMM to IMM were stimulated by specific PBR ligands resulting in increased 3H-pregenenolone formation. These data are in agreement with previous findings in all steroid synthesizing cell types of the body (3, 6). Moreover, a similar PBR-dependent cholesterol transport mechanism from OMM to IMM was recently identified in liver mitochondria (19). Cholesterol transport to liver IMM may be required for cholesterol detoxification from the periphery by the IMM sterol-27-hydroxylase (19). Interestingly, the rate of cholesterol uptake and intramitochondrial transport to IMM, in response to PBR ligand activation, was identical (0.9 nmol/mg protein·min) for adrenal (8) and liver (19) mitochondria, suggesting that a similar PBR-mediated cholesterol transport mechanism is operative in both steroidogenic and nonsteroidogenic tissues.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Effect of PBR ligands on MA-10 Leydig cell cholesterol transport and pregnenolone formation. Mitochondria from MA-10 Leydig cells were incubated with 3H-cholesterol in the presence or absence of the indicated compounds. 3H-Pregnenolone formed was measured as described in Materials and Methods. Data (means ± SD) shown are representative of two to four independent experiments, each having triplicate assays. The effect seen was statistically significant at all times (P < 0.001).

 
As noted above, a bacterium is a model system without endogenous cholesterol (18). In addition, bacteria do not express PBR protein (Fig. 2AGo) and ligand binding (not shown), although the presence of a PBR homologous protein, the tryptophan-rich-sensory-protein tspO (also called crtK), involved in carotenoid biosynthesis in Rhodobacter capsulatus and Rhodobacter sphaeroides photosynthetic bacteria, has been reported (20). Escherichia coli were transfected with mouse PBR cDNA in a pET vector. Addition of IPTG to transfected bacteria resulted in the expression of the 18 kDa PBR protein (Fig. 2AGo) and ligand binding (Fig. 2BGo; Kd = 1.1 nM and Bmax = 0.23 pmol/mg protein) with similar pharmacological characteristics to that previously described for PBR (3, 7) (Fig. 2CGo). IPTG-induced PBR expression resulted in a protein (Fig. 3AGo), time (Fig. 3BGo), and temperature-dependent uptake of radiolabeled cholesterol (Fig. 3BGo). This cholesterol uptake was maintained when protoplasts were prepared indicating that PBR resides in the internal bacterial plasma membrane (data not shown). The uptake of cholesterol could not be blocked by energy poisons (21) (Fig. 3CGo). In addition, it was specific for cholesterol because no uptake of other radiolabeled steroid could be seen (Fig. 3DGo), and could not be saturated at the concentrations of radiolabeled cholesterol used (Fig. 3EGo), suggesting that PBR functions as a channel for cholesterol rather than a cholesterol-binding protein, which is in agreement with the modeling studies (10, 11). When IPTG-induced, cholesterol-loaded, bacterial membranes were treated with PK 11195, cholesterol was liberated from the membranes (Fig. 3FGo), suggesting that cholesterol captured by PBR is released upon ligand binding. Thus, PBR serves a channel-like or a port function where cholesterol can enter and reside stored within the membrane without interacting with the lipid or protein components of the lipid bilayer. This may also be the way by which the mitochondria sort between the steroidogenic pool of cholesterol from the cholesterol component of the membrane. Thus, PBR ligands control the opening/release state of the channel, mediating cholesterol movement across membranes. In addition to the PBR drug ligands, the polypeptide diazepam binding inhibitor (DBI) and porphyrins (3) have been identified as naturally occurring endogenous ligands. It should be noted that at present we couldn’t exclude the possibility that PBR functions as a flippase or a transporter.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Expression of recombinant PBR in bacteria. Recombinant mPBR expression vector was developed and used to transform the BL21(DE3) Escherichia coli strain as described under Materials and Methods. The expression of recombinant mPBR protein was induced by 1 mM IPTG. A, PBR protein expression was monitored by SDS-PAGE followed by Coomassie Blue staining or immunoblot analysis. 1, Control; 2 and 3, two different preparations of IPTG-treated bacteria. B, Scatchard representation of the specific binding of 3H-PK 11195 to IPTG-induced bacteria. C, Binding specificity of the IPTG-induced PBR in Escherichia coli. Specific binding of [3H]PK 11195 (1.0 nM) was measured in the presence of the indicated concentrations of various ligands.

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. Characteristics of 3H-cholesterol uptake by E. coli cells. A, 3H-Cholesterol uptake by E. coli cells was examined using increasing concentrations of control or IPTG-treated transformed bacteria incubated in the presence of 6.7 nM 3H-cholesterol (50.0 Ci/mmol) for 60 min at 37 C. Specific cholesterol uptake is defined as IPTG-induced minus basal values. B, 3H-Cholesterol specific uptake examined at the indicated temperatures using 100 µg bacterial protein. C, Effect of energy poisons on 3H-cholesterol uptake by IPTG-induced transformed bacteria. D, PBR expression induces uptake of cholesterol only. Bacteria were incubated under the same conditions as described above in the presence of the indicated radiolabeled steroid. E, 3H-Cholesterol specific uptake determined in the presence of increasing concentrations of 3H-cholesterol. F, Ligand-induced release of cholesterol uptaken by the bacterial membranes. 3H-Cholesterol-labeled membranes of IPTG-induced transformed bacteria were incubated with increased concentrations of PK 11195 or clonazepam, and the 3H-cholesterol released was quantified. The results shown represent means ± SD from an experiment performed in triplicate. Similar results were obtained in three other independent experiments.

 
In support of the data presented herein, targeted disruption of the PBR gene in steroidogenic cells resulted in inhibition of cholesterol transport to IMM and arrest of steroid biosynthesis (9). Transfecting PBR mutant Leydig cells with the PBR cDNA rescued steroidogenesis and demonstrated the obligatory role of PBR in cholesterol transport (9).

PBR is an 18 kDa hydrophobic protein with five putative transmembrane domains located in the OMM. As a first step in defining the regions of the receptor involved in the interaction with the drug ligand and cholesterol, we constructed mutant PBRs with the deletions indicated in the left panel of Fig. 4Go. The location of the five transmembrane regions of the receptor (I to V) is also shown in Fig. 4Go. It should be noted that the amino-terminus of mitochondrial membrane proteins is directed toward the inside of the organelle, whereas the carboxy-terminus is in the cytoplasmic side. The right panel of Fig. 4Go shows the effect of deletion of specific amino acid sequences on PBR ligand binding and cholesterol uptake examined in the bacterial system described above. Deletion of amino acid sequences 5–20 and 41–51 in the amino-terminus of the receptor decreased by 30–45% the ability of PBR to bind the ligand PK 11195. Our results are in agreement with previous studies on human PBR expressed in yeast (22), although in those studies deletion of the amino-terminus of human PBR completely abolished the ability of the receptor to bind PK 11195. Deletion of amino acids 120–133 in the fourth transmembrane domain also decreased PBR ligand binding by 45%. Smaller decrease (25%) of PK 11195 binding was also seen when the regions 141–152 and 153–169 were deleted. These results suggest that, although the amino- terminus of the receptor may confer the ability to bind drug ligands, such as the isoquinoline PK 11195, amino acid sequences in the fourth transmembrane domain may participate in the formation of the ligand binding site. It should be noted that deletions affecting PK 11195 ligand binding did not had a major effect on the ability of the recombinant receptor expressed in bacterial membranes to take up radiolabeled cholesterol.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Deletion mutation analysis of PBR function-PK 11195 ligand binding and 3H-cholesterol uptake by bacteria transfected with the wild-type and mutated PBRs. The expression of the proteins was induced by IPTG. Left, The five transmembrane regions of PBR are shown as well as the location of the deletions undertaken. Right, The effect of each deletion on PK 11195 ligand binding and cholesterol uptake is shown. Results shown are the means of triplicates. 100% of PK 11195 ligand binding corresponds to 280 ± 22 fmol/mg protein. 100% of specific cholesterol uptake corresponds to 1.35 ± 0.15 pmol/per mg of protein.

 
Figure 4Go also shows that deletion of amino acids 153–169 in the carboxy-terminus of PBR had a dramatic effect on the ability of the molecule to take up 3H-cholesterol when expressed in bacteria (70% decrease). This result suggests that the cytoplasmic carboxy-terminal domain of the receptor is responsible for the interaction and subsequent uptake of cholesterol. In an effort to identify specific amino acids in PBR responsible for the interaction with cholesterol, we undertook site-directed mutagenesis studies in the carboxy-terminal region.

Recent studies by Pikuleva et al. (23) with another protein that interacts with cholesterol, the enzyme P450scc, indicated that a Tyrosine in the active site of the P450scc interacts with the side chain of cholesterol. Aligning the P450scc active site amino acid sequence with the carboxy-terminus of PBR indicated that there might be a common amino acid consensus pattern in these two molecules recognizing cholesterol (Table 1Go). This consensus pattern is composed of a neutral and hydrophobic amino acid, such as Leucine or Valine, a neutral and polar amino acid, such as Tyrosine, and a basic amino acid, such as Arginine or Lysine. One to five different amino acids may be placed between these three coding amino acids. Thus, the proposed consensus pattern is –L/V-(X)1–5-Y-(X)1–5-R/K-. Leucine or Valine will interact with the hydrophobic side chain of cholesterol and Tyrosine will interact with the polar 3'OH-group of cholesterol, whereas the Arginine or Lysine may help create a pocket. This hypothesis was tested (Fig. 5Go). Replacement of Y153 by Serine or R156 by Leucine completely abolished the ability of PBR to take up radiolabeled cholesterol. Mutation and replacement of A147 with Threonine, did not affect cholesterol uptake by bacteria expressing the mutated receptor. Figure 5Go also shows that the wild-type and mutated recombinant receptor proteins were expressed at equal levels upon IPTG induction.


View this table:
[in this window]
[in a new window]
 
Table 1. Identification of the cholesterol recognition/interaction amino acid consensus pattern

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. Identification of specific amino acids responsible for the uptake of cholesterol. 3H-Cholesterol uptake by bacteria transfected with the wild-type and point-mutated PBRs (bottom). The expression of the proteins was induced by IPTG. 100% of specific cholesterol uptake corresponds to 1.2 ± 0.1 pmol of cholesterol per mg of protein. Immunoblot analysis of the mutated PBRs expressed by the bacteria examined for 3H-cholesterol uptake. (top). Results shown are the means of triplicates.

 
In an effort to see whether this putative cholesterol recognition/interaction amino acid consensus pattern is present in other molecules shown or suggested to interact with cholesterol, such as the apolipoprotein A-I (24), caveolin (25), DBI (3, 6), steroidogenesis acute regulatory protein (StAR; 26), hedgehog protein (27), cytochrome P450 C26/25 (28), annexin II (29) sterol carrier protein-2 (30), cholesterol 7{alpha}-monooxygenase (31), cholesterol oxidase (32), cholesterol dehydrogenase (33), bile-salt-activated lipase precursor (cholesterol esterase) (34), and acyl-CoA cholesterol acyltransferase (35) we looked for the presence of the cholesterol recognition/interaction amino acid consensus pattern –L/V-(X)1–5-Y-(X)1–5-R/K- in these proteins. Table 1Go shows that all these proteins, with the exception of sterol carrier protein-2, contain this amino acid consensus pattern. Proteins such as rat skeletal muscle {alpha}-actin, nonmuscle and smooth muscle myosin light chain did not contain this cholesterol recognition/interaction consensus pattern. However, given any tyrosine there is a reasonably high probability that this consensus amino acid sequence will be found in many proteins. Indeed, a motif search through the various gene data banks indicated that this amino acid consensus pattern is present in various proteins. This is not surprising because it is known that the cholesterol/protein interaction plays a role not only in cholesterol transport and/or storage but also in protein stability, folding, and/or localization. Thus, it is possible that only in some proteins this consensus sequence will be functional. The strength and specificity of the interaction of a protein containing this consensus amino acid sequence with cholesterol may be due either to the presence of a certain microenvironment, or the location of the consensus sequence within the protein, or a specific conformation of the protein that allows the use of this amino acid sequence. In the latter case, it is also possible that the consensus sequence identified represents only a portion, may the core, of a larger motif to be identified.

Of special interest to steroidogenesis is the observation that the cholesterol recognition/interaction amino acid consensus pattern was found in the polypeptide DBI (3, 6) and the precursor StAR protein (26). In search of a cytosolic steroidogenesis-stimulating factor, a protein was purified shown to be identical to DBI (3). DBI was originally purified from brain by monitoring its ability to displace diazepam from its recognition sites in synaptosomes. DBI is also identical to the acyl-CoA-binding protein (36). Purified DBI was shown to stimulate intramitochondrial cholesterol transport and increase pregnenolone formation by isolated mitochondria (6). Later on, it was demonstrated that this action of DBI was mediated by PBR (3, 6). In addition, DBI was shown to increase cholesterol loading onto isolated P450scc (37). Thus, the identification of the cholesterol recognition/interaction amino acid consensus pattern in DBI may help understand its role in steroidogenesis and its direct effect on P450scc. Interestingly, we showed in the past that the naturally occurring processing product of DBI, the triakontatetrapeptide TTN (DBI17–50), but not the octadecaneuropeptide ODN (DBI33–50), was able to mimic the effect of DBI on mitochondrial steroidogenesis (38). The finding that in DBI the cholesterol recognition/interaction amino acid consensus pattern is located in the amino acid sequence 25 to 32 (Table 1Go) may now explain this result. It should be also noted that the cholesterol recognition/interaction amino acid consensus pattern is found in the middle of the acyl-CoA-binding protein signature domain (amino acids 19 to 37) important in forming the acyl-CoA-binding site (36).

StAR has been found in gonadal and adrenal cells, where it is newly synthesized in response to trophic hormones, as a cytoplasmic precursor protein of 37 kDa targeted to mitochondria (26). StAR synthesis in Leydig cells begins 60 min after addition of the hormone and then parallels the capacity of the cells to produce steroids in response to tropic hormones (26, 39). The 37 kDa StAR precursor further undergoes cleavage to produce the 30 kDa mitochondrial mature StAR protein and its phosphorylated counterpart (26). This protein processing is believed to occur at the level of the outer/inner mitochondrial membrane contact sites and it has been proposed to be responsible for cholesterol transport from outer to inner mitochondrial membrane (26). Considering that the cholesterol recognition/interaction amino acid consensus pattern is found in the amino-terminus of the StAR precursor protein, which is removed from the mature protein, it is possible that the function of the precursor StAR protein is to shuttle cholesterol from intracellular stores to the outer mitochondrial membrane.

In conclusion, the results presented herein demonstrate that PBR may have a channel-like function for cholesterol in the OMM. The steroidogenic pool of cholesterol, coming from various intracellular sources, is recognized by the cholesterol recognition/interaction amino acid consensus pattern –L/V-(X)1–5-Y-(X)1–5-R/K- present in the carboxy-terminus of PBR in the OMM. This pool of cholesterol enters in the OMM at the PBR sites where it remains without mixing with other membrane components. Ligand binding to the receptor induces the release of this cholesterol. Considering that PBR has been shown to be associated with the voltage-dependent anion channel (6), found in the outer/inner mitochondrial membrane contact sites, the released cholesterol could now directly access the P450scc in the IMM where it will be cleaved to pregnenolone, precursor of all steroids.

In addition to being a precursor for steroid hormone synthesis, cholesterol is an essential structural element of cellular membranes and a precursor for the synthesis of bile acids and lipoproteins. Mammalian cells obtain cholesterol by internalization of low density lipoproteins or by de novo synthesis in the endoplasmic reticulum. The subcellular distribution of cholesterol suggests that cholesterol is trafficked and incorporated quickly from the sites of acquisition to the target membrane (40). Thus, a tissue and cell specific cholesterol homeostasis is achieved. Considering the widespread occurrence of PBR and its tissue and cell specific subcellular localization (3, 6), these results suggest a more general role for PBR in intracellular cholesterol transport and compartmentalization.


    Acknowledgments
 
The authors thank Drs. E. Roberts (Beckman Research Institute, Duarte, CA) for his encouragement in searching for a cholesterol recognition sequence shared by various proteins and M. Culty (Georgetown University Medical Center, Washington, DC) for critically reviewing the manuscript.


    Footnotes
 
1 This work was supported by grant number ES-07747 from the National Institute of Environmental Health Sciences, NIH (to V.P.). Back

2 Supported by a Research Career Development Award (HD-01031) from the National Institute of Child Health and Human Development, NIH. Back

Received May 19, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Simpson ER, Waterman MR 1983 Regulation by ACTH of steroid hormone biosynthesis in the adrenal cortex. Can J Biochem Cell Biol 61:692–707[Medline]
  2. Jefcoate CR, McNamara BC, Artemenko I, Yamazaki T 1992 Regulation of cholesterol movement to mitochondrial cytochrome P450scc in steroid hormone synthesis.
  3. Papadopoulos V 1993 Peripheral-type benzodiazepine/diazepam binding inhibitor receptor: biological role in steroidogenic cell function. Endocr Rev 14:222–240[Abstract/Free Full Text]
  4. Costa E, Guidotti A 1979 Molecular mechanism in the recptor actions of benzodiazepines. Annu Rev Pharmacol Toxicol 19:531–545[CrossRef][Medline]
  5. Anholt RRH, Pedersen PL, DeSouza EB, Snyder SH 1986 The peripheral-type benzodiazepine receptor: localization to the mitochondrial outer membrane. J Biol Chem 261:576–583[Abstract/Free Full Text]
  6. Papadopoulos V 1998 Structure and function of the peripheral-type benzodiazepine receptor in steroidogenic cells. Proc Soc Exp Biol Med 217:130–142[CrossRef][Medline]
  7. Papadopoulos V, Mukhin AG, Costa E, Krueger KE 1990 The peripheral-type benzodiazepine receptor is functionally linked to Leydig cell steroidogenesis. J Biol Chem 265:3772–3779[Abstract/Free Full Text]
  8. Krueger KE, Papadopoulos V 1990 Peripheral-type benzodiazepine receptors mediate translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells. J Biol Chem 265:15015–15022[Abstract/Free Full Text]
  9. Papadopoulos V, Amri H, Li H, Boujrad N, Vidic B, Garnier M 1997 Targeted disruption of the peripheral-type benzodiazepine receptor gene inhibits steroidogenesis in the R2C Leydig tumor cell line. J Biol Chem 272:32129–32135[Abstract/Free Full Text]
  10. Bernassau JM, Reversat JL, Ferrara P, Caput D, Lefur G 1993 A 3D model of the peripheral benzodiazepine receptor and its implication in intra mitochondrial cholesterol transport. J Mol Graph 11:236–245[CrossRef][Medline]
  11. Papadopoulos V 1996 Pharmacologic influence on androgen biosynthesis. In: Payne AH, Hardy MP, Russell LD (eds) The Leydig Cell. Cache River Press, Vienna, IL, pp 598–628
  12. Leaver HA, Boyd GS 1981 Control of steroidogenesis in rat corpus luteum: the rate of access of cholesterol to the active site of the cholesterol side-chain cleavage enzyme. J Endocrinol 91:123–133[Abstract/Free Full Text]
  13. Amri H, Ogwuegbu SO, Boujrad N, Drieu K, Papadopoulos V 1996 In vivo regulation of the peripheral-type benzodiazepine receptor and glucocorticoid synthesis by the Ginkgo biloba extract EGb 761 and isolated ginkgolides. Endocrinology 137:5707–5718[Abstract]
  14. Garnier M, Dimchev A, Boujrad N, Price MJ, Musto NA, Papadopoulos V 1994 In vitro reconstitution of a functional peripheral-type benzodiazepine receptor. Mol Pharm 45:201–211[Abstract]
  15. Weiss R L 1978 Methods for protoplast formation in Escherichia coli. Meth Cell Biol 20:141–147[Medline]
  16. Munson PJ, Rodbard D 1980 LIGAND: a versatile computerized approach for charcterization of ligand binding systems. Anal Biochem 107:220–239[CrossRef][Medline]
  17. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  18. Moat AG, Foster JW 1995 Microbial Physiology. Wiley-Liss, New York
  19. Tsankova V, Magistrelli A, Cantoni L, Tacconi MT 1995 Peripheral benzodiazepine receptor ligands in rat liver mitochondria: effect on cholesterol translocation. Eur J Pharm 294:601–607[CrossRef][Medline]
  20. Yeliseev AA, Kaplan S 1995 A sensory transducer homologous to the mammalian peripheral-type benzodiazepine receptor regulates photosynthetic membrane complex formation in Rhodobacter sphaeroides 2.4.1. J Biol Chem 270:21167–21175[Abstract/Free Full Text]
  21. DeGrella RF, Simoni RD 1982 Intracellular transport of cholesterol to the plasma membrane. J Biol Chem 257:14256–14262[Abstract/Free Full Text]
  22. Farges R, Joseph-Liauzun E, Shire D, Caput D, Le Fur G, Ferrara P 1994 Site-directed mutagenesis of the peripheral benzodiazepine receptor: identification of amino acids implicated in the binding site of Ro5–4864. Mol Pharm 46:1160–1167[Abstract]
  23. Pikuleva IA, Mackman RL, Kagawa N, Waterman MR, Ortiz de Montellano PR 1995 Active-site topology of bovine cholesterol side-chain cleavage cytochrome P450 (P450scc) and evidence for interaction of tyrosine 94 with the side chain of cholesterol. Arch Biochem Biophys 322:189–197[CrossRef][Medline]
  24. Boyle TP, Marotti KR 1992 Structure of the murine gene encoding apolipoprotein A-I. Gene 117:243–247[Medline]
  25. Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia T, Simons K 1995 VIP21/caveolin is a cholesterol-binding protein. Proc Natl Acad Sci USA 92:10339–10343[Abstract/Free Full Text]
  26. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
  27. Porter JA, Young KE, Beachy PA 1996 Cholesterol modification of hedgehog signaling proteins in animal development. Science 274:255–259[Abstract/Free Full Text]
  28. Su P, Rennert H, Shayiq RM, Yamamoto R, Zheng YM, Addya S, Stracuu JF III, Avadhani NG 1990 A cDNA encoding a rat mitochondrial cytochrome P450 catalyzing both the 26-hydroxylation of cholesterol and 25-hydroxylation of vitamin D3:gonadotropic regulation of the cognate mRNA in ovaries. DNA Cell Biol 9:657–667[Medline]
  29. Harder T, Kellner R, Parton RG, Gruenberg J 1997 Specific release of membrane-bound annexin II and cortical cytoskeletal elements by sequestration of membrane cholesterol. Mol Biol Cell 8:533–545[Abstract]
  30. Colles SM, Woodford JK, Moncecchi D, Myers-Payne SC, McLean LR, Billheimer JT, Schroeder F 1995 Cholesterol interaction with recombinant human sterol carrier protein-2. Lipids 30:795–803[Medline]
  31. Kai M, Eto T, Kondo K, Setogushi Y, Higashi S, Maeda Y, Setogushi T 1995 Synchronous circadian rhythms of mRNA levels and activities of cholesterol 7 alpha-hydroxylase in the rabbit and rat.J. Lipid Res 36:367–374[Abstract]
  32. Ishizaki T, Hirayama N, Shinkawa H, Nimi O, Murooka Y 1989 Nucleotide sequence of the gene for cholesterol oxidase from a Streptomyces sp. J Bacteriol 171:596–601[Abstract/Free Full Text]
  33. Horinouchi S, Ishizuka H, Beppu T 1991 Cloning, nucleotide sequence, and transcriptional analysis of the NAD(P)-dependent cholesterol dehydrogenase gene from a Nocardia sp. and its hyperexpression in Streptomyces spp. Appl Environ Microbiol 57:1386–1393[Abstract/Free Full Text]
  34. Nilsson J, Blaeckberg L, Carlsson P, Enerbaeck S, Hernell O, Bjursell G 1990 cDNA cloning of human-milk bile-salt-stimulated lipase and evidence for its identity to pancreatic carboxylic ester hydrolase. Eur J Biochem 192:543–550[Medline]
  35. Pape ME, Schultz PA, Rea TJ, DeMattos RB, Kieft K, Bisgaier CL, Newton RS, Krause BR 1995 Tissue specific changes in acyl-CoA: cholesterol acyltransferase (ACAT) mRNA levels in rabbits. J Lipid Res 36:823–838[Abstract]
  36. Knudsen J, Mansrup S, Rasmussen JT, Andreasen PH, Poulsen F, Kristiansen K 1993 The function of acyl-CoA-binding protein (ACBP)/diazepam binding inhibitor (DBI). Mol Cell Biochem 123:129–138[CrossRef][Medline]
  37. Brown AS, Hall PF 1991 Stimulation by endozepine of the side-shain cleavage of cholesterol in a reconstituted enzyme system. Biochem Biophys Res Commun 180:609–614[CrossRef][Medline]
  38. Papadopoulos V, Berkovich A, Krueger KE, Costa E, Guidotti A 1991 Diazepam Binding Inhibitor (DBI) and its processing products stimulate mitochondrial steroid biosynthesis via an interaction with mitochondrial benzodiazepine receptors. Endocrinology 129:1481–1488[Abstract/Free Full Text]
  39. Clark BJ, Soo S-C, Caron KM, Ikeda Y, Parker KL, Stocco DM 1995 Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocr 9:1346–1355[Abstract/Free Full Text]
  40. Liscum L, Underwood KW 1995 Intracellular cholesterol transport and compartmentation. J Biol Chem 270:15433–15446AU: Alignment of items in the second column is not clear—what kinds of changes do we need to make, if any, regarding alignment?



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Chen, T. Cai, H. Wang, Z. Li, E. Loreaux, J. B. Lingrel, and Z. Xie
Regulation of Intracellular Cholesterol Distribution by Na/K-ATPase
J. Biol. Chem., May 29, 2009; 284(22): 14881 - 14890.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
B. Chini and M. Parenti
G-protein-coupled receptors, cholesterol and palmitoylation: facts about fats
J. Mol. Endocrinol., May 1, 2009; 42(5): 371 - 379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Boesze-Battaglia, A. Brown, L. Walker, D. Besack, A. Zekavat, S. Wrenn, C. Krummenacher, and B. J. Shenker
Cytolethal Distending Toxin-induced Cell Cycle Arrest of Lymphocytes Is Dependent upon Recognition and Binding to Cholesterol
J. Biol. Chem., April 17, 2009; 284(16): 10650 - 10658.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. S.-L. Chen, P. Yang, P.-Y. Ke, H.-F. Li, W.-E. Chan, D.-K. Chang, C.-K. Chuang, Y. Tsai, and S.-C. Huang
Identification of the LWYIK Motif Located in the Human Immunodeficiency Virus Type 1 Transmembrane gp41 Protein as a Distinct Determinant for Viral Infection
J. Virol., January 15, 2009; 83(2): 870 - 883.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. Das, M. A. Davis, and L. L. Rudel
Identification of putative active site residues of ACAT enzymes
J. Lipid Res., August 1, 2008; 49(8): 1770 - 1781.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Kirkham, S. J. Nixon, M. T. Howes, L. Abi-Rached, D. E. Wakeham, M. Hanzal-Bayer, C. Ferguson, M. M. Hill, M. Fernandez-Rojo, D. A. Brown, et al.
Evolutionary analysis and molecular dissection of caveola biogenesis
J. Cell Sci., June 15, 2008; 121(12): 2075 - 2086.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-H. Sun, D. C. Flynn, V. Castranova, L. L. Millecchia, A. R. Beardsley, and J. Liu
Identification of a Novel Domain at the N Terminus of Caveolin-1 That Controls Rear Polarization of the Protein and Caveolae Formation
J. Biol. Chem., March 9, 2007; 282(10): 7232 - 7241.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Hager-Braun, H. Katinger, and K. B. Tomer
The HIV-Neutralizing Monoclonal Antibody 4E10 Recognizes N-Terminal Sequences on the Native Antigen.
J. Immunol., June 15, 2006; 176(12): 7471 - 7481.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. G. Parton, M. Hanzal-Bayer, and J. F. Hancock
Biogenesis of caveolae: a structural model for caveolin-induced domain formation.
J. Cell Sci., March 1, 2006; 119(Pt 5): 787 - 796.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y. Liu, Z.-X. Yao, and V. Papadopoulos
Cytochrome P450 17{alpha} Hydroxylase/17,20 Lyase (CYP17) Function in Cholesterol Biosynthesis: Identification of Squalene Monooxygenase (Epoxidase) Activity Associated with CYP17 in Leydig Cells
Mol. Endocrinol., July 1, 2005; 19(7): 1918 - 1931.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Jamin, J.-M. Neumann, M. A. Ostuni, T. K. N. Vu, Z.-X. Yao, S. Murail, J.-C. Robert, C. Giatzakis, V. Papadopoulos, and J.-J. Lacapere
Characterization of the Cholesterol Recognition Amino Acid Consensus Sequence of the Peripheral-Type Benzodiazepine Receptor
Mol. Endocrinol., March 1, 2005; 19(3): 588 - 594.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Hauet, Z.-X. Yao, H. S. Bose, C. T. Wall, Z. Han, W. Li, D. B. Hales, W. L. Miller, M. Culty, and V. Papadopoulos
Peripheral-Type Benzodiazepine Receptor-Mediated Action of Steroidogenic Acute Regulatory Protein on Cholesterol Entry into Leydig Cell Mitochondria
Mol. Endocrinol., February 1, 2005; 19(2): 540 - 554.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. NAVARRO, B. ANAND-APTE, and M.-O. PARAT
A role for caveolae in cell migration
FASEB J, December 1, 2004; 18(15): 1801 - 1811.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. A. Spencer, P. Wang, D. Li, J. S. Russel, D. H. Blank, J. Huuskonen, P. E. Fielding, and C. J. Fielding
Benzophenone-containing cholesterol surrogates: synthesis and biological evaluation
J. Lipid Res., August 1, 2004; 45(8): 1510 - 1518.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
P. Lindemann, A. Koch, B. Degenhardt, G. Hause, B. Grimm, and V. Papadopoulos
A Novel Arabidopsis thaliana Protein is a Functional Peripheral-Type Benzodiazepine Receptor
Plant Cell Physiol., June 15, 2004; 45(6): 723 - 733.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M.-K. Chen, K. Baidoo, T. Verina, and T. R. Guilarte
Peripheral benzodiazepine receptor imaging in CNS demyelination: functional implications of anatomical and cellular localization
Brain, June 1, 2004; 127(6): 1379 - 1392.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. A. Ostuni, K. Marazova, G. Peranzi, B. Vidic, V. Papadopoulos, R. Ducroc, and J.-J. Lacapere
Functional characterization and expression of PBR in rat gastric mucosa: stimulation of chloride secretion by PBR ligands
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G1069 - G1080.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Giatzakis and V. Papadopoulos
Differential Utilization of the Promoter of Peripheral-Type Benzodiazepine Receptor by Steroidogenic Versus Nonsteroidogenic Cell Lines and the Role of Sp1 and Sp3 in the Regulation of Basal Activity
Endocrinology, March 1, 2004; 145(3): 1113 - 1123.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
E. Bribes, D. Carriere, C. Goubet, S. Galiegue, P. Casellas, and J. Simony-Lafontaine
Immunohistochemical Assessment of the Peripheral Benzodiazepine Receptor in Human Tissues
J. Histochem. Cytochem., January 1, 2004; 52(1): 19 - 28.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Gazouli, Z. Han, and V. Papadopoulos
Identification of a Peptide Antagonist to the Peripheral-Type Benzodiazepine Receptor That Inhibits Hormone-Stimulated Leydig Cell Steroid Formation
J. Pharmacol. Exp. Ther., November 1, 2002; 303(2): 627 - 632.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. Culty, L. Luo, Z.-X. Yao, H. Chen, V. Papadopoulos, and B. R. Zirkin
Cholesterol Transport, Peripheral Benzodiazepine Receptor, and Steroidogenesis in Aging Leydig Cells
J Androl, May 1, 2002; 23(3): 439 - 447.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Li, B. Degenhardt, D. Tobin, Z.-x. Yao, K. Tasken, and V. Papadopoulos
Identification, Localization, and Function in Steroidogenesis of PAP7: A Peripheral-Type Benzodiazepine Receptor- and PKA (RI{alpha})-Associated Protein
Mol. Endocrinol., December 1, 2001; 15(12): 2211 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. M. Stocco
Tracking the Role of a StAR in the Sky of the New Millennium
Mol. Endocrinol., August 1, 2001; 15(8): 1245 - 1254.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Li, Z.-x. Yao, B. Degenhardt, G. Teper, and V. Papadopoulos
Cholesterol binding at the cholesterol recognition/ interaction amino acid consensus (CRAC) of the peripheral-type benzodiazepine receptor and inhibition of steroidogenesis by an HIV TAT-CRAC peptide
PNAS, January 23, 2001; (2001) 31461598.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
N. Boujrad, B. Vidic, M. Gazouli, M. Culty, and V. Papadopoulos
The Peroxisome Proliferator Perfluorodecanoic Acid Inhibits the Peripheral-Type Benzodiazepine Receptor (PBR) Expression and Hormone-Stimulated Mitochondrial Cholesterol Transport and Steroid Formation in Leydig Cells
Endocrinology, September 1, 2000; 141(9): 3137 - 3148.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Yeliseev and S. Kaplan
TspO of Rhodobacter sphaeroides. A STRUCTURAL AND FUNCTIONAL MODEL FOR THE MAMMALIAN PERIPHERAL BENZODIAZEPINE RECEPTOR
J. Biol. Chem., February 25, 2000; 275(8): 5657 - 5667.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. Gavish, I. Bachman, R. Shoukrun, Y. Katz, L. Veenman, G. Weisinger, and A. Weizman
Enigma of the Peripheral Benzodiazepine Receptor
Pharmacol. Rev., December 1, 1999; 51(4): 629 - 650.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Hardwick, D. Fertikh, M. Culty, H. Li, B. Vidic, and V. Papadopoulos
Peripheral-Type Benzodiazepine Receptor (PBR) in Human Breast Cancer: Correlation of Breast Cancer Cell Aggressive Phenotype with PBR Expression, Nuclear Localization, and PBR-mediated Cell Proliferation and Nuclear Transport of Cholesterol
Cancer Res., February 1, 1999; 59(4): 831 - 842.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Li, Z.-x. Yao, B. Degenhardt, G. Teper, and V. Papadopoulos
Cholesterol binding at the cholesterol recognition/ interaction amino acid consensus (CRAC) of the peripheral-type benzodiazepine receptor and inhibition of steroidogenesis by an HIV TAT-CRAC peptide
PNAS, January 30, 2001; 98(3): 1267 - 1272.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Papadopoulos, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Papadopoulos, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals