help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, M.
Right arrow Articles by McPhaul, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, M.
Right arrow Articles by McPhaul, M. J.
Endocrinology Vol. 139, No. 12 5082-5093
Copyright © 1998 by The Endocrine Society


ARTICLES

A Steroidogenic Factor-1-Binding Site and Cyclic Adenosine 3',5'-Monophosphate Response Element-Like Elements Are Required for the Activity of the Rat Aromatase Promoter in Rat Leydig Tumor Cell Lines1

Maureen Young2 and Michael J. McPhaul

Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas 75235-8857

Address all correspondence and requests for reprints to: Michael J. McPhaul, M.D., Department of Internal Medicine, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-8857.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although transcription initiation within CYP19 (cytochrome P450 aromatase) occurs immediately 5' to the initiator methionine (proximal promoter) in two rat Leydig tumor cell lines (R2C and H540) that express high aromatase activity and in rat ovary, the patterns of aromatase expression in the two cell types are distinctive. To define mechanisms controlling different patterns of expression of the rat aromatase proximal promoter, we performed transient transfection and gel mobility shift assays. Transfection experiments using different sized promoter fragments fused to a reporter gene were used to identify regions that are functionally important for transcriptional regulation in steroidogenic cell lines [R2C, H540, and Y1 (mouse adrenocortical cells that express low aromatase activity)]. These experiments indicate that the cAMP response element (CRE) at -231 and the steroidogenic factor-1 (SF1) motif are both required for expression of the reporter gene in each steroidogenic cell line and that the CRE at -169 is similarly required in R2C cells. Gel mobility shift assays confirm binding of nuclear proteins from the steroidogenic cell lines to the SF1 motif and to CRE (-231). Leydig tumor cells also contain nuclear proteins that bind to the CRE (-169), but nuclear extracts from R2C cells produce a uniquely shifted band compared with H540 cells. These results suggest that differences in proteins that bind to distinct elements within the rat aromatase promoter may be responsible for different patterns and levels of aromatase expression in these steroidogenic cell lines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE CONVERSION of androgens to estrogens is catalyzed by aromatase cytochrome P450 (P450arom, encoded by the CYP19 gene). The tissue-specific expression of the CYP19 gene determines whether a cell is capable of converting testosterone, androstenedione, and 16{alpha}- hydroxy-androstenedione to estradiol, estrone, and estriol, respectively. Aromatase is expressed in the gonadal and brain tissue(s) of all species studied to date (1, 2, 3, 4, 5, 6, 7, 8, 9). In some species, P450arom has also been detected in placenta, adipose, skin, adrenal, and some Leydig tumors (6, 10, 11, 12, 13, 14).

It appears that aromatase expression can be regulated in at least three different ways. At one extreme, recent evidence suggests the existence of discrete, independently regulated aromatase isoforms that are expressed in porcine ovary, placenta, and blastocyst (15, 16). In contrast, tissue-specific promoters regulate the expression of a single CYP19 gene in some species (e.g. humans, cows, pigs, horses, chickens, and rats) (15, 16, 17, 18, 19, 20, 21). Finally, the differential regulation of each promoter can result in varying levels of aromatase expression. For example, we have previously shown that transcription initiation of the aromatase gene in rat ovary and in two rat Leydig tumor cells (R2C and H540) occurs immediately 5' to the initiator methionine (proximal promoter, also called promoter II) (6, 22). Although the proximal promoter regulates aromatase expression in both rat ovary and rat Leydig tumor cells, this promoter is regulated differentially by treatment with forskolin, cAMP, or glucocorticoids in these cell types (1, 6, 22, 23, 24, 25, 26, 27, 28). In the studies described here, we have focused on this latter model: the regulation of a single aromatase gene by one of its promoters (the proximal promoter) in different cell types.

By sequence analysis, a steroidogenic factor-1 (SF1)-binding site (at -90 relative to the start of transcription) and two motifs similar to cAMP response elements (5'CRE at -335 and 3'CRE at -231) have been identified in the proximal promoter (24). SF1 (also named Ad4BP), an orphan member of the nuclear receptor family, was first identified as an important regulator of adrenal steroidogenic P450s and appears to be necessary, but not sufficient, for the expression of many steroidogenic P450s (29, 30, 31, 32). The two CRE-like sequences differ from the consensus CRE by nucleotide substitutions of the two central nucleotides. A third CRE-like sequence has recently been identified at -169 by functional analysis (24, 25, 26). The latter CRE-like sequence (which we have designated the XCRE) has an extra nucleotide inserted between the second and third nucleotides of the consensus motif. Each of these CRE-like sequences is a potential candidate in the regulation of CYP19 by forskolin or cAMP analogs (6, 22, 23, 24, 25, 26, 27, 28, 32).

To define the mechanisms controlling the different regulatory patterns of the rat aromatase proximal promoter, vectors containing different sized promoter fragments fused to the luciferase reporter gene were transfected into two rat Leydig tumor cell lines (R2C and H540, which express high levels of aromatase activity), a mouse adrenocortical cell line (Y1, which expresses low, but detectable, levels of aromatase activity), and a rat embryonic fibroblast cell line (Rat2, which has no detectable aromatase activity). The results of these functional studies have been correlated using gel mobility shift assays to identify the proteins binding to functionally important promoter sequences.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
The R2C, Y1, and Rat2 cell lines were obtained from the American Type Culture Collection (Manassas, VA). Y1 cells were also obtained from Dr. B. P. Shimmer (University of Toronto, Toronto, Canada). The R2C and Y1 cell lines were cultured in Ham’s F-12 medium [ICN Pharmaceuticals, Inc. (Costa Mesa, CA) and Mediatech (Herndon, VA)] containing 15% horse serum (Sigma Chemical Co., Inc., St. Louis, MO), 2.5% FCS [Sigma Chemical Co. and PAA Laboratories, Inc. (Newport Beach, CA)], and 1 mg/ml penicillin-streptomycin (Life Technologies, Grand Island, NY). The Rat2 cell line was cultured in DMEM (Life Technologies) containing 10% FCS and 1 mg/ml penicillin-streptomycin.

The H540 cell line was obtained from Dr. J. I. Mason (University Department of Clinical Biochemistry, Royal Infirmary of Edinburgh NHS Trust, Edinburgh EH3 9YW, Scotland, UK) and was cultured in 50:50 Ham’s F-12-MEM (Mediatech) containing 5% FBS, 1 mg/ml penicillin-streptomycin, and 1% anti-PPLO (Life Technologies).

Aromatase assay
Aromatase activity was measured by the tritiated water release assay using 0.6–0.8 mM [1ß-3H]testosterone (New England Nuclear Research Products, Boston, MA) (7, 33, 34). The protein content was measured by the method of Lowry et al. (35).

Transfection assay
Promoter fragments were generated by the PCR and subcloned into the pGL2-Basic vector (Promega Corp., Madison, WI). The promoter fragment was also sequenced by the dideoxynucleotide sequencing method (36) to ensure that no unintended mutations were introduced into the PCR product during amplification. Lipofectamine (Life Technologies; R2C, H540, Y1: 10 µl/3.5-cm2 dish; Rat2: 5 µl/3.5-cm2 dish) was used as directed by the manufacturer to cotransfect cells with the pGL2-promoter constructs (1.5 µg/dish) and the cytomegalovirus (CMV)-lacZ plasmids (1 µg/dish). Luciferase activity was measured after 3 days of expression. ß-Galactosidase activity and protein content (Bio-Rad Laboratories, Inc., Hercules, CA; Bradford method) were also determined for each sample. The luciferase data were corrected for transfection efficiency with ß-galactosidase activity. The corrected promoter activity was then depicted relative to the most active promoter construct (-688; Figs. 2Go and 3Go). Samples were analyzed in triplicate.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Transcriptional activity of a series of 5'-deleted promoter fragments. A, A schematic diagram of the region of genomic DNA containing the proximal promoter of the rat aromatase gene is shown at the top. The arrow indicates the site of transcription initiation (+1). The open box represents the 5'-untranslated region of the aromatase messenger RNA transcript, and the shaded box represents the first coding exon. This promoter contains a TATA box (-40; long vertical line) and a CAAT box (-62; short vertical line). Three putative CRE motifs (5'CRE at -335; 3'CRE at -231; XCRE at -169) are indicated as filled circles. An SF1-binding site motif (SF1 at -90) is indicated as a filled rectangle. All of the promoter constructs used in this study contain the same 3'-boundary (+94). The 5'-boundaries of the promoter fragments varied from -85 to -1037. The coordinates of the promoter fragments are indicated. Each of the fragments was subcloned into the pGL2 vector. B, The relative transcriptional activities of a series of 5'-deletions in the rat aromatase promoter (A), as assayed in the pGL2-luciferase reporter plasmid, are shown. The y-axis represents the percentage of transcriptional activity (luciferase light units corrected for transfection efficiency estimated from the levels of measured ß-galactosidase activity) compared with the -688 fragment (included in every experiment). The -688 fragment consistently had the highest activity in the steroidogenic cell lines, and the range of corrected values obtained in our experiments is shown next to the legend. The x-axis has been drawn so that the longest promoter fragment is on the left, and the shortest fragment is on the right. The promoter diagram at the bottom of this figure has been drawn to show which motifs are contained in each fragment. These results are the averages of three to seven independent experiments. In each experiment, the activities of the transfected plasmids were assayed in triplicate transfections.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional activity of mutated aromatase promoter fragments. A, A schematic diagram of the region of genomic DNA containing the proximal promoter of the rat aromatase gene is shown at the top. Each of the promoter fragments has the same 5'- and 3'-ends (-688 to +94). Six base pairs of the XCRE, 3'CRE, 5'CRE, or SF1 motif have been replaced with a SalI restriction site and designated mX, m3, m5, and mSF1, respectively. Some promoter fusions containing two mutations were also constructed (m5 m3, m5 mSF1, and m3 mSF1). Each fragment was subcloned into the pGL2 vector. B, The relative activity of the -688 promoter fragment compared with those of seven mutant fragments of the same size (see A) is shown. The y-axis represents the percentage of transcriptional activity (luciferase activity corrected by ß-galactosidase activity), using the -688 fragment as 100%. The -688 fragment consistently had the highest activity in the steroidogenic cell lines, and the range of corrected values obtained in our experiments is shown next to the legend. The x-axis is labeled with the names of the promoter fragments being studied. These results represent the averages of five to eight independent experiments. Each promoter fusion included in an individual experiment was assayed in triplicate.

 
Gel mobility shift assay
Nuclear extracts were prepared from R2C, H54O, Y1, and Rat2 cells as previously described (37, 38). In later experiments, all fractions obtained during the extraction process were saved and analyzed. All extracts were prepared in the presence of 0.5 mM phenylmethylsulfonylfluoride; the Y1 extracts used in Figs. 4Go and 5Go also included 1 mM leupeptin. The pET-{Delta}-CRE-binding protein (CREB) plasmid (39), obtained from Dr. C. R. Mendelson (University of Texas Southwestern Medical Center, Dallas, TX) was transcribed and translated using the T7 polymerase in the rabbit reticulocyte lysate system as directed by the manufacturer (Promega Corp.). Ten microliters of the reaction were used in mobility shift assays. When the in vitro transcribed and translated {Delta}CREB protein product was labeled with 35S and separated on a 9% SDS-polyacrylamide gel, one major protein of the expected size (46 kDa) was detected (data not shown).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Gel mobility shift assay using the SF1 motif as probe. A, A gel mobility shift assay using the SF1 motif as probe is shown. Lane 15 contained probe alone, and lane 14 contained probe incubated with anti-Ad4BP antibodies ({alpha}-Ad4BP). The source of the nuclear extract tested in each lane is labeled at the top of the autoradiogram. The results of incubating nuclear extracts with probe are shown in lanes 2, 6, and 10. In some reactions, a 10- or 100-fold molar excess of unlabeled probe (SF1: lanes 3 and 4, 7 and 8, and 11 and 12) or a 250-fold molar excess of unlabeled oligonucleotides containing a mutated SF1 motif (MUT: lanes 5, 9, and 13) was added as competitor. In lane 14, {alpha}-Ad4BP was incubated with Y1 nuclear extracts before the addition of probe. B, A gel mobility shift assay using the SF1 motif as probe is shown. Lane 16 contained probe alone, lane 17 contained probe incubated with anti-Ad4BP antibodies ({alpha}-Ad4BP), and lane 18 contained probe incubated with antiandrogen receptor antibodies ({alpha}-AR). The source of the nuclear extract tested in each lane is indicated at the top of the autoradiogram. The results of incubating nuclear extracts with probe are shown in lanes 19 and 22. In lanes 20 and 23, {alpha}-Ad4BP was incubated with nuclear extracts before the addition of probe. In lanes 21 and 24, {alpha}-AR was incubated with nuclear extracts before the addition of probe.

 


View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. Gel mobility shift assay using the 3'CRE motif as probe. A, A gel mobility shift assay using the 3'CRE motif as probe (3'CRE-s, 24-mer) is shown. The reaction containing probe alone (data not shown) only contains a single band representing unbound probe. The source of the nuclear extract tested in each lane is indicated at the top of the autoradiogram. The results of incubating nuclear extracts with probe are shown in lanes 1, 8, and 15. In lanes 2 and 3, 9 and 10, and 16 and 17, a 50- or 100-fold molar excess of unlabeled probe was added as competitor. A 100-fold molar excess of mut1, mut2, mut3, or mut4 was included as competitor in lanes 4–7, 11–14, and 18–21. The sequences of the mutants are shown in Materials and Methods and B. Briefly, in mut1, the first six nucleotides of the 3'CRE motif have been replaced. Mut2 contains mutations in the first and last nucleotides of the 3'CRE motif, which have been shown to be important for CREB binding. Mut3 and mut4 contain mutations in the three nucleotides flanking the 3'CRE motif. B, The sequence of the probe and mutant competitor oligonucleotides used in A are listed. The CRE-like region is underlined, and the nucleotide substitutions are in lowercase letters. C, A gel mobility shift assay using a 3'CRE motif as probe (3'CRE-l, a 54-mer) is shown. Only the results of experiments using R2C nuclear extracts are shown, although the data obtained with extracts from the H540 cell line were essentially the same. Lane 1 contained probe alone, and lane 2 contained probe incubated with {alpha}-CREB. The result of incubating nuclear extracts with probe is shown in lane 4. In lane 3, {alpha}-CREB was incubated with nuclear extracts before the addition of probe. In other samples, excess unlabeled probe (lanes 5 and 6), unlabeled SSCRE (lanes 7 and 8), or unlabeled Sp1 motif (lane 9) was added as competitor.

 
Gel mobility shift assays were performed essentially as previously described (37, 38) with 5 µg poly(dI-dC)-poly(dI-dC) (Pharmacia Biotech, Piscataway, NJ) as nonspecific competitor and 10 µg nuclear extract. The 3'CRE motif, the somatostatin CRE motif, and the SF1 motif were generated by PCR and either subcloned into Bluescript (Stratagene, La Jolla, CA) or subcloned with the TA Cloning Kit (Invitrogen, Carlsbad, CA). The rest of the probes were generated by annealing single stranded oligonucleotides. A list of the DNA sequences used in mobility shift assays follows (the nucleotide motifs of interest are underlined; mutations are shown as lower case letters): SF1, CAGGACCTGAGTCTCCCAAGGTCATCCTTGTTTTGACTTGTA; 20SF1, TCTCCCAAGGTCATCCTTGT; mutSF1, TCTCCCAAtaTCATCCTTGT; 3'CRE-l, CTCAGCAAATGCTGCTGATGAAATCACATGGAGATTG-TTCCTCT; 3'CRE-s, GCTGCTGATGAAATCACATGGAGA (The Midland Certified Reagent Co., Midland, TX); mut1, GCTGCTGAgtcgacCACATGGAGA; mut2, GCTGCTGAaGAAATCtCATGGAGA (BioSynthesis, Lewisville, TX); mut3, GCTGCaatTGAAATCACATGGAGA (BioSynthesis); mut4, GCTGCTGATGAAATCAtggGGAGA (BioSynthesis); XCRE, TGAGTATGCACGTCACTCTAC (The Midland Certified Reagent Co.); mutXCRE, ATTGAGTATGCgtcgacCTCTACC; 5'CRE, TAGGGGATGAACTCAGGTTACT (The Midland Certified Reagent Co.); somatostatin CRE (SSCRE), GGATCTGGGGGCTCCTCCTGGCTGACGTCAGAGAGAGAGTTT; activating protein-1, CTAGTGATGAGTCAGCCGGATC (Stratagene, La Jolla, CA); and Sp1, GATCGATCGGGGCGGGGCGATC (Stratagene).

Unless specified, oligonucleotides were synthesized by a PE Applied Biosystems (Foster City, CA) 381A DNA synthesizer. The anti-CREB monoclonal antibody ({alpha}-CREB) was obtained from Dr. J. P. Hoeffler (University of Colorado Health Science Center, Denver, CO). The anti-SF1 antibody ({alpha}-SF1) was obtained from Dr. K. L. Parker (Duke University Medical Center, Durham, NC). The anti-Ad4BP (Ad4BP is the bovine homolog of SF1) antibody ({alpha}-Ad4BP) was obtained from Dr. K.-I. Morohashi (Kyushu University, Fukuoka, Japan).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Functional activity of the proximal promoter of the rat aromatase gene
Transient transfection experiments using vectors containing different sized aromatase promoter fragments fused to the luciferase reporter gene have been used to characterize regions that are functionally important for transcriptional regulation. Table 1Go contains a list of the cell lines used in functional studies. These cell lines have been chosen to compare the relative activities of the promoter fusions in cells with different levels of aromatase activity. The R2C and H540 cell lines are two independently derived Leydig tumor lines that arose in different strains of rats (40, 41).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of the cell lines studied

 
The nucleotide sequence of the longest promoter fragment is shown in Fig. 1Go. This fragment was subcloned from a 1.5-kb PstI fragment isolated from a rat genomic Charon library (19). The promoter fragments, shown schematically in Fig. 2AGo, were assayed by transient transfection in each of the cell lines. The relative transcriptional activity of this series of 5'-deletions in the rat aromatase promoter in transient transfection assays is shown in Fig. 2BGo. When assayed in the R2C cell line, an increase in transcriptional activity was seen as the regions containing the 3'CRE and 5'CRE sequences were included in the promoter fragments (-183 compared with -242 and -339). Inclusion of the GT-rich sequences (located between nucleotides -339 to -475) did not increase promoter activity. An additional increase was seen as the promoter region from -475 to -538 was included. Addition of sequences 5' to the -688 boundary resulted in an apparent decrease in promoter activity.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide sequence of the rat aromatase promoter. The nucleotide sequence of the longest promoter fragment used in our experiments is listed above. The TATAA and CAAT boxes are shown in bold letters. The start of transcription is marked by an asterisk. The SF1-binding motif is double underlined, and the CRE-like sequences are single underlined. (The initiating methionine lies outside the region of the aromatase gene under study; its codon begins at +97.) This fragment was subcloned from a 1.5-kb genomic clone that was isolated from a rat genomic Charon library (19 ).

 
The activities of these promoter fusions assayed in the H540 Leydig tumor cells closely resembled those measured in the R2C Leydig tumor cells. Major increases in promoter activity were observed as the regions from -183 to -339 and from -475 to -538 were included.

As noted in Table 1Go, the Y1 cells express much lower aromatase activity than either of the Leydig tumor lines. Despite this, the data obtained from assays of the promoter fusions were very similar to the results of assays performed in both the R2C and H540 cell lines.

The transfection experiments performed with the nonsteroidogenic Rat2 cell line (embryonic fibroblasts) yielded markedly different results. Although constitutively active plasmids (pCMV-lacZ, which was used to monitor transfection efficiency among the different aromatase promoter plasmids, and pRSV-luciferase) were transcriptionally active in the Rat2 cell line at levels similar to those observed for the other cell lines, none of the aromatase promoter fragment constructs had significant activity above that seen with the pGL2 parent reporter vector (data not shown).

Transcriptional activity of mutated aromatase promoter fragments
The above results suggested that the segments containing the 5'CRE, 3'CRE, XCRE, and/or SF1 motif were functionally important. To test the significance of these motifs more directly, 6 bp of the 5'CRE, 3'CRE, XCRE, and/or the SF1 motifs were replaced with a SalI restriction endonuclease cleavage site (GTCGAC). A schematic diagram of the single and double mutant promoter fragments that were generated and assayed is shown in Fig. 3AGo. The relative activities of these seven mutant fragments compared with that of the wild-type promoter fragment (-688/+94) are shown in Fig. 3BGo. In the R2C Leydig tumor cells, single mutations of the SF1 motif (mSF1), the XCRE (mX), or the 3'CRE (m3) reduced promoter activity by 60–90% of wild-type activity. In contrast, mutation of the 5'CRE (m5) consistently resulted in a slight increase in promoter activity. The combination of m5 with either mSF1 or m3 slightly increased the activity of the promoter fragments compared with that of the single mSF1 and m3 mutants. The m3 mSF1 double mutant showed a dramatic decrease (~95%) in activity compared with the wild-type promoter fragment (Fig. 3BGo).

The promoter activities measured in the H540 Leydig tumor cells and the Y1 adrenocortical cells were very similar to the results seen in R2C Leydig tumor cells, except for the mX mutant promoter fusion. The mSF1, m3, m5 mSF1, and m5 m3 promoter fusions exhibited activities decreased by 45–70% compared with that of the wild-type fragment. The m5 mutant showed an increase in promoter activity, whereas the m3 mSF1 mutant only had 10–15% of the activity of the wild-type promoter. As noted above, the only major difference in the behavior of the promoter fusions assayed in H540 and Y1 cells compared with R2C cells was the activity of the promoter fusion carrying the mutagenized XCRE (mX). In the H540 cells, the mX construct had elevated levels of activity compared with the wild-type fragment, and in the Y1 cells, the mX construct had 80% the activity of the wild-type construct, suggesting that this region is less important in the H540 and Y1 cell lines than this region is in the R2C cell line.

As described earlier, although constitutively active pRSV-luciferase and pCMV-lacZ plasmids were transcriptionally active in the nonsteroidogenic cell line Rat2, none of the promoter fragment constructs had significant activity above that seen with the pGL2 parent reporter vector (data not shown).

Nuclear proteins from Leydig tumor cells bind to the SF1-binding site
As the SF1-binding site is functionally important in transfection experiments, gel mobility shift assays were performed to further characterize the nuclear proteins (putative transcription factors) that can bind to the aromatase SF1 binding motif. Gel mobility shift assays using the SF1 motif as probe (SF1: see Materials and Methods) are shown in Fig. 4Go. The same results were obtained using a 20-mer oligonucleotide as probe (20SF1; data not shown).

Although the relative intensities of the shifted bands varied, similar patterns could be demonstrated using nuclear extracts prepared from each of the steroidogenic cell lines (Fig. 4Go, R2C, H540, and Y1; lanes 2, 6, and 10 in A). Three complexes (arrows) could be specifically competed by excess unlabeled probe (lanes 3–4, 7–8, and 11–12). A 50- to 250-fold molar excess of oligomers containing a mutated SF1 motif (mutSF1) does not compete with any of the specific band shifts in most experiments, although a 250-fold molar excess of mutSF1 appears to slightly compete with specific bands in Fig. 4Go (data not shown and lanes 5, 9, and 13).

The inclusion of an anti-Ad4BP antibody in the reactions eliminated the specific band shifts of the two slower migrating bands and formed a supershifted complex (Fig. 4Go, arrowhead; compare lanes 10 and 14 in A; compare lanes 19–20 and 22–23 in B), whereas incubation with an unrelated antibody against member of the steroid hormone receptor superfamily ({alpha}-AR, which is specific for the androgen receptor) did not alter the mobility of the specific bands visualized (lanes 21 and 24 in B). Lanes 15, 17, and 18 are control reactions that show that the antibody preparations do not have an intrinsic ability to bind to the DNA probe. In data not shown, a second antibody ({alpha}-SF1) slightly retarded the mobility of the two slower migrating bands without completely eliminating the original band containing SF1-bound oligonucleotide.

As might be expected on the basis of cell lineage, nuclear proteins that bind the SF1 motif from the aromatase gene were not detected in nuclear extracts prepared from the nonsteroidogenic cell line, Rat2 (data not shown).

Nuclear proteins from steroidogenic cells bind specifically to the 3'CRE and the XCRE, but not the 5'CRE
The transfection data shown in Fig. 2Go (promoter fragments -183, -242, and -339) and Fig. 3Go (m3 single and double mutants and mX) demonstrate that the CRE-like motifs play an important role in regulating the expression of the aromatase gene in steroidogenic cell lines. Mobility shift assays using fragments containing these motifs were performed using extracts from the different cell lines.

A gel mobility shift assay using the 3'CRE motif as probe is shown in Fig. 5Go. In functional assays, this motif was found to be important for promoter activity in all of the steroidogenic cell lines that we tested (Fig. 3Go). Nuclear extracts from each of these cell lines (R2C, H540, and Y1) contained proteins that could bind to the 3'CRE motif (Fig. 5AGo, lanes 1, 8, and 15, respectively). Three bands were visualized in mobility shift assays of the 3'CRE probe using the nuclear extracts from steroidogenic cell lines (complexes I–III). Complex II was the major protein-DNA interaction detected, whereas the levels of complexes I and III varied among the cell lines. No significant protein-DNA interactions were detected in Rat2 nuclear extracts that bound to the labeled 3'CRE oligonucleotides (data not shown).

To determine the specificity of the protein-DNA interactions and to characterize the DNA-binding site more precisely, competition experiments were then performed. In experiments using Leydig cell tumor nuclear extracts, complex II could be completely competed by excess unlabeled probe (Fig. 5AGo, lanes 2 and 3 and lanes 9 and 10). Complex I was not affected by the same concentrations of unlabeled probe, suggesting that the mobility-shifted probe is interacting with a nonspecific DNA-binding protein (Fig. 5AGo, lanes 2 and 3 and lanes 9 and 10). A 100-fold molar excess of mut1 oligonucleotide, a 24-mer in which the 3'CRE motif has been replaced by a SalI endonuclease restriction site (Fig. 5BGo), slightly competed with all of the shifted bands (Fig. 5AGo, lanes 4 and 11). Three additional mutant oligonucleotides also could not eliminate protein-DNA probe interactions. These mutants include the following: 1) mut2, in which the first and the last nucleotide in the 3'CRE motif was altered (Fig. 5Go, B and A, lanes 5 and 12); 2) mut3, in which three nucleotides preceding the 3'CRE motif were altered (Fig. 5Go, B and A, lanes 6 and 13); and 3) mut4, in which three nucleotides following the 3'CRE motif were altered (Fig. 5Go, B and A, lanes 7 and 14). The SSCRE was not as efficient a competitor as the unlabeled probe for the proteins that specifically bind to the 3'CRE probe (Fig. 5CGo, compare lanes 5 and 6 to lanes 7 and 8) and excess Sp1 does not compete with the labeled probe for protein binding (Fig. 5CGo, compare lanes 4 and 9). Finally, an excess of oligonucleotides containing the 5'CRE and XCRE sequences cannot compete with the 3'CRE probe for protein binding (data not shown).

Similar to the results using R2C and H540 nuclear extracts, complex II could be fully competed by excess unlabeled probe in experiments using Y1 nuclear extracts, and complex I was not affected by excess unlabeled probe (Fig. 5AGo, lanes 16 and 17). In addition, complex III, which was detected in the Leydig cell tumor extracts at lower levels, was only slightly competed by excess unlabeled probe (lanes 16 and 17). The mutant oligonucleotides (mut1-mut4) could not completely disrupt any of the shifted bands (lanes 18–21). Again, the SSCRE was not as efficient a competitor as the unlabeled probe for the proteins that specifically bind to the 3'CRE probe and excess Sp1 did not compete with the labeled probe for protein binding (data not shown).

The anti-CREB antibody ({alpha}-CREB), which recognizes CREB 341, CREM{alpha}, and ATF-1, seemed to affect the binding of proteins in complex II from the Leydig tumor cells (R2C and H540) by slightly increasing the mobility of complex II. In contrast, {alpha}-CREB did not affect the binding of proteins detected as complex I or III in any of the cell lines (Fig. 5CGo, compare lanes 3 and 4). As shown in lane 2 (Fig. 5CGo), {alpha}-CREB did not interact with the 3'CRE probe. Anti-ATF2 ({alpha}-ATF2) and anti-ATF3 ({alpha}-ATF3) antibodies had no effect of the mobility of any shifted band (data not shown).

Gel mobility shift assays were also performed using oligonucleotides containing the XCRE motif (Fig. 6AGo). In functional assays this motif was required for promoter activity only in the R2C cell line. Specific nuclear protein binding was detected in the Leydig tumor cells (R2C and H540; lanes 2 and 9), but not in Y1 or Rat2 cells (lanes 16–23). The mobility-shifted bands detected with Y1 and Rat2 nuclear extracts increased as the amount of nonspecific DNA competitor, poly(dI-dC) decreased, and these bands could not be competed by an excess of unlabeled probe. Three complexes were detected when using nuclear extracts from R2C cells, but only the two slower migrating bands were formed with H540 extracts. In the Leydig cell experiments, the band shifts could be competed by excess unlabeled probe (lanes 3, 4, and 10), but not by excess, unlabeled oligonucleotides containing the rat aromatase 3'CRE or 5'CRE (lanes 5, 6, 11, and 12) or by excess unlabeled Sp1 oligonucleotide (lanes 7 and 13). The inclusion of the anti-CREB antibody altered the pattern of band shifts, suggesting that CREB, CREM, and/or ATF-1 are involved in the formation of the complexes visualized (lanes 8 and 14). As shown in Fig. 6BGo, in vitro transcribed and translated {Delta}CREB protein was able to form complexes with our XCRE probe in mobility shift assays.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 6. Gel mobility shift assay using XCRE as probe. A, A gel mobility shift assay using the XCRE motif as probe is shown. Lane 1 contained probe alone, and lane 15 contained probe incubated with {alpha}-CREB. The source of the nuclear extract tested in each lane is indicated at the top of the autoradiogram. The results of incubating R2C and H540 nuclear extracts with probe are shown in lanes 2 and 9, respectively. In some R2C and H540 experiments, {alpha}-CREB was incubated with nuclear extracts before the addition of probe (lanes 8 and 14). In other R2C and H540 experiments, excess unlabeled XCRE (lanes 3, 4, and 10), 3'CRE (lanes 5 and 11), 5'CRE (lanes 6 and 12), or Sp1 (lanes 7 and 13) oligonucleotides were added as competitors. In the tests of the Y1 (lanes 16–19) and Rat2 (lanes 20–23) nuclear extracts, varying amounts of poly(dI-dC)-poly(dI-dC) were incubated with the probe and nuclear extract. B, A gel mobility shift assay using the XCRE motif as probe and in vitro synthesized {Delta}CREB is shown. Lane 1 contained probe alone. Lanes 24 and 25 contained 10 µl {Delta}CREB, the XCRE probe, and varying amounts of poly(dI-dC)-poly(dI-dC).

 
When mobility shift assays were performed with an oligonucleotide containing the rat aromatase 5'CRE motif, no specific protein binding was detected in nuclear extracts from R2C, H540, Y1, or Rat2 cells. Excess unlabeled probe was unable to compete with the labeled probe for protein binding. Excess unlabeled DNA containing either the 3'CRE or an SP1 motif was also unable to compete with labeled probe for protein binding, and the anti-CREB antibody did not affect the mobility of any of the shifted bands (data not shown).

Additional mobility shift experiments were performed to examine the interaction of nuclear extracts from R2C cells with an oligonucleotide probe containing a consensus CRE from the somatostatin promoter (SSCRE; Fig. 7Go). As shown in lane 3, multiple protein binding could be detected. An excess of unlabeled probe was able to compete with visualized bands (compare lanes 3 and 5). It is also of interest that the XCRE motif from the aromatase promoter was able to completely compete with the probe, whereas the 5'CRE and 3'CRE motifs were not efficient competitors (lanes 6–8). In supershift experiments, {alpha}-CREB clearly decreased the mobility of some of the shifted bands (lane 4). The results of experiments using nuclear extracts from H540 cells and the SSCRE were essentially the same as the results shown in Fig. 7.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 7. Gel mobility shift assay using SSCRE as probe. A gel mobility shift assay using the consensus CRE from the somatostatin promoter (SSCRE) as probe is shown. Only the results of experiments using R2C nuclear extracts are shown. Lane 1 contained probe alone, and lane 2 contained probe incubated with {alpha}-CREB. The results of incubating nuclear extracts with probe are shown in lane 3. In lane 4, {alpha}-CREB was incubated with nuclear extracts before the addition of probe. In other samples, excess unlabeled probe (lane 5), unlabeled CRE-like motifs from the aromatase promoter (lanes 6–8), or unlabeled fragment containing a nuclear factor-1/CCAAT transcription factor element were added as competitor.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Functional studies of 5'-deletions of the rat aromatase promoter indicate that the regions between -183 to -339 and -475 to -538 contain positive regulatory elements, whereas the region between -688 to -786 appears to contain a negative regulatory element(s). These regions are important for aromatase expression in all of the steroidogenic cell lines examined (R2C, H540, and Y1) regardless of the levels of endogenous aromatase activity, as the relative functional activity of the series of 5'-promoter deletions is similar in all three cell types. In this paper we have examined the roles that three CRE-like motifs within the first region (-183 to -339) and the SF1 motif at -90 play in the control of aromatase gene expression in the R2C, H540, and Y1 cell lines.

The orphan nuclear receptor, SF1, has been shown to be an important regulator of steroidogenic P450s (29, 30, 31, 32, 42). The bovine homolog has been named Ad4BP (30, 32). Our work builds on the data supporting the paradigm that the SF1-binding site plays a crucial role in controlling transcription of cytochrome P450 genes in cell lines of both gonadal and adrenal origins. Mutagenesis of the SF1 binding site (Fig. 3Go) and the results of our deletion analysis (Fig. 2Go, promoter fragments -85 and -183) indicate that the SF1-binding site is necessary, but not sufficient, for regulating the aromatase gene in the R2C cell line [in agreement with the studies of Lynch et al. (31) and Carlone and Richards (26)] and in two additional steroidogenic cell lines (H540 and Y1). These results are paralleled by the results of mobility shift assays, which indicate that nuclear extracts from these three cell lines contain factors that bind to radiolabeled DNA fragments containing the SF1 motif. Competition experiments indicate that the protein binding is specific for the SF1 motif.

Similar to our results, a complex pattern of mobility shifts was also detected in experiments using probes containing the SF1 motifs from the side-chain cleavage cytochrome P450, steroid 21-hydroxylase, and aldosterone synthase promoters and nuclear extracts from rat granulosa cells at various stages of follicular development, Y1 cells, and bovine adrenal cortex (29, 43). Under the conditions of our antibody supershift experiments, we consistently observed a slight supershifting of the proteins bound to the SF1 motif with {alpha}-SF1. In contrast, the {alpha}-SF1, which recognizes the DNA-binding domain of the SF1 protein, interferes with protein-DNA interactions in experiments performed in other laboratories (42, 44). The supershifts we detected with {alpha}-Ad4BP, which was raised against the full-length protein, is similar to other reports using the same antibody (45). Taken together, the oligonucleotide competition experiments and the two antibody studies support our conclusion that the SF1 protein is involved in forming at least the two slower migrating complexes. Further experiments analyzing the complex mobility shift pattern of SF1 will be described elsewhere.

Our inability to detect SF1 by mobility shift assays in the Rat2 cell line is consistent with the derivation of these cells from a nonsteroidogenic cell lineage. The absence of a transcription factor that can bind to the SF1 motif is in keeping with the lack of detectable steroidogenic P450 expression in this cell line.

FSH can regulate aromatase expression in ovarian granulosa cells and in testicular Sertoli cells (3, 23), and LH can regulate aromatase expression in Leydig cells (1, 27). All of these effects are believed to be modulated at least in part via alterations in the intracellular concentrations of cAMP. In contrast, aromatase activity in the R2C and H540 Leydig tumor cells is not responsive to cAMP, but instead, aromatase activity decreases in R2C cells and appears to be constitutively active in H540 cells (6, 22, 24, 29). These differences suggest the possibility that transcription factors expressed in the Leydig tumor cells can bind to these CRE-like motifs in the aromatase promoter and constitutively activate transcription.

Inspection of the nucleotide sequence surrounding the site of transcription initiation of aromatase messenger RNA identified three potential CRE-like elements. One cis element that was found to regulate aromatase expression was the CRE-like sequence at -231 (3'CRE: TGAAATCA), which bears substantial similarity to the consensus CRE (TGACGTCA) (46, 47, 48). The functional importance of the 3'CRE and the proteins that bind to this regulatory element has not been previously characterized. Deletion analysis and mutagenesis of promoter fragments in transient transfection assays show that the 3'CRE contributes to the activity of the aromatase promoter in each of the steroidogenic cell lines examined in this paper. Using mobility shift assays, we demonstrate that nuclear extracts from steroidogenic cell lines contain factors that bind to the radiolabeled 3'CRE probes, whereas Rat2 nuclear proteins do not interact with this motif. The pattern of band shifts detected in nuclear extracts prepared from R2C, H540, and Y1 cells were similar, but the ratios of the three complexes visualized (I, II, and III) in each cell line differed. Competition experiments suggest that complexes I and III resulted from nonspecific protein binding, because these bands were not competed by an excess of unlabeled probe. These observations suggest that the proteins contained in complexes I and III are not functionally important.

Additional competition experiments were performed for the following reasons: 1) nuclear proteins from the steroidogenic cell lines could also bind to an oligonucleotide containing the consensus CRE from the somatostatin promoter; 2) some of these mobility-shifted bands could clearly be supershifted by {alpha}-CREB; 3) in mobility shift assays, an excess of unlabeled SSCRE was not an efficient competitor for the proteins bound to the aromatase 3'CRE; and 4) the {alpha}-CREB supershift assays were not conclusive for CREB binding to the 3'CRE (the mobility of complex II slightly increased, instead of decreased).

By mutagenesis and comparisons of natural variants of the consensus CRE, Deutsch et al. (47) showed that nucleotides at positions 1 and 4, and to a lesser extent 8 (TGACGTCA; indicated residues underlined), are required for transcriptional activity of a CRE. In the aromatase 3'CRE, nucleotide 4 is already different from the consensus motif (TGAAATCA), which begins to suggest that CREB or CREB family members are not involved in binding to this regulatory element. In mobility shift assays, competitor oligonucleotides containing substitutions of the first six nucleotides (mut1) slightly affected nuclear protein interactions with the 3'CRE, which suggests that these nucleotides may participate in protein binding or stabilizing protein binding. A longer promoter fragment that contains the same mutation as mut1 had low functional activity in transfection assays (Fig. 3Go). Mut2, containing substitutions of bases 1 and 8 of the CRE-like motif, was designed to decrease binding of CREB family members, but in competition experiments, mut2 still slightly affected nuclear protein interactions with a 3'CRE probe. Deutsch et al. (47) also found that flanking sequences can affect both transcriptional activity of a consensus CRE and protein binding to a consensus CRE. In mut3 and mut4, three nucleotides flanking the aromatase 3'CRE were changed to the flanking sequences of {alpha}-CG CRE, which is very responsive to cAMP. Mut3 and mut4 were designed to have a stronger affinity for CREB family members, but when mut3 and mut4 were used in mobility shift competition assays, we found that these mutant competitors only partially eliminated protein-DNA interactions, suggesting that mut3 and mut4 retained low levels of protein binding. Comparison of the elimination of complex II by an excess of unlabeled probe to the remaining protein binding after competition with an excess of mutated oligonucleotides suggests that the nucleotides in the wild-type 3'CRE sequence (TGATGAAATCACAT; indicated residues underlined) contribute to protein binding. Collectively, our data also suggest that the protein that binds to the functionally important 3'CRE is not a member of the CREB family of transcription factors.

The CRE-like sequence at -169 (XCRE: TGCACGTCA) appears to be important for the expression of aromatase only in R2C Leydig tumor cells, but not in H540 Leydig tumor cells, Y1 adrenocortical cells, or Rat2 embryonic fibroblastic cells. Previous work by Fitzpatrick and Richards (24, 25) and Carlone and Richards (26) demonstrated that this motif was required for aromatase promoter activity in R2C cells and in forskolin-stimulated primary rat granulosa cells. As shown in Fig. 2Go, a promoter fragment containing the XCRE and the SF1 motifs (fragment -183) is inactive when assayed in all of the steroidogenic cells studied here. Although Carlone and Richards (26) reported that a similarly sized promoter fragment had transcriptional activity in R2C cells and in forskolin-treated primary granulosa cells, our results suggests that the XCRE and SF1 motifs together are not sufficient for promoter activity. This discrepancy might be explained by the way the data from the respective laboratories are presented. Carlone and Richards expressed promoter activity as the percent conversion of substrate to acetylated substrate (chloramphenicol acetyltransferase activity), whereas our data are expressed as luciferase activity of the -183 fragment relative to the activity of a longer more active promoter fragment (-688). The results of our analysis of the 5'-deletions showed concordant behavior in all of the steroidogenic cell lines. Surprisingly, however, mutagenesis of the XCRE motif only had a marked effect on promoter activity in the R2C cell line (Fig. 3Go), indicating that the XCRE is much less important for aromatase expression in the H540 and Y1 cell lines. Examination by mobility shift assays demonstrates that although R2C and H540 nuclear extracts contain proteins that can bind to the XCRE motif in mobility shift assays, no protein-DNA interactions were detected with Y1 and Rat2 nuclear extracts. In the {alpha}-CREB supershift experiments, the appearance of faster migrating bands, with mobilities similar to those of the nonspecific bands seen with the Y1 and Rat2 nuclear extracts, suggests that the antibody interferes with specific protein binding and allows nonspecific protein binding to occur. This interpretation of the mobility shift assay in which the {alpha}-CREB antibody was included suggests that CREB341, CREM{alpha}, and/or ATF1 is a component of the shifted bands visualized. In support of this, in vitro {Delta}CREB is able to form complexes with DNA probes containing the XCRE (25), and nuclear proteins from our steroidogenic cell lines specifically bound to a consensus CRE (SSCRE) were competed by an excess of unlabeled XCRE oligonucleotides. Of interest, experiments using R2C nuclear extracts produce a shifted band that is not detected in the assays using H540 nuclear extracts. This unique complex may include the transcription factor that is required for aromatase promoter activity in transient transfection assays in R2C cells. In addition, this unique complex may be responsible for the elevated levels of aromatase activity that are characteristic of the R2C tumor cells relative to the aromatase activity measured in H540 and Y1 cell lines.

In contrast to our studies of the 3'CRE and XCRE, the CRE-like sequence at -335 (5'CRE: TGAACTCA) does not appear to be important for expression of the aromatase gene. In transient transfection assays in steroidogenic cell lines (R2C, H540, and Y1), mutagenesis of the 5'CRE did not significantly affect promoter activity. In mobility shift assays, no specific protein binding to the 5'CRE was detected in experiments using nuclear extracts from any cell line studied. This finding suggests that the increase in promoter activity observed in functional assays when the region between -242 to -339 is included in the promoter fusions is not due to the proteins that bind the 5'CRE motif at -335. This finding implies that sequences other than the 5'CRE within the -242 to -339 segment mediate this observed increase in promoter activity.

In summary, the goal of these experiments was to examine how the proximal promoter of the rat aromatase gene regulates different patterns of gene expression in different cell types. Functional analysis has identified the following three elements in the proximal promoter of the rat aromatase gene that are important for basal activity in at least one of three steroidogenic cell lines (R2C, H540, and Y1) used in this study: 1) in R2C, H540, and Y1, the SF1-binding site at -90 relative to the start of transcription; 2) in R2C, H540, and Y1, the CRE-like sequence at -231 relative to the start of transcription (3'CRE); and 3) in the R2C cell line, the CRE-like sequence at -169 relative to the start of transcription (XCRE). Further, in these cell lines, not only does there appear to be differential use of multiple cis regulatory elements, but mobility shift assays suggest that in the different cell lines different binding activities are present that recognize specific elements. These observations suggest that the varied levels of aromatase activity in the cell lines that we have studied are probably a consequence of the combinations of proteins in each that bind to these three regulatory elements.


    Acknowledgments
 
We thank the following people for their generous gifts of cell lines, antibodies, or plasmids: Dr. B. P. Shimmer (University of Toronto, Toronto, Canada) for the Y1 cell line, Dr. J. I. Mason (University of Texas Southwestern Medical Center, Dallas, TX) for the H540 cell line, Dr. K. L. Parker (Duke University Medical Center, Durham, NC) for the anti-SF1 antibodies, Dr. K.-I. Morohashi (Kyushu University, Fukuoka, Japan) for the anti-Ad4BP antibodies, Dr. J. P. Hoeffler (University of Colorado Health Science Center, Denver, CO) for the anti-CREB/CREM/ATF-1 antibodies, and Dr. C. R. Mendelson (University of Texas Southwestern Medical Center) for the pET-{Delta}CREB plasmid. We also thank Drs. D. J. Mangelsdorf and C. R. Mendelson (both at University of Texas Southwestern Medical Center) for helpful advice during the preparation of this manuscript, and Michele A. Herbst for isolating the genomic clone containing the rat aromatase promoter.


    Footnotes
 
1 This work was completed while M.Y. was a member of the Cell Regulation Graduate Program at the University of Texas Southwestern Medical Center. This work was supported by NIH Grant DK-03892. Back

2 Current address: The Jackson Laboratory, Bar Harbor, Maine 04609. Back

Received July 30, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Valladares LE, Payne AH 1979 Induction of testicular aromatization by luteinizing hormone in mature rats. Endocrinology 105:431–436[Abstract/Free Full Text]
  2. Tsai-Morris C-H, Aquilano DR, Dufau ML 1985 Cellular localization of rat testicular aromatase activity during development. Endocrinology 116:38–46[Abstract/Free Full Text]
  3. Dorrington JR, Armstrong DT 1975 Folicle-stimulating hormone stimulates estradiol-17ß synthesis in cultured Sertoli cells. Proc Natl Acad Sci USA 72:2677–2681[Abstract/Free Full Text]
  4. Nitta H, Bunick D, Hess RA, Janulis L, Newton SC, Millette CF, Osawa Y, Shizuta Y, Toda K, Bahr JM 1993 Germ cells of the mouse testis express P450 aromatase. Endocrinology 132:1396–1401[Abstract/Free Full Text]
  5. McPhaul MJ, Noble JF, Simpson ER, Mendelson CR, Wilson JD 1988 The expression of a functional cDNA encoding the chicken cytochrome P-450arom (aromatase) that catalyzes the formation of estrogen from androgen. J Biol Chem 263:16358–16363[Abstract/Free Full Text]
  6. Lephart ED, Peterson KG, Noble JF, George FW, McPhaul MJ 1990 The structure of cDNA clones encoding the aromatase P-450 isolated from a rat Leydig cell tumor line demonstrates different processing of aromatase mRNA in rat ovary and a neoplastic cell line. Mol Cell Endocrinol 70:31–40[CrossRef][Medline]
  7. Milewich L, George FW, Wilson JD 1977 Estrogen formation by the ovary of the rabbit embryo. Endocrinology 100:187–196[Abstract/Free Full Text]
  8. Naftolin F, Ryan KJ, Davies IJ, Reddy VV, Flores F, Petro Z, Kuhn M, White RJ, Takaoka Y, Wolin L 1975 The formation of estrogens by central neuroendocrine tissues. Recent Prog Horm Res 31:295–314
  9. Yamada NM, Hirata S, Kato J 1994 Distribution and postnatal changes of aromatase mRNA in the female rat brain. J Steroid Biochem Mol Biol 48:529–533[CrossRef][Medline]
  10. Bolt HM, Gobel P 1972 Formation of estrogens from androgens by human subcutaneous adipose tissue in vitro. Horm Metab Res 4:312–313[Medline]
  11. Ryan KJ 1959 Biological aromatization of steroids. J Biol Chem 234:268–272[Free Full Text]
  12. Simpson ER, Cleland WH, Mendelson CR 1983 Aromatization of androgens by human adipose tissue in vitro. J Steroid Biochem 19:707–719[CrossRef][Medline]
  13. McPhaul MJ, Herbst MA, Matsumine H, Young M, Lephart ED 1993 Diverse mechanisms of control of aromatase gene expression. J Steroid Biochem Mol Biol 44:341–346[CrossRef][Medline]
  14. Conley AJ, Corbin CJ, Hinshelwood MM, Liu Z, Simpson ER, Ford JJ, Harada N 1996 Functional aromatase expression in porcine adrenal gland and testis. Biol Reprod 54:497–505[Abstract]
  15. Corbin CJ, Khalil MW, Conley AJ 1996 Functional ovarian and placental isoforms of porcine aromatase. Mol Cell Endocrinol 113:29–37
  16. Choi I, Simmen RC, Simmen FA 1996 Molecular cloning of cytochrome P450 aromatase complementary deoxyribonucleic acid from periimplantation porcine and equine blastocysts identifies multiple novel 5'-untranslated exons expressed in embryos, endometrium, and placenta. Endocrinology 137:1457–1467[Abstract]
  17. Bulun SE, Simpson ER 1994 Regulation of aromatase expression in human tissues. Breast Cancer Res Treat 30:19–29[CrossRef][Medline]
  18. Matsumine H, Herbst MA, Ou S-HI, Wilson JD, McPhaul MJ 1991 Aromatase mRNA in the extragonadal tissues of chickens with the henny-feathering trait is derived from a distinctive promoter structure that contains a segment of a retroviral long terminal repeat. J Biol Chem 266:19900–19907[Abstract/Free Full Text]
  19. Lephart ED, Herbst MA, McPhaul MJ 1995 Characterization of aromatase cytochome P-450 mRNA in rat perinatal brain, ovary, and a Leydig tumor cell line: evidence for the existence of brain specific aromatase transcripts. Endocrine 3:25–31
  20. Hinshelwood MM, Corbin CJ, Tsang PCW, Simpson ER 1993 Isolation and characterization of a complementary deoxyribonucleotide acid insert encoding bovine aromatase cytochrome P450. Endocrinology 133:1971–1977[Abstract/Free Full Text]
  21. Vanselow J, Furbass R 1995 Novel aromatase transcripts from bovine placenta contain repeated sequence motifs. Gene 154:281–291[CrossRef][Medline]
  22. Young M, McPhaul MJ, Lephart ED 1997 The expression of aromatase cytochrome P-450 in rat H540 Leydig tumor cells. J Steroid Biochem Mol Biol 63:37–44[CrossRef][Medline]
  23. Steinkampf MP, Mendelson CR, Simpson ER 1987 Regulation by follicle-stimulating hormone of the synthesis of aromatase cytochrome P-450 in human granulosa cells. Mol Endocrinol 1:465–471[Abstract/Free Full Text]
  24. Fitzpatrick SL, Richards JS 1993 cis-acting elements of the rat aromatase promoter required for cyclic adenosine 3',5'-monophosphate induction in ovarian granulosa cells and constitutive expression in R2C Leydig cells. Mol Endocrinol 7:341–354[Abstract/Free Full Text]
  25. Fitzpatrick SL, Richards JS 1994 Identification of a cyclic adenosine 3',5'-monophosphate-response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C Leydig cells. Mol Endocrinol 8:1309–1319[Abstract/Free Full Text]
  26. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  27. Valladares LE, Payne AH 1981 Effects of hCG and cyclic AMP on aromatization in purified Leydig cells of immature and mature rats. Biol Reprod 35:752–758
  28. Payne AH, Youngblood GL 1995 Regulation of expression of steroidogenic enzymes in Leydig cells. Biol Reprod 52:217–225[Abstract]
  29. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 6:1249–1258[Abstract/Free Full Text]
  30. Honda S-I, Morohashi K-I, Nomura M, Takeya H, Kitajima M, Omura T 1993 Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily. J Biol Chem 268:7494–7502[Abstract/Free Full Text]
  31. Lynch JP, Lala DS, Peluso JJ, Luo W, Parker KL, White BA 1993 Steroidogenic factor 1, and orphan nuclear receptor, regulates the expression of the rat aromatase gene in gonadal tissues. Mol Endocrinol 7:776–786[Abstract/Free Full Text]
  32. Morohashi K-I, Zanger UM, Honda S-I, Hara M, Waterman MR, Omura T 1993 Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP. Mol Endocrinol 7:1196–1204[Abstract/Free Full Text]
  33. Leshin M, Noble JF 1986 Solubilization and partial purification of aromatase from chicken ovary. J Steroid Biochem 25:91–97[Medline]
  34. Lephart ED, Simpson ER 1991 Assay of aromatase activity. Methods Enzymol 206:477–483[Medline]
  35. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275[Free Full Text]
  36. Sanger F, Nicklens S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463[Abstract/Free Full Text]
  37. Landolfi NF, Yin XM, Capra JD, Tucker PW 1988 A conserved heptamer upstream of the IgH promoter region octamer can be the site of a coordinate protein-DNA interaction. Nucleic Acids Res 16:5503–5514[Abstract/Free Full Text]
  38. Landolfi NF, Capra JD, Tucker PW 1987 Protein-nucleotide contacts in the immunoglobulin heavy-chain promoter region. Proc Natl Acad Sci USA 84:3851–3855[Abstract/Free Full Text]
  39. Michael LF, Alcorn JL, Gao E, Mendelson CR 1996 Characterization of the cyclic adenosine 3',5'-monophosphate response element of the rabbit surfactant protein-A gene: evidence for transactivators distinct from CREB/ATF family members. Mol Endocrinol 10:159–170[Abstract/Free Full Text]
  40. Shin S-I, Yasumura Y, Sato GH 1968 Studies on interstitial cells in tissue culture. II. Steroid biosynthesis by a clonal line of rat testicular interstitial cells. Endocrinology 82:614–616[Abstract/Free Full Text]
  41. Jacobs BB, Huseby RA 1967 Neoplasms occurring in aged Fischer rats, with special reference to testicular, uterine, and thyroid tumors. J Natl Cancer Inst 39:303–309[Medline]
  42. Ikeda Y, Lala DS, Luo X, Kim E, Moisan M-P, Parker KL 1993 Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Endocrinol 7:852–860[Abstract/Free Full Text]
  43. Clemens JW, Lala DS, Parker KL, Richards JS 1994 Steroidogenic factor-1 binding and transcriptional activity of the cholesterol side-chain cleavage promoter in rat granulosa cells. Endocrinology 134:1499–1508[Abstract/Free Full Text]
  44. Shen W-H, Moore CCD, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Mullerian inhibiting substance gene: a link to the sex determination cascade. Cell 77:651–661[CrossRef][Medline]
  45. Liu Z, Simpson ER 1997 Steroidogenic factor 1 (SF-1) and SP1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127–137[Abstract/Free Full Text]
  46. Deutsch PJ, Hoeffler JP, Jameson JL, Lin JC, Habener JF 1988 Cyclic AMP and phorbol ester-stimulated transcription mediated by similar DNA elements that bind distinct proteins. Proc Natl Acad Sci USA 85:7922–7926[Abstract/Free Full Text]
  47. Deutsch PJ, Hoeffler JP, Jameson JL, Lin JC, Habener JF 1988 Structural determinants for transcriptional activiation by cAMP-responsive DNA elements. J Biol Chem 263:18466–18472[Abstract/Free Full Text]
  48. Meyer TE, Habener JF 1993 Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr Rev 14:269–290[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
H. K. Choi, S. H. Roh, H. G. Kim, E. H. Han, H. G. Jeong, and K. W. Kang
Enhanced expression of aromatase in p53-inactivated mammary epithelial cells
Endocr. Relat. Cancer, March 1, 2008; 15(1): 139 - 147.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Sirianni, A. Chimento, R. Malivindi, I. Mazzitelli, S. Ando, and V. Pezzi
Insulin-Like Growth Factor-I, Regulating Aromatase Expression through Steroidogenic Factor 1, Supports Estrogen-Dependent Tumor Leydig Cell Proliferation
Cancer Res., September 1, 2007; 67(17): 8368 - 8377.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
D. Silandre, C. Delalande, P. Durand, and S. Carreau
Three promoters PII, PI.f, and PI.tr direct the expression of aromatase (cyp19) gene in male rat germ cells
J. Mol. Endocrinol., August 1, 2007; 39(2): 169 - 181.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D.-S. Wang, T. Kobayashi, L.-Y. Zhou, B. Paul-Prasanth, S. Ijiri, F. Sakai, K. Okubo, K.-i. Morohashi, and Y. Nagahama
Foxl2 Up-Regulates Aromatase Gene Transcription in a Female-Specific Manner by Binding to the Promoter as Well as Interacting with Ad4 Binding Protein/Steroidogenic Factor 1
Mol. Endocrinol., March 1, 2007; 21(3): 712 - 725.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Galmiche, N. Richard, S. Corvaisier, and M.-L. Kottler
The Expression of Aromatase in Gonadotropes Is Regulated by Estradiol and Gonadotropin-Releasing Hormone in a Manner that Differs from the Regulation of Luteinizing Hormone
Endocrinology, September 1, 2006; 147(9): 4234 - 4244.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Euskirchen, T. E. Royce, P. Bertone, R. Martone, J. L. Rinn, F. K. Nelson, F. Sayward, N. M. Luscombe, P. Miller, M. Gerstein, et al.
CREB Binds to Multiple Loci on Human Chromosome 22
Mol. Cell. Biol., May 1, 2004; 24(9): 3804 - 3814.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Pezzi, R. Sirianni, A. Chimento, M. Maggiolini, S. Bourguiba, C. Delalande, S. Carreau, S. Ando, E. R. Simpson, and C. D. Clyne
Differential Expression of Steroidogenic Factor-1/Adrenal 4 Binding Protein and Liver Receptor Homolog-1 (LRH-1)/Fetoprotein Transcription Factor in the Rat Testis: LRH-1 as a Potential Regulator of Testicular Aromatase Expression
Endocrinology, May 1, 2004; 145(5): 2186 - 2196.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Morinaga, T. Yanase, M. Nomura, T. Okabe, K. Goto, N. Harada, and H. Nawata
A Benzimidazole Fungicide, Benomyl, and Its Metabolite, Carbendazim, Induce Aromatase Activity in a Human Ovarian Granulose-Like Tumor Cell Line (KGN)
Endocrinology, April 1, 2004; 145(4): 1860 - 1869.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Peng, J. W. Kim, W. E. Rainey, B. R. Carr, and G. R. Attia
The Role of the Orphan Nuclear Receptor, Liver Receptor Homologue-1, in the Regulation of Human Corpus Luteum 3{beta}-Hydroxysteroid Dehydrogenase Type II
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6020 - 6028.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Zeleznik, D. Saxena, and L. Little-Ihrig
Protein Kinase B Is Obligatory for Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology, September 1, 2003; 144(9): 3985 - 3994.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Bourguiba, S. Chater, C. Delalande, M. Benahmed, and S. Carreau
Regulation of Aromatase Gene Expression in Purified Germ Cells of Adult Male Rats: Effects of Transforming Growth Factor {beta}, Tumor Necrosis Factor {alpha}, and Cyclic Adenosine 3',5'-Monosphosphate
Biol Reprod, August 1, 2003; 69(2): 592 - 601.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. J. Meeks, T. A. Russell, B. Jeffs, I. Huhtaniemi, J. Weiss, and J. L. Jameson
Leydig Cell-Specific Expression of DAX1 Improves Fertility of the Dax1-Deficient Mouse
Biol Reprod, July 1, 2003; 69(1): 154 - 160.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Catalano, V. Pezzi, A. Chimento, C. Giordano, A. Carpino, M. Young, M. J. McPhaul, and S. Ando
Triiodothyronine Decreases the Activity of the Proximal Promoter (PII) of the Aromatase Gene in the Mouse Sertoli Cell Line, TM4
Mol. Endocrinol., May 1, 2003; 17(5): 923 - 934.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Yoshiura, B. Senthilkumaran, M. Watanabe, Y. Oba, T. Kobayashi, and Y. Nagahama
Synergistic Expression of Ad4BP/SF-1 and Cytochrome P-450 Aromatase (Ovarian Type) in the Ovary of Nile Tilapia, Oreochromis niloticus, During Vitellogenesis Suggests Transcriptional Interaction
Biol Reprod, May 1, 2003; 68(5): 1545 - 1553.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Y. Gevry, E. Lalli, P. Sassone-Corsi, and B. D. Murphy
Regulation of Niemann-Pick C1 Gene Expression by the 3'5'-Cyclic Adenosine Monophosphate Pathway in Steroidogenic Cells
Mol. Endocrinol., April 1, 2003; 17(4): 704 - 715.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden
An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells
Am. J. Pathol., January 1, 2002; 160(1): 369 - 380.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Lanzino, S. Catalano, C. Genissel, S. Ando, S. Carreau, K. Hamra, and M. J. McPhaul
Aromatase Messenger RNA Is Derived from the Proximal Promoter of the Aromatase Gene in Leydig, Sertoli, and Germ Cells of the Rat Testis
Biol Reprod, May 1, 2001; 64(5): 1439 - 1443.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, M.
Right arrow Articles by McPhaul, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, M.
Right arrow Articles by McPhaul, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals