help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boden, S. D.
Right arrow Articles by Titus, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boden, S. D.
Right arrow Articles by Titus, L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Endocrinology Vol. 139, No. 12 5125-5134
Copyright © 1998 by The Endocrine Society


ARTICLES

LMP-1, A LIM-Domain Protein, Mediates BMP-6 Effects on Bone Formation

Scott D. Boden1, Yunshan Liu1, Gregory A. Hair1, Jill A. Helms, Diane Hu, Michele Racine, Mark S. Nanes and Louisa Titus

Emory University School of Medicine (S.D.B., Y.L., G.A.H., M.R.), Department of Orthopaedic Surgery, and Atlanta Veterans Affairs Medical Center, Decatur, Georgia 30033; Division of Endocrinology and Metabolism (F.L.T., M.S.N.), Emory University School of Medicine, Atlanta Veterans Affairs Medical Center, Decatur, Georgia 30033; and University of California San Francisco School of Medicine (J.A.H., D.H.), Department of Orthopaedic Surgery, San Francisco, California 94143

Address all correspondence and requests for reprints to: Scott D. Boden, M.D., The Emory Spine Center, 2165 North Decatur Road, Decatur, Georgia 30033.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucocorticoids can promote osteoblast differentiation from fetal calvarial cells and bone marrow stromal cells. We recently reported that glucocorticoid specifically induced bone morphogenetic protein-6 (BMP-6), a glycoprotein signaling molecule that is a multifunctional regulator of vertebrate development. In the present study, we used fetal rat secondary calvarial cultures to determine genes induced during early osteoblast differentiation as initiated by glucocorticoid treatment.

Glucocorticoid, and subsequently BMP-6, was found to induce a novel rat intracellular protein, LIM mineralization protein-1 (LMP-1), that in turn resulted in synthesis of one or more soluble factors that could induce de novo bone formation. Blocking expression of LMP-1 using antisense oligonucleotide prevented osteoblast differentiation in vitro. Overexpression of LMP-1 using a mammalian expression vector was sufficient to initiate de novo bone nodule formation in vitro and in sc implants in vivo. These data demonstrate that LMP-1 is an essential positive regulator of the osteoblast differentiation program as well as an important intermediate step in the BMP-6 signaling pathway.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OSTEOBLASTS ARE THOUGHT to differentiate from pluripotent mesenchymal stem cells. The maturation of an osteoblast results in the secretion of an extracellular matrix that can mineralize and form bone. The regulation of this complex process is not well understood but is thought to involve a group of signaling glycoproteins known as bone morphogenetic proteins (BMPs), members of the transforming growth factor-ß superfamily. These proteins have been shown to be involved with embryonic dorsal-ventral patterning, limb bud development, and fracture repair in adult animals (1). This group of secreted proteins has a spectrum of activities in a variety of cell types at different stages of differentiation; differences in physiological activity between these closely related molecules have not been clarified (2).

To better discern the unique physiological role of different BMP signaling proteins, we recently compared the potency of BMP-6 with that of BMP-2 and BMP-4, for inducing rat calvarial osteoblast differentiation (3). We studied this process in first passage (secondary) cultures of fetal rat calvarial osteoblasts that require BMP or glucocorticoid for initiation of differentiation. In this model of membranous bone formation, glucocorticoid (GC) or a BMP will initiate differentiation to mineralized bone nodules capable of secreting osteocalcin, an osteoblast-specific protein. This secondary culture system is distinct from primary rat osteoblast cultures that undergo spontaneous differentiation. In this secondary system, glucocorticoid treatment resulted in a 10-fold induction of BMP-6 messenger RNA (mRNA) and protein expression that was responsible for the enhancement of osteoblast differentiation (4).

Here we report on a novel positive regulator of rat osteoblast differentiation. Owing to the presence of two LIM finger structures in its sequence, its pattern of expression, and its role in formation of mineralized bone, we have named this protein LMP (for LIM mineralization protein). LIM domain proteins were originally named for the three homeodomain proteins in which they were first described: Lin-11, Isl-1, and Mec-3 (5, 6, 7).

LMP was identified in RNA from osteoblasts stimulated by glucocorticoid and isolated from an osteosarcoma complementary DNA (cDNA) library. Based on its association with bone development in vivo and on the results of suppression and overexpression experiments in vitro and in vivo, our findings indicate that LMP is an essential intracellular positive regulator of the osteoblast differentiation program. Furthermore, its temporal and spatial association with bone morphogenetic protein-6 (BMP-6) suggests that it may be involved in the signaling pathway of BMPs, a family of secreted proteins important in bone formation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
Recombinant human (rh) BMP-2, -4, and -6 produced in Chinese hamster ovary cells were obtained from Genetics Institute (Cambridge, MA). MEM supplemented with L-glutamine was purchased from Gibco BRL (Gaithersburg, MD); BGJb bone culture medium, the glucocorticoid (GC) triamcinolone acetonide, ß-glycero-phosphate (ß-GlyP), and ascorbic acid from Sigma Chemical Co. (St. Louis, MO); and heat-inactivated FBS from Hyclone Laboratories, Inc. (Logan, UT). Timed pregnant Sprague Dawley rats were purchased from Charles River Laboratories, Inc. (Raleigh, NC).

Calvarial cell preparation
Following approval by the Institutional Animal Care and Use Committee, fetal Sprague Dawley rats were removed at 20 days gestation, decapitated, and the heads submerged in sterile PBS with 1% penicillin/streptomycin-5000U (Gibco BRL). The crania were dissected using sterile technique in the laminar flow hood. Parietal and frontal bones were dissected free from the sutures and subjected to four collagenase digestions (type 1:type 2 = 6:1). The specific activity of collagenase (Worthington Enzymes, Freehold, NJ) was 43 IU/ml in the first digestion and 172 IU/ml for the remaining three digestions. All digestions were carried out at 32 C for 20 min each. Cells from the latter two digestions were pooled to provide a rat osteoblastic (rOB)-enriched cell suspension (3). The pooled cells were washed, pelleted, resuspended in MEM/10% FBS, counted by hemocytometer, and seeded in T-75 vented flasks (Corning, Inc., Corning, NY) at 1 x 106 cells/flask. Cells were grown at 37 C in 5% CO2 with humidification. The cells were fed at 48 h and again at 96 h with MEM/10% FBS. Seven days after seeding, the primary culture was trypsinized and passed into 6-well plates at 1 x 105 cells/35 mm well) as first subculture or secondary cells. Secondary cultures were grown for an additional 7 days during which they reached second confluence (day 0). To initiate osteoblast differentiation in the secondary cultures 1 nM triamcinolone acetonide, a glucocorticoid (GC), was applied for 7 days; alternatively 50 ng/ml of rhBMP was applied in certain experiments to initiate differentiation. Beginning on day 0, media were changed and treatments (GC and/or cytokines) were applied under a laminar flow hood every 3–4 days. The standard culture protocol was as follows: days 0–7 = MEM, 10% FBS, 50 µg/ml ascorbic acid; days 8–14 = BGJb medium, 10% FBS, 5 mM ß-GlyP (as a source of inorganic phosphate to permit mineralization). Endpoint analysis of bone nodule formation and osteocalcin secretion was performed at day 14.

Quantitation of bone nodule formation
Cultures were fixed overnight in 70% ethanol and stained with von Kossa silver stain. A semiautomated computerized video image analysis system (Optomax 5, Optomax, Hollis, NH) was used to quantitate nodules in each well. This automated technique was previously validated against a manual counting technique and demonstrated a correlation coefficient of 0.92 (P < 0.000001) (3). All data are expressed as the mean ± SEM (SEM) calculated from 5–6 wells at each condition. Each experiment was reconfirmed at least two times using cells from different calvarial preparations.

Quantitation of osteocalcin secretion
Osteocalcin levels in the medium were measured using a competitive RIA with a monospecific polyclonal antibody (PAb) raised in our laboratory against the C-terminal octapeptide of rat osteocalcin as described previously except for use of an acetylated peptide analog as radioligand and standard (8). Osteocalcin values were reported as pmol/ml (nM) medium (3-day production). Values were expressed as the mean ± SEM of triplicate determinations for 5–6 wells for each condition. Each experiment was reconfirmed at least two times using cells from different calvarial preparations.

Differential display PCR
Secondary osteoblast cultures were prepared as previously described and treated in the presence or absence of 1 nM GC. Total RNA was isolated by our standard methods (4) and differential display RT-PCR was performed using four RNAimage kits (GenHunter Corp.) according to the manufacturer’s protocol. Radiolabeled PCR products were fractionated by electrophoresis on a DNA sequencing gel; dried gels were exposed overnight to Kodak X-OMAT film (Eastman Kodak Co., Rochester, NY). Bands of differentially expressed cDNAs were excised from the gel, reamplified by PCR and the products were cloned into the PCR-II vector (TA cloning kit, Invitrogen). Sequence analysis of the PCR product revealed a novel 260-bp cDNA fragment (BLASTN;http://www.ncbi.nlm.nih.gov/).

Isolation and sequencing of clones
The 260-bp DNA fragment was random primer labeled (Amersham Pharmacia Biotech, Piscataway, NJ) with {alpha}-(32P)-dCTP (New England Nuclear, Boston, MA) and used to probe an osteoblast cDNA library (custom UMR 106 library, Stratagene, La Jolla, CA, generously provided by Dr. Laura Mauro). The library was plated (5 x 104 pfu/ml) onto agar plates, grown 8 h at 37 C, and filter membranes (Duralon-UV, Stratagene) overlaid for 2 or 4 min onto the plates. Filters were denatured, rinsed, UV cross-linked, prehybridized for 2 h at 42 C, hybridized with the probe overnight at 42 C, washed under moderately stringent conditions, and exposed to Kodak X-OMAT film overnight. Four positive clones were identified that hybridized strongly to the 260 bp probe. Positive plaques were rescued as Bluescript SK(-) phagemids (Stratagene). Nucleotide sequence of the clones were obtained using the Amplicycle Sequencing Kit (Perkin-Elmer Applied Biosciences, Foster, CA) and sequence-specific oligonucleotides as sequencing primers. Autoradiographic bands were analyzed manually. A total of 8 primers were used to assemble a cDNA consisting of 1696 bp.

RT-PCR
Secondary rat osteoblast cultures were untreated or treated with 1 nM GC or 50 ng/ml BMP-6 for the indicated times. Total RNA was pooled and isolated from two 35-mm wells as previously described (4), and triplicate samples from each treatment were analyzed by RT-PCR. Briefly, cDNAs were generated from total RNA using MMLV reverse transcriptase (Promega Corp., Madison, WI) and oligo-dT17 primer. PCR was performed on one twentieth of the total RT reaction using {alpha}-(32P)-dCTP, Amplitaq DNA polymerase (Perkin-Elmer Corp.), and specific primers for LMP-1 (forward = 5'CCACGTATGAGCACCTCCTC3'; reverse = 5'CACAGCTACATACAGGTTTATTG3'. PCR was performed for 22 cycles (94 C, 30"; 58 C, 30"; 72 C, 20"). Products were separated by PAGE, analyzed by Phosphorimager (Molecular Dynamics, Inc., Sunnyvale, CA), and their intensities were normalized to those of glyceraldehyde phosphate dehydrogenase (GAPDH, a constitutive marker, not regulated by treatments; forward = 5'CTGGTCATCAATGGGAAAC3'; reverse = 5'AAAGTTGTCATGGATGACC3'). BMP-2 primers: forward = 5'TATGCTCGACCTGTACCGC3'; reverse = 5'CACTTCCACCACAAACCC3'. Cbfa-1 primers: forward = 5'CCAGATGGGA- CTGTGGTTACC3'; reverse = 5'ACTTGGTGCAGAGTTCAGGG3'. To evaluate the expression of LMP-1 mRNA in other tissues, total RNA from various rat tissues was purchased (Stratagene), treated with DNase I (5 U, Gibco BRL) at 37 C for 20 min and RT-PCR was performed as described above and repeated using another set of primers specific for a unique region of LMP-1 (forward = 5'ATCCTTGCTCACCTCAC-GGG3'; reverse = 5'GCACTGTGCTGGTTTTGTCTGG3'.

Antisense oliogonucleotide blocking experiments
Specific antisense oligonucleotides were designed by computer analysis, synthesized and HPLC purified by the Emory University Microchemical Facility as follows: BMP-6 antisense: 5'CCTGTAGTGTCGTTGATCGT3' against sequence beginning 7 bp downstream from the translation start site. LMP-1 antisense: 5'GCACTACCTTGAAGGAATCCATGGT3', spanned the putative translation start site. Cbfa1 antisense: 5'TTGTGAGGCGAATGAAGCAT3'. NONSENSE–5'AGC TTGTTGCTGAGTTGTCC3' had no significant homologies to any known rat sequence. Osteoblast cultures were stimulated to differentiate using 1 nM GC. In addition, cultures were treated with antisense oligonucleotides or random oligonucleotides (0.4 µM for the first 7 days). Oligonucleotides were preincubated in MEM without serum at least 10 min or for 2 h at 4 C and further diluted in MEM containing 10% FBS (Hyclone Laboratories, Inc.) and 50 µg/ml ascorbic acid to achieve 0.4 µM. RNA was harvested at the indicated time points and analyzed by RT-PCR.

Northern analysis and RNase protection assay
Total RNA (30 µg/lane) was electrophoresed using a formaldehyde 1% agarose gel and osmotically transblotted to Gene-Screen (DuPont NEN). Membranes were hybridized overnight with a 625 bp LMP-1 probe radiolabeled by random primer method (Boehringer Mannheim, Mannheim, Germany). Membranes were washed under moderately stringent conditions and exposed to Kodak X-OMAT film overnight.

A nearly full-length 1498 bp riboprobe of LMP-1 was prepared (Boehringer Mannheim Transcription Kit) by T7 initiation of complementary sequence polymerization in linearized LMP-1 PCR-II (Invitrogen) clones. Total RNA (30 µg/lane) was hybridized (Boehringer Mannheim RNase Protection Kit) to the riboprobe (2.5 x 104 cpm/µl), the mixture was digested and precipitated according to the manufacturer’s protocol. Digested products were separated by electrophoresis on a 6% urea gel; the gel was dried and exposed to Kodak X-OMAT film overnight.

Protein analysis
A polyclonal antibody to rat LMP-1 was generated. A hydrophillic hexapeptide (Gln-Asp-Pro-Asp-Glu-Glu, amino acids 389–394), determined using the OMIGA 1.0 (Intelligenetics, Inc.) subprogram ANTIGEN, was synthesized and conjugated to keyhole limpet hemocyanin by the Emory University Microchemical Facility; 100 µg of the conjugated peptide was mixed with Freund’s complete adjuvant and injected into 10 sites sc along the back of an 8-week-old rabbit in accordance with Emory University guidelines. Rabbits were reinjected 15 days later and every 30 days for 5 months to generate acceptable LMP-1 antibody titers. In selected experiments, BMP-2 protein levels were determined using a specific antibody for BMP-2 (provided by Genetics Institute).

Western blot analysis (9) was performed on 50 µg of cell culture homogenate (cells and matrix for LMP-1, medium for BMP-2), separated by SDS-PAGE, and electrophoretically transblotted to PVDF filter paper (Bio-Rad Laboratories, Inc.). LMP-1 antiserum (diluted 1:250 in TBS/1% goat serum) was incubated with membrane (blocked with TBS/5% goat serum) for 36 h at 4 C and, after washing, was detected using biotinylated goat antimouse secondary IgG (1:500) followed by Streptavidin (1:500) and TMB developer (Kirkegaard & Perry Laboratories) under standard conditions. For in vitro translation studies, an 35S-labeled LMP-1 protein was synthesized in vitro from a pcDNA3.1His plasmid (Invitrogen) containing an LMP-1 cDNA insert using the Promega Corp. TNT T7 Quick Coupled Transcription/Translation System (no. L1170).

In situ hybridization
Tissue postfixation was performed with 4% paraformaldehyde-PBS with 0.1% sodium borohydride followed by acetylation to reduce nonspecific binding. Riboprobes were prepared by standard methods (Promega Corp. Kit) using 35S initially with the full length LMP-1 cDNA and repeated with a 650 bp cDNA (nucleotides -70 to +580) that did not contain the LIM domain sequences of LMP-1 to confer greater specificity. In situ hybridization was performed overnight at 55 C with high stringency washes (60 C) and RNase A. Slides were exposed to emulsion (Kodak) for appropriate times, developed, fixed and counterstained with Hoechst 33258. Images were captured using a 3-chip color CCD camera (Optronics) and stored as Adobe Photoshop files. Images were displayed as superimpositions of the in situ hybridization signal obtained with transmitted light overlaid on the blue nuclear stain revealed by the fluorescence of Hoechst 33258 dye. Results were repeated on several specimens and with riboprobes to different regions of LMP-1 to ensure specificity.

Construction of LMP-1 expression vector and transient transfection of cells
The 1696 bp cDNA for LMP-1 was excised from the PCR-II cloning vector and ligated into the mammalian expression vector, pCMV2 (5.5 kb, Invitrogen), by standard methods (10). A control vector was constructed in which the LMP-1 cDNA was inserted in the reverse orientation, so as to not be translated. These vectors were applied to osteoblast cultures for 2 h on day 0, before any other treatment, using 7.5 µl/well Superfect transfection reagent (3 mg/ml, Quiagen) and a modification of the manufacturer’s protocol. DNA was resuspended in MEM to 450 µl and vortexed 10 sec; Superfect was added, the solution vortexed and incubated at room temperature for 10 min. MEM/10% FBS (1 ml/well) was added, mixed and applied to osteoblast cultures immediately. Following 2 h incubation at 37 C, the Superfect/DNA mixture was removed by aspiration, the cultures were washed and MEM/10%FBS/50 µg/ml ascorbic acid was added to begin the usual differentiation protocol. Nodule number and osteocalcin were determined 14 days post transfection.

Preparation of LMP-1 conditioned medium
Transfections were performed using 6 µg pCMV2-LMP-1-forward or pCMV2-LMP-1-reverse DNA per culture. The medium was removed 4 days posttransfection, frozen overnight, concentrated (10-fold) and desalted using a Centriprep 3 centrifugal concentrator (3000 mol wt cut off), and frozen. The concentrate was resuspended in fresh complete medium to its original concentration and applied to secondary osteoblast cultures with or without 1 nM GC (day 0).

Transfection of bone marrow cells for in vivo bone induction
Marrow was extracted from the hindlimbs of 4- to 5-week-old normal rats (rnu-/+) in {alpha} MEM, centrifuged, and the red blood cells lysed by resuspending the pellet in 0.83% NH4Cl in 10 mM Tris, pH 7.4. Remaining marrow cells were washed x 3 with medium and transfected for 2 h with 9 µg pCMV2-LMP-1 in the forward or reverse (control) orientation/1.5–3 million cells. Cells were washed x 2 with medium, resuspended to 30 million cells/ml, and 100 µl of the suspension applied to a sterile sheet (4 x4 x 3 mm) of human devitalized bone matrix or a bovine type I collagen disc (2 x 5 mm). Implants were surgically placed sc on each side of the chest wall, abdominal wall, or on the skull of 4- to 5-week-old athymic rats (rnu/rnu). Animal care was in accordance with institutional guidelines. The animals were euthanized after 4 weeks and the explants were removed, fixed in 70% ethanol, and analyzed by radiography and undecalcified histologic examination using Goldner trichrome. These experiments were repeated in 14 animals spread over three groups of animals with consistent results.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A novel rat LIM protein is expressed in differentiating osteoblasts and up-regulated by glucocorticoid
To better understand the molecular pathway of glucocorticoid induction of early osteoblast differentiation, we used differential display RT-PCR to identify mRNAs induced within 48 h of glucocorticoid treatment. One of the novel glucocorticoid-induced mRNAs was used to screen an osteoblast cDNA library to obtain a 1696-bp cDNA (GenBank accession number AF095585). DNA sequence analysis determined that the full-length cDNA containing the fragment originally detected by differential display PCR. The full-length cDNA sequence revealed an open reading frame of 1374 bp encoding a protein of 457 amino acids (predicted size 49.4 kDa), flanked 3' by a 250-bp untranslated region and 5' by 72 untranslated bp. The protein contained multiple putative posttranslational modification sites, including two N-glycosylation sites, and was a member of the diverse LIM protein family (Fig. 1AGo).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Induction of novel rat gene product during osteoblast differentiation. A, Deduced amino acid sequence of LMP-1. LIM motif (residues 341–391) and LIM domain (residues 400–452) sequences are underlined. The asterisks (Asn 113 and Asn 257 indicate putative N-linked glycosylation sites. B, Structural schematic diagram comparing LMP-1 protein with similar rat and human LIM-domain proteins. Ril, LMP-1, and ENH are rat proteins; enigma is a human protein; zyxin and paxillin have been described in multiple species.

 
LIM proteins include putative transcription factors and cytoskeletal proteins, some of which have been implicated in cell proliferation and differentiation (11, 12, 13). LIM domains are defined by a conserved pattern of cysteine, histidine, or alternate metal-coordinating residues which, in turn, define two specialized zinc fingers (14). The LIM domain is thought to mediate protein-protein interactions within or between molecules (13). LMP-1 does not contain a homeodomain. The group of LIM proteins containing C-terminal LIM domains, to which our newly identified clone belongs, have been shown to bind membrane receptors and protein kinase C intracellularly, but the functional significance of their binding is undefined (15, 16, 17).

The LIM protein induced by glucocorticoid, hereafter named LIM Mineralization Protein-1 (LMP-1), showed 54.9% homology (51.4% nucleotide homology) to the most similar rat LIM family member, ENH (17). In addition, LMP-1 protein was 78.5% homologous (83.9% nucleotide) with the most similar human LIM family member, enigma (16). Although the amino acid homology of the two LIM domains in LMP-1 and the corresponding domains in human enigma is 96.8%, human enigma (and rat ENH) contain a third LIM domain that is not present in LMP-1. In addition, the remainder of the protein is considerably different; therefore, we do not know if LMP-1 is the rat homologue of human enigma (Fig. 1BGo). The remainder of LMP-1 (nonLIM domain regions) had less than 25% overall homology with other rat LIM proteins.

To examine the time course of LMP-1 expression in our in vitro model of membranous bone formation, we studied mRNA expression using RT-PCR. Experiments with glucocorticoid (GC) as the stimulus for osteoblast differentiation revealed a peak increase in LMP-1 message at 48 h (Fig. 2AGo). In light of earlier data showing that glucocorticoid treatment increased BMP-6 mRNA levels by 6 h, we hypothesized that the increase in LMP-1 message by GC could be mediated by BMP-6. Using RT-PCR, we demonstrated that BMP-6 treatment resulted in a 4-fold increase in LMP-1 message by 2 h (Fig. 2BGo), which increased to 30-fold on day 3 and returned to baseline on day 7 (Fig. 2CGo). We further established the downstream relationship of LMP-1 to BMP-6 by showing that the GC-induced increase of LMP-1 mRNA was blocked by the addition of antisense oligonucleotide to BMP-6.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. A, Time course of LMP-1 induction by GC as measured by RT-PCR. GC, Long dashed bar; no treatment, short dashed bar. B, Time course of early LMP-1 induction by 50 ng/ml BMP-6 (solid line) compared with untreated control cultures (broken line). C, Time course of LMP-1 induction by 50 ng/ml BMP-6 (solid line) over 1 week compared with untreated control cultures (broken line). Inset, 24 h time point. LMP-1 RT-PCR product (untreated, lanes 1, 2, 3; BMP-6 treated, lanes 4, 5, 6).

 
We used three methods to confirm the induction of LMP-1 mRNA and protein in secondary calvarial osteoblast cultures treated with glucocorticoid or BMP-6. Northern analysis revealed the expected 1.7-kb mRNA species stimulated 19-fold by BMP-6 (Fig. 3AGo). GC induction of LMP-1 mRNA was confirmed by the RNase protection assay (Fig. 3BGo). Western blot analysis using an LMP-1 polyclonal antibody demonstrated that GC stimulated an approximately 50 kDa band (Fig. 3CGo). Thus, the increase in steady-state LMP-1 mRNA levels resulted in increased synthesis of LMP-1 protein. In vitro translation of LMP-1 cDNA in a rabbit reticulocyte lysate system also yielded a 50-kDa protein, confirming the size of LMP-1 (data not shown).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. A, Northern blot of untreated (lane 1) or BMP-6 treated (50 ng/ml for 48 h, lane 2) total RNA probed with a 625 bp radiolabeled fragment of LMP-1. The arrow indicates a single 1.7-kb transcript that increased 19-fold in response to BMP-6. B, RNase protection assay of 30 µg total RNA from cultures treated with 1 nM GC for 48 h, probed with a 1498 bp radiolabeled riboprobe of LMP-1. The arrow indicates an approximately 1.5 kb protected RNA sequence. C, Western analysis of 50 µg total protein from cultures treated as in 3B. The arrow indicates an approximately 50-kDa protein band detected by LMP-1 specific polyclonal antiserum that was enhanced 9-fold by GC treatment. The additional three bands seen on the gel represent nonspecific binding, as they were not removed by antibody pretreatment with the hexapeptide against which the antiserum was raised (lane 3).

 
LMP-1 mRNA is expressed early during embryonic bone development
RT-PCR revealed that LMP-1 was expressed at varying levels in adult rat kidney, heart, brain, lung, and skeletal muscle. The tissue distribution of LMP-1 during fetal endochondral and membranous bone development was examined by in situ hybridization using rat and mouse tissues (Fig. 4Go). Rat embryonic day 14 (e14) and mouse e15 sections showed LMP-1 transcripts in mesenchymal tissue surrounding the cartilaginous anlage of immature bones, and in the future joint spaces (Fig. 4Go, A, B, and D). At the same time during embryonic development, BMP-6 was expressed in the hypertrophic cartilage region in the center of the long bone anlage and in the joint spaces (Fig. 4CGo) as has been previously reported (18). Later, as endochondral ossification progressed (Fig. 4LGo) and the hypertrophic cartilage zone began to be replaced by mineralized bone, LMP-1 expression appeared in the mineralizing portion of the bone (Fig. 4Go, F and G) adjacent to the BMP-6 expression domain in the hypertrophic chondrocytes (Fig. 4EGo).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. LMP-1 and BMP-6 expression in fetal rat and mouse tissues. A, Embryonic day 14 (e14) sagittal section through a rat handplate showed LMP-1 expression in the cells surrounding the cartilaginous anlage of developing long bones and in cells lining the future joint spaces. B, Rat handplate (e14.5) showed a similar LMP-1 expression domain in perichondrium and skeletal muscle. C, Sagittal section through a mouse limb at e15 showed BMP-6 expression in the hypertrophic chondrocytes of the digits, the radius, and in the future articular surfaces. D, Near-adjacent section to that of 2C demonstrated LMP-1 in the perichondrium and future articular spaces of the digits and wrist bones. E, Sagittal section through a mouse e17 limb showed BMP-6 in the hypertrophic chondrocytes adjacent to the primary ossification center. F, Near-adjacent section to that of 2E showed that the LMP-1 expression domain is adjacent to that of BMP-6, in the central region of the primary ossification center that had begun to form membranous bone. G, Section through an e18 rat limb showed LMP-1 was highly expressed in muscle as well as in the ossifying cells in the primary ossification centers of long bones. Expression was also seen in the cells lining the articular surfaces of the wrist bones. H, Rat e14 sagittal section showed LMP-1 transcripts in the neural crest derived bone of the skull which includes the palatine, nasal, mandibular (mn), and hyoid bones. LMP-1 was also expressed in the ventricular layers and the meninges of the brain. I, Coronal section of rat e15 skull revealed LMP-1 expression in the tongue muscle (t), nasal bone, basispresphenoid (bs), sclerotic ossicles, and the proximal mandible. J, Sagittal section of a rat e18 skull showed LMP-1 transcripts in the membranous bone of the calvarium. K, Sagittal section of a rat e18 skull showed similar expression domains as in 2I. LMP-1 expression in the proximal mandible, nasal bone (n), and basispresphenoid (bs) was evident. L, Schematic diagram of endochondral bone formation during fetal long bone development. 1) A cartilaginous anlage is formed. 2) A perichondral ring develops adjacent to the center. 3) The central portion of the long bone cartilage undergoes hypertrophy. 4) Vascular invasion of this region brings osteoprogenitor cells and forms the primary ossification center. 5) This primary ossification center advances toward each end of the bone as it forms intramembranous bone containing marrow elements. 6) At each end of the bone, a secondary ossification center forms and a growth plate consisting of a gradual transition from resting to proliferating to hypertrophic cartilage cells is established adjacent to the diaphyseal shaft of the bone.

 
In situ hybridization was also used to study LMP-1 expression during fetal skull development, an example of intramembranous bone formation whereby bone is formed directly without a cartilage interphase. LMP-1 expression was detected in the cranium in the membranous bones such as the palatine and nasal bones (Fig. 4Go, H, I, and J). In addition, LMP-1 transcripts were found in mesoderm-derived bones of the skull base and neural crest-derived endochondral bones such as the proximal mandible (Fig. 4Go, I and K).

LMP-1 is an essential positive regulator of osteoblast differentiation
To explore the potential functional role of LMP-1 during membranous bone formation, we synthesized an antisense oligonucleotide to block LMP-1 mRNA translation and treated secondary osteoblast cultures that were undergoing differentiation initiated by glucocorticoid. LMP-1 antisense oligonucleotide inhibited mineralized nodule formation and osteocalcin secretion (measured 14 days later) in a dose-dependent manner (Fig. 5Go) similar to the effect of BMP-6 oligonucleotide (4). The LMP-1 antisense block in osteoblast differentiation could not be rescued by addition of exogenous BMP-6 (50 ng/ml for 6 days), whereas the BMP-6 antisense oligonucleotide inhibition was overcome, by addition of BMP-6, to 84% of GC-stimulated levels (data not shown). This experiment further confirmed the downstream position of LMP-1 relative to BMP-6 in the osteoblast differentiation pathway.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Blocking the translation of either LMP-1 or BMP-6 mRNA inhibited GC-stimulated osteoblast differentiation. Treatment with antisense oligonucleotide (0.4 µM) to either LMP-1 or BMP-6 resulted in complete inhibition of osteoblast differentiation in as measured by bone nodule formation (A) or osteocalcin secretion (B). Nonsense oligonucleotide = filled bars, BMP-6 antisense oligonucleotide = open bars, LMP-1 antisense oligonucleotide = hatched bars. Cultures treated with glucocorticoid alone (no DNA) resulted in 172 ± 11 nodules and 64 ± 6 pmol/ml of osteocalcin secreted.

 
LMP-1 antisense oligonucleotide also inhibited spontaneous osteoblast differentiation in primary rat osteoblast cultures. Primary osteoblasts differentiate in culture without growth factor or hormonal stimulation, requiring only the presence of 50 µg/ml ascorbic acid during the first week postproliferation and 5 mM ß-glycerol phosphate during the second week (19, 20). Antisense or sense oligonucleotides (0.4 µM) to LMP-1 and BMP-6 were applied during the final 3 days of proliferation and during the first 4 days of differentiation. Nodule number and osteocalcin secretion, measured after 14 days of differentiation, were reduced at least 80% by antisense, but not nonsense, oligonucleotide treatment (data not shown).

LMP-1 Overexpression induces osteoblast differentiation in vitro via secretion of a soluble factor
From the experiments described above, we concluded that LMP-1 was necessary for osteoblast differentiation. We then performed experiments to determine if forced expression of LMP-1 could enhance GC-stimulated bone formation. We therefore cloned the LMP-1 cDNA into a pCMV expression vector in the forward and reverse (control) orientations. Overexpression of pCMV-LMP-1 in secondary fetal calvarial cells stimulated with GC resulted in a 3- to 5-fold enhancement of mineralized nodule formation and osteocalcin secretion (Fig. 6Go, A–D).



View larger version (123K):
[in this window]
[in a new window]
 
Figure 6. Overexpression of LMP-1 enhanced GC-stimulated osteoblast differentiation and caused de novo osteoblast differentiation in unstimulated cultures. A, Effect of increasing the amount of pCMV2-LMP-1 applied to each culture on GC-stimulated osteoblast differentiation as measured by nodule number (filled bars) and osteocalcin secretion (open bars). Application of 3 µg pCMV2-LMP-1/well enhanced the GC effect at least 4-fold. Addition of 3 or 30 µg/well of pCMV2-LMP-1-reverse had no effect on either endpoint. B–D, Photographs (4x magnification) taken on day 12 of 1 nM GC-stimulated (B), GC + 9 µg pCMV2-LMP-1-reverse-stimulated (control, C), or GC + 9 µg pCMV2-LMP-1-forward-stimulated (D) cultures. Note the increased mineralization of cultures overexpressing pCMV-LMP-1-forward (D) compared with GC stimulated cultures (B). All cultures received equal amount of transfection agent. E, Effect of increasing the amount of pCMV2-LMP-1 applied to each culture on de novo osteoblast differentiation measured as in 4A. Application of 3 µg pCMV2-LMP-1-forward/well increased both endpoints at least 30-fold. Note that the result of LMP-1 expression mimics that of GC-stimulated expression. Addition of 3 or 30 µg/well of pCMV2-LMP-1-reverse had no effect on either endpoint. F–H, Photographs taken on day 14 of cultures that were not stimulated (F), treated with 9 µg pCMV2-LMP-1-reverse (control, G), or 9 µg pCMV2-LMP-1 (H). Note the presence of mineralized nodules in cultures expressing LMP-1 (H), but not in untreated cultures (F).

 
We then sought to determine whether LMP-1 overexpression was sufficient to induce osteoblast differentiation de novo in the absence of a glucocorticoid or exogenous BMP stimulation. Overexpression experiments repeated in secondary osteoblast cultures in the absence of glucocorticoid demonstrated that LMP-1 overexpression could initiate complete osteoblast differentiation de novo (Fig. 6Go, E–H) comparable with that induced by glucocorticoid. Control cultures treated with overexpression of LMP-1 in the reverse orientation or the empty vector did not undergo osteoblast differentiation. Western blot analysis of cellular protein confirmed a 50-fold induction of LMP-1 protein 72 h after application of LMP-1 cDNA. The induction of osteoblast differentiation by LMP-1 overexpression was blocked by treatment with LMP-1 antisense oligonucleotide confirming the functional importance of LMP-1 expression. Osteoblast cultures were exposed to 3 µg pCMV2-LMP-1 and treated for 7 days with 1 µM antisense oligonucleotide to LMP-1 or nonsense oligonucleotide for the next 7 days. The LMP-1 antisense oligonucleotide completely inhibited osteocalcin secretion and mineralized nodule formation measured on day 14, whereas the nonsense oligonucleotide had no apparent effect on the GC-stimulated differentiation (Fig. 7Go). RT-PCR demonstrated consistent high levels of LMP-1 PCR product even in the presence of LMP-1 antisense oligonucleotide, suggesting that the oligonucleotide inhibition was not due to nonspecific cell toxicity. In addition, Western blot analysis confirmed that the LMP-1 antisense oligonucleotide inhibited LMP-1 protein synthesis (Fig. 7Go, inset).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7. LMP-1 antisense oligonucleotide inhibits nodule formation in rat osteoblast cultures and down regulates LMP-1 protein expression. LMP-1 was overexpressed (OE) in untreated secondary osteoblast cultures as described in the Materials and Methods to stimulate osteoblast differentiation. LMP-1 nonsense (NS) or antisense (AS) oligonucleotides were added with media changes for 7 days. LMP-1 NS (1.0 µM) did not inhibit mineralized bone nodule formation in these cultures nor did it reduce LMP-1 antigen expression (Western blot, inset). LMP-1 AS oligonucleotide (1.0 µM), in contrast, inhibited bone nodule formation >99% and reduced the amount of LMP-1 protein expression (>80%) seen in these cultures (inset).

 
The profound bone induction response was somewhat surprising given our previous experience with low transfection efficiency in osteoblast cultures. We thus hypothesized that LMP-1, which is not a secreted protein, induced a soluble protein or proteins in the transfected cells that could affect neighboring cells in the culture. This hypothesis was confirmed by demonstrating that conditioned medium induced differentiation and nodule formation in unstimulated cells (no GC treatment) (Fig. 8Go). A time course analysis suggested that at least 72 h were required for the LMP-1 transfected cells to condition the medium. The enhancement of differentiation by conditioned medium mimicked the effect caused by overexpression of LMP-1.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 8. Conditioned medium from cultures overexpressing LMP-1 induced differentiation of unstimulated secondary osteoblast cultures. Medium was harvested from cultures overexpressing LMP-1 for the indicated times (6–120 h) and applied to untreated cultures for 4 days. The conditioned medium was the most osteoinductive after 96 h of LMP-1 overexpression.

 
Conditioned medium from cells overexpressing LMP-1 was also able to restore differentiation in secondary osteoblast cultures that were blocked with LMP-1 antisense oligonucleotide (0.4 µM) for 7 days. The oligonucleotide treatment reduced the number of mineralized nodules from 468 ± 7 in control cultures stimulated by GC to 2 ± 1 (P < 0.0001). Conditioned medium from cells transfected with LMP-1 cDNA restored differentiation to 450 ± 8 nodules, whereas conditioned medium from cells transfected with the reverse orientation LMP-1 cDNA (control) only formed 6 ± 2 nodules (P < 0.0001). The effect of the conditioned medium was not due to LMP-1 protein because we have earlier demonstrated that LMP-1 is only found intracellularly and not in the medium. The effect of the conditioned medium was also not due to residual pCMV-LMP-1 because it was washed off after application and the presence of LMP-1 antisense oligonucleotide in the cultures would block expression if any plasmid were present (Fig. 7Go). This conditioned medium experiment designed to rescue osteoblast differentiation confirmed the lack of toxicity of the LMP-1 antisense oligonucleotide treatment and further strengthened the evidence for the existence of a secreted factor.

Bone marrow cells transfected with LMP-1 cDNA induce fone formation in vivo
To determine if expression of LMP-1 could induce bone in vivo, we transfected bone marrow cells with pCMV-LMP-1 and implanted them on devitalized bone matrix placed on the chest of athymic rats. Radiographs of explants at 4 weeks revealed extensive bone formation in the implants which contained cells transfected with the LMP-1 gene in the forward orientation, whereas cells transfected with the reverse-oriented LMP-1 cDNA failed to form bone (Fig. 9Go, A and B). In 16 animals, 16/16 implants containing cells transfected with the LMP-1 (forward) cDNA induced bone formation, whereas none (0/16) of the implants containing cells with the control cDNA induced bone. Histology revealed new bone trabeculae lined with osteoblasts in the LMP-1-transfected implants and absence of new bone with partial resorption of the carrier in the controls (Fig. 9Go, C–F). These studies demonstrate the feasibility of local gene therapy using the LMP-1 gene to induce new bone formation in vivo.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 9. LMP-1 initiated de novo bone formation in vivo. A and B, Radiographs of devitalized bone matrix explant which contained marrow cells transfected with pCMV2-LMP-1 (A) or control (B) cDNA 4 weeks after sc implantation on the chest of an athymic rat. Note the explant with the pCMV2-LMP-1 cDNA formed a nodule of bone, shown in A, while the explant with control cDNA did not form a bone nodule, as shown in B. D and E, Medium power histologic sections (33x) of explants shown in radiographs above. A mature ossicle of newly formed cancellous bone (C) was found in the explant that contained cells transfected with the pCMV2-LMP-1 cDNA, while the control explant did not demonstrate any new bone formation and partially resorbed devitalized bone matrix carrier was seen (D). Newly formed bone was stained blue, unmineralized osteoid and devitalized bone matrix were stained red. E and F, High power histologic sections (132x) of explants from a similar experiment as above. Explants that contained cells transfected with pCMV-LMP-1 (E) demonstrated bony trabeculae (b) with active osteoblasts (ob) producing unmineralized osteoid (o) matrix and elements of bone marrow (m). In addition, osteoclasts (oc) were seen remodeling the primary trabeculae. In contrast, explants that contained cells transfected with pCMV-LMP-1-reverse (control) demonstrated the original pieces of devitalized bone matrix carrier (pink) remained with minimal cellular infiltration and no new bone induction.

 
LMP-1 induces genes known to be important regulators of osteoblast differentiation
Although the precise downstream mechanism of action for LMP-1 is not known, we have observed a 30-fold increase in BMP-2 mRNA and a 38-fold increase in protein levels 7 days posttransfection. LMP-1 overexpression also resulted in a 5-fold increase in levels of mRNA for the recently described osteoblast transcription factor core binding factor a-1 (cbfa1), which is one of the earliest osteoblastic markers in embryogenesis (21). Cbfa1 message is induced by BMP-7 before osteocalcin expression in transformed cells (22). cbfa1 mRNA is constitutively expressed in our osteoblast culture system and is necessary for osteoblast differentiation and formation of mineralized nodules, which is consistent with recent data from transgenic mice (23). Inhibition of cbfa1 translation on days 1–14 blocked formation of nodules normally induced by GC, BMP-6, or LMP-1 overexpression in secondary osteoblast cultures. When cbfa-1 translation was inhibited later in the culture period, mineralization of prenodules was blocked (data not shown). These results suggest that the transcription factor cbfa-1 is regulated by LMP-1 and, like LMP-1, is required for osteoblast differentiation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LMP-1 is a novel rat LIM domain protein up-regulated in osteoblasts during embryonic bone formation. LMP-1 transcripts are first detectable in the mesenchymal cells surrounding the hypertrophic cartilage cells in developing long bones just before osteoblastic invasion of the cartilage anlage. This intracellular protein is also up-regulated transiently in calvarial osteoblasts in vitro during the early stages of the osteoblast differentiation program.

Transient expression of an antisense LMP-1 construct in rat osteoblast cells suppresses LMP-1 expression and prevents osteoblast differentiation in these cells. In addition, forced overexpression of LMP-1 in osteoblast cultures enhances ongoing differentiation and induces de novo differentiation of resting (unstimulated) osteoblast cultures. The in vitro effects are easily replicated in vivo, as demonstrated by ectopic bone formation in rats, even with relatively poor gene transfection efficiency. These profound physiologic effects are most likely facilitated by the secretion of a soluble factor induced by LMP-1 expression.

Role of LMP-1 in bone formation
LMP-1 appears to be involved with both of the two fundamental mechanisms of bone formation. During membranous bone formation (seen in embryonic flat bones such as the mandible and cranium), osteoblasts differentiate, mature, and synthesize bone matrix which mineralizes. This is the type of direct bone formation most closely simulated by our osteoblast culture systems. In endochondral bone formation (seen in embryonic long bone development and recapitulated postnatally during fracture repair), chondrocytes proliferate, hypertrophy, and by some unknown mechanism initiate the ingrowth of blood vessels and osteoblast precursors resulting in a conversion of the cartilage matrix to trabecular bone. This later bone formation phase of endochondral ossification is similar to membranous bone formation.

BMP-6 is known to be expressed in hypertrophic chondrocytes, but its precise role has been unclear. The expression patterns of BMP-6 and LMP-1 suggest that the BMP-6 secreted by the long bone hypertrophic chondrocytes may induce the expression of LMP-1 in perichondral cells. The expression of LMP-1 in perichondral cells at e15 with subsequent expression in cells within the primary ossification center at e17 implies that LMP-1 in perichondral cells may facilitate the migration of osteoblastic cells into the primary ossification center. LMP-1 may represent a critical signal involved in coordinating the linkage between cartilage maturation and initiation of bone formation. Thus, BMP-6, acting through LMP-1, seems to provide an important signal to initiate membranous bone formation, the final phase of endochondral ossification. The expression of LMP-1 in bones of neural crest and mesoderm origin, as well as in both intramembranous and endochondral bone suggests that LMP-1 may be involved in a final common pathway of bone formation.

Possible mechanism of action of LMP-1
The data presented here strongly support a critical role of LMP-1 in the regulation of the complex program of osteoblast differentiation. The association of LMP-1 with other proteins known to be important to bone formation enables us to begin to build a more complete temporal sequence of events comprising the pathway of osteoblast differentiation. The observation that LMP-1 is regulated by BMP-6 and not by BMP-2 or BMP-4 is consistent with its unique role early in osteoblast differentiation because BMP-6 is the earliest of these three BMPs to be expressed during differentiation in our culture system and in vivo (4, 24).

Given the small number of cells actually transfected, the striking physiologic effects suggest that overexpression of LMP-1 results in the synthesis of an unidentified soluble factor or factors which act on cells in the osteoblast lineage causing them to differentiate and secrete BMP-2, a growth factor whose effects are well documented in the osteoinductive process (25, 26). The secretion of a soluble factor was confirmed by the conditioned medium experiments. In addition, the finding that LMP-1 up-regulates the recently described osteoblast transcription factor cbfa1 is further evidence for the vital role of this LIM protein.

The precise intracellular mechanism of action of LMP-1 is unknown. This protein appears to activate an intracellular switch that induces secretion of soluble factors that initiate and promote osteoblast differentiation during embryogenesis and adult bone formation. LMP-1, stimulated by BMP-6, may initiate the transition from hypertrophic cartilage to primary bone formation during endochondral ossification. Because this protein is also involved in membranous bone formation, it may be part of a final common pathway linking the processes of endochondral and membranous ossification. Studies are underway to further elucidate the relationship of LMP-1 with bone formation, BMP signaling, and the function of LMP-1 in tissues other than bone.


    Acknowledgments
 
The authors are indebted to Paul Farmer for assistance with the in vitro translation, James McNeil for assistance with animal surgery and aftercare, and Christine Anderson for performing RT-PCR. We are especially grateful to Cynthia Baranowski for excellent technical assistance with preparation of the histologic sections.


    Footnotes
 
1 These authors contributed equally to this work. Back

Received May 15, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hogan BLM 1996 Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10:1580–1594[Free Full Text]
  2. Kingsley DM 1994 What do BMPs do in mammals? Clues from the mouse short-ear mutation. Trends Genet 10:16–21[CrossRef][Medline]
  3. Boden SD, McCuaig K, Hair G, Racine M, Titus L, Wozney JM, Nanes MS 1996 Differential effects and glucocorticoid potentiation of bone morphogenetic protein action during rat osteoblast differentiation in vitro. Endocrinology 137:3401–3407
  4. Boden SD, Hair G, Titus L, Racine M, McCuaig K, Wozney JM, Nanes MS 1997 Glucocorticoid-induced differentiation of fetal rat calvarial osteoblasts is mediated by BMP-6. Endocrinology 138:2920–2928
  5. Way JC, Chalfie M 1988 Mec-3, a homeobox-containing gene that specifies the differentiation of the touch receptor neurons in C. elegans. Cell 54:5–16[CrossRef][Medline]
  6. Karlsson O, Thor S, Norberg T, Ohlsson H, Edlund T 1990 Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeodomain and a Cys-His domain. Nature 344:879–882[CrossRef][Medline]
  7. Freyd G, Kim SK, Horvitz HR 1990 Novel cysteine-rich motif and homeodomain in the product of the Caenorhabditis elegans cell lineage gene lin-II. Nature 344:876–879[CrossRef][Medline]
  8. Nanes MS, Rubin J, Titus L, Hendy GN, Catherwood BD 1990 {alpha}-Interferon inhibits 1,25-Dihydroxyvitamin D3 stimulated synthesis of bone gla protein in rat osteosarcoma cells by a pretranslational mechanism. Endocrinology 127:588–594[Abstract/Free Full Text]
  9. Towbin H, Staehelin T, Gordon J 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedures and some applications. Proc Natl Acad Sci 76:4350–4354[Abstract/Free Full Text]
  10. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 7–19
  11. Dawid IB, Toyama R, Taira M 1995 LIM domain proteins. C R Acad Sci Paris 318:295–306
  12. Sadler I, Crawford AW, Michelsen JW, Beckerle MC 1992 Zyxin and cCRP: Two interactive LIM domain proteins associated with the cytoskeleton. J Cell Biol 119:1573–1587[Abstract/Free Full Text]
  13. Dawid IB, Breen JJ, Toyama R 1998 LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet 14:156–162[CrossRef][Medline]
  14. Wang M, Drucker DJ 1994 The LIM domain homeobox gene isl-1:Conservation of human, hamster, and rat complementary deoxyribonucleic acid sequences and expression in cell types of nonneuroendocrine lineage. Endocrinology 134:1416–1422[Abstract/Free Full Text]
  15. Wu R, Durick K, Songyang Z, Cantley LC, Taylor SS, Gill GN 1996 Specificity of LIM domain interactions with receptor tyrosine kinases. J Biol Chem 271:15934–15941[Abstract/Free Full Text]
  16. Wu R, Gill GN 1994 LIM domain recognition of a tyrosine-containing tight turn. J Biol Chem 269:25085–25090[Abstract/Free Full Text]
  17. Kuroda S, Tokunaga C, Kiyohara Y, Higuchi O, Konishi H, Mizuno K, Gill GN, Kikkawa U 1996 Protein-protein interaction of zinc finger LIM domains with protein kinase C. J Biol Chem 271:31029–31032[Abstract/Free Full Text]
  18. Lyons KM, Pelton RW, Hogan BLM 1989 Patterns of expression of murine Vgr-1 and BMP-2a RNA suggest that transforming growth factor-ß like genes coordinately regulate aspects of embryonic development. Genes Dev 3:1657–1668[Abstract/Free Full Text]
  19. Aronow MA, Gerstenfeld LC, Owen TA, Tassinari MS, Stein GS, Lian JB 1990 Factors that promote progressive development of the osteoblast phenotype in cultured rat calvarial cells. J Cell Physiol 143:213–221[CrossRef][Medline]
  20. Bellows CG, Aubin JE, Heersche JNM, Antosz ME 1986 Mineralized bone nodules formed in vitro from enzymatically released rat calvaria cell populations. Calcif Tissue Int 38:143–154[Medline]
  21. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GWH, Beddington RSP, Mundlos S, Olsen BR, Selby PB, Owen MJ 1997 Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89:765–771[CrossRef][Medline]
  22. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G 1997 Osf2/Cbfa1:A transcriptional activator of osteoblast differentiation. Cell 89:747–754[CrossRef][Medline]
  23. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao Y, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T 1997 Targeted disruption of cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755–764[CrossRef][Medline]
  24. Morone MA, Boden SD, Martin G, Hair G, Titus L 1998 Gene expression during autograft posterolateral lumbar spine fusion. Clin Orthop
  25. Wang EA, Rosen V, D’Alessandro JS, Bauduy M, Cordes P, Harada T, Israel DI, Hewick RM, Kerns KM, LaPan P, Luxenberg DP, McQuaid D, Moutsatsos IK, Nove J, Wozney JM 1990 Recombinant human bone morphogenetic protein induces bone formation. Proc Natl Acad Sci 87:2220–2224[Abstract/Free Full Text]
  26. Schimandle JH, Boden SD, Hutton WC 1995 Experimental spinal fusion with recombinant human bone morphogenetic protein-2 (rhBMP-2). Spine 20:1326–1337



This article has been cited by other articles:


Home page
Bioscience HorizonsHome page
D. Ireland
Molecular mechanisms involved in intervertebral disc degeneration and potential new treatment strategies
Bioscience Horizons, March 1, 2009; 2(1): 83 - 89.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
T. Camarata, B. Bimber, A. Kulisz, T.-L. Chew, J. Yeung, and H.-G. Simon
LMP4 regulates Tbx5 protein subcellular localization and activity
J. Cell Biol., July 31, 2006; 174(3): 339 - 348.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Sangadala, S. D. Boden, M. Viggeswarapu, Y. Liu, and L. Titus
LIM Mineralization Protein-1 Potentiates Bone Morphogenetic Protein Responsiveness via a Novel Interaction with Smurf1 Resulting in Decreased Ubiquitination of Smads
J. Biol. Chem., June 23, 2006; 281(25): 17212 - 17219.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. Loughran, N. C. Healy, P. A. Kiely, M. Huigsloot, N. L. Kedersha, and R. O'Connor
Mystique Is a New Insulin-like Growth Factor-I-regulated PDZ-LIM Domain Protein That Promotes Cell Attachment and Migration and Suppresses Anchorage-independent Growth
Mol. Biol. Cell, April 1, 2005; 16(4): 1811 - 1822.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
A. Minamide, S. D. Boden, M. Viggeswarapu, G. A. Hair, C. Oliver, and L. Titus
Mechanism of Bone Formation with Gene Transfer of the cDNA Encoding for the Intracellular Protein LMP-1
J. Bone Joint Surg. Am., May 28, 2003; 85(6): 1030 - 1039.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
D. Hannallah, B. Peterson, J. R. Lieberman, F. H. Fu, and J. Huard
Gene Therapy in Orthopaedic Surgery
J. Bone Joint Surg. Am., June 1, 2002; 84(6): 1046 - 1061.
[Full Text]


Home page
J. Biol. Chem.Home page
Y. G. Amaar, G. R. Thompson, T. A. Linkhart, S.-T. Chen, D. J. Baylink, and S. Mohan
Insulin-like Growth Factor-binding Protein 5 (IGFBP-5) Interacts with a Four and a Half LIM Protein 2 (FHL2)
J. Biol. Chem., March 29, 2002; 277(14): 12053 - 12060.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
M. Viggeswarapu, S. D. Boden, Y. Liu, G. A. Hair, J. Louis-Ugbo, H. Murakami, H. S. Kim, M. T. Mayr, W. C. Hutton, and L. Titus
Adenoviral Delivery of LIM Mineralization Protein-1 Induces New-Bone Formation in Vitro and in Vivo
J. Bone Joint Surg. Am., March 1, 2001; 83(3): 364 - 364.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
L. Gilbert, X. He, P. Farmer, S. Boden, M. Kozlowski, J. Rubin, and M. S. Nanes
Inhibition of Osteoblast Differentiation by Tumor Necrosis Factor-{alpha}
Endocrinology, November 1, 2000; 141(11): 3956 - 3964.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Vallenius, K. Luukko, and T. P. Makela
CLP-36 PDZ-LIM Protein Associates with Nonmuscle alpha -Actinin-1 and alpha -Actinin-4
J. Biol. Chem., April 6, 2000; 275(15): 11100 - 11105.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boden, S. D.
Right arrow Articles by Titus, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boden, S. D.
Right arrow Articles by Titus, L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals