| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
: Structure and Expression1
Department of Molecular & Integrative Physiology (G.D., B.M.C., B.L., K.E.O., D.W., M.J.S.), University of Kansas Medical Center, Kansas City, Kansas 66160; Section of Medical Genetics and Molecular Medicine (R.A.W., B.P.), Childrens Mercy Hospital, Kansas City, Missouri 64108
Address all correspondence and requests for reprints to: Michael J. Soares, Ph.D., Department of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, Kansas 66160-7401. E-mail: msoares{at}kumc.edu
| Abstract |
|---|
|
|
|---|
,
characterize its complementary DNA and gene, and map its chromosomal
location and pattern of expression during pregnancy. Mouse PLP-C
encodes for a 239 amino acid protein and possesses from 6971%
identity with rat PLP-C, PLP-Cv, PLP-D, and PLP-H. Another feature
characteristic of PLP-C subfamily members that is also present in mouse
PLP-C
is a 6-exon/5-intron gene structure including an aromatic
domain encoded by exon 3. Southern analysis with mouse and rat PLP-C
subfamily probes suggested the existence of a single mouse PLP-C
gene. Mouse PLP-C
maps to chromosome 13 along with other members of
the mouse PRL family. Expression of mouse PLP-C
increases
dramatically as gestation advances and is restricted to
spongiotrophoblast and trophoblast giant cells of the junctional zone.
In summary, we have established the presence of a new PLP-C subfamily
member in the mouse and demonstrated its similarity in structure and
expression to rat PLP-C subfamily members. This level of conservation
between species expands the biological significance of the PLP-C
subfamily and provides additional opportunities for genetically
evaluating its function. | Introduction |
|---|
|
|
|---|
Members of the PRL family can be divided into classical and nonclassical categories based on their biological activity (1). Classical PRL family members, including PRL, placental lactogen-I (PL-I), PL-I variant (PL-Iv), and PL-II, bind the PRL receptor and stimulate PRL-like bioactivities. The PLP-C subfamily is included in the nonclassical category because its members do not use the PRL receptor signaling pathway (11, 12, 13). Only limited information is available on possible cellular targets for some members of the rat PLP-C subfamily (13, 14).
Understanding the physiology of the PLP-C subfamily and other
nonclassical PRL family members would be significantly advanced by the
availability of a mouse model and the application of gene manipulation
strategies. In this study, we establish the presence of a new member of
the PLP-C family in the mouse, PLP-C
, characterize its complementary
DNA (cDNA) and gene, and map its chromosomal location and pattern of
expression during pregnancy.
| Materials and Methods |
|---|
|
|
|---|
Animals and tissue preparation
CD-1 mice were obtained from Charles River Laboratories, Inc. (Wilmington, MA). The animals were housed in an
environmentally controlled facility, with lights on from 06002000 h
and allowed free access to food and water. Timed pregnancies were
generated and tissue dissections were performed as previously described
(15). The presence of a copulatory plug was designated day 1 of
pregnancy. Protocols for the care and use of animals were approved by
the University of Kansas Animal Care and Use Committee.
Cloning and characterization of the PLP-C
cDNA
Total RNA was extracted with TRIzol reagent from mouse placental
tissues isolated from day 19 of pregnancy. Five micrograms of total RNA
and 0.5 µg of oligo (deoxythymidine) were used for the RT reaction.
PCR reactions were performed using Pfu polymerase with a set
of primers based on the rat PLP-Cv cDNA sequence (5' primer: 5'
AGAACTCATCCTGCTTAGGAA 3'; 3' primer: 5' GCATAGCCCAAGCAGACATAA 3') for
30 cycles (denature, 94 C for 1 min; anneal, 60 C for 2 min; extension,
72 C for 2 min). The amplified product was subcloned into pCR2.1-TOPO
vector flanked by M13 reverse primer and T7 promoter with the TOPO TA
Cloning kit. DNA sequencing was performed using an PE Applied Biosystems Model 310 sequencer and PE Applied Biosystems Dye Terminator Cycle Sequencing kits (Foster City,
CA). Both strands of the cDNAs were completely sequenced. Comparisons
of PLP-C
with other members of the PRL family were performed with
CLUSTAL W (version 1.6, European Molecular Biology Laboratory,
Heidelberg, Germany, 16).
Isolation and characterization of the PLP-C
gene
A genomic DNA library generated from a 129/SvEv mouse strain
liver and packaged in the Lambda FIX II vector was a generous gift of
Lexicon Genetics, Inc. (Houston, TX). Approximately, 1 x
106 pfu were screened with a mouse PLP-C
cDNA as
previously described (5). Three positive clones obtained were
amplified. Integrity of the clones was verified by PCR with primers
originally used to clone the PLP-C
cDNA. One of the two full length
clones was used to inoculate LE392 Escherichia coli. A
series of forward and reverse oligonucleotide primer sets based on the
mouse PLP-C
cDNA were designed and used to sequence exons and
exon-intron boundaries. These primers were also used to estimate 5' and
3' flanking DNA and intron sizes by PCR analysis and agarose
electrophoresis. DNA sequencing was performed using an PE Applied Biosystems Model 310 sequencer and PE Applied Biosystems Dye Terminator Cycle Sequencing kits (Foster City,
CA).
Southern blot analysis
Genomic DNA was isolated from mouse liver and individually
digested with BamHI, EcoRI, or
HindIII. Digested samples were electrophoretically separated
in 0.8% agarose gels, transferred to nylon membranes, and probed with
[32P]-labeled mouse PLP-C
, rat PLP-C, or rat PLP-Cv
cDNAs. Hybridizations were performed in hybridization buffer (50%
formamide, 6 x SSPE, 5 x Denhardts reagent, 1% SDS, and
100 µg/ml salmon sperm DNA) at 42 C overnight. Membranes were washed
under low stringency conditions consisting of two 15 min washes in
7 x SSPE with 0.1% SDS at room temperature followed by two
15-min washes in 1 x SSPE with 0.5% SDS solution at 37 C.
Chromosomal assignment of the mouse PLP-C
gene
Chromosomal mapping of the mouse PLP-C
gene was determined
using The Jackson Laboratory Interspecific Backcross Panel
(17). Genomic DNAs from C57BL/6J, Mus spretus and a
(M. spretus x C57BL/6J)F1 x M.
spretus (BSS type) backcross were analyzed by Southern blotting as
previously described (18). Approximately 5 µg of genomic DNAs from
the C57BL6/J and M. spretus progenitors were digested with
28 different restriction enzymes to find a suitable restriction
fragment length variation (RFLV) for mapping. Southern blots were
probed with the mouse PLP-C
cDNA. Approximately 2 µg of DNA from
the BSS type backcross panel were digested for each sample with
BclI overnight. Segration of alleles was compared with other
loci from a database at The Jackson Laboratory Backcross
DNA map Panel Service (17).
Analysis of PLP-C
expression
Northern blot analysis. Northern blots were performed as
previously described in our laboratory (19, 20). RNA was extracted from
tissues essentially as described by Chomczynski and Sacchi (21), using
TRIzol. Total RNA (15 µg) was separated on a 1% agarose gel and
transferred to a nylon membrane. Blots were probed with
[32P]-labeled mouse PLP-C
cDNA. The ribosomal protein
L7 (rpL7) control probe was generated by PCR (22). Specific
oligonucleotide primers amplified a 246 bp rpL7 fragment that was
random primer labeled using Klenow and [32P]-dATP.
In situ hybridization
PLP-C
messenger RNA (mRNA) was detected in frozen tissue
sections as previously described (19, 23). The full-length mouse
PLP-C
cDNA was subcloned into pGEM-T vector flanked by T7
and SP6 promoters, linearized, and used as a template for
the synthesis of [35S]-labeled sense and antisense RNA
probes.
| Results |
|---|
|
|
|---|
cDNA and gene characterization
, because of its
significant homology with all members of the PLP-C subfamily but lack
of additional overall homology with any one member. Based on homology
with the rat PLP-C protein, it was determined that the mouse PLP-C
contains a 29 amino acid signal peptide (2). The mature mouse PLP-C
encodes for a protein with a number of features similar to other
members of the PLP-C subfamily including a homologously positioned
putative N-linked glycosylation site and six homologously situated
cysteine residues, and the characteristic 14 amino acid aromatic domain
(Fig. 2
|
|
|
cDNA was then used to screen a mouse genomic library
resulting in the identification of three positive phage clones. One of
the two full length clones was further characterized by restriction
enzyme mapping, PCR, and sequencing. The PLP-C
gene has a
6-exon/5-intron gene organization (Figs. 2
(Fig. 4
gene.
|
|
cDNA was used to determine the chromosomal
location of the gene encoding PLP-C
by analyzing the segregation of
a BclI RFLV in genomic DNAs derived from the offspring of a
(M. spretus x C57BL/6J)F1 x M.
spretus backcross. The gene symbol, Prlpc, has been
assigned to the mouse PLP-C
locus and has been approved by the
International Mouse Nomenclature Committee. A BclI RFLV for
Prlpc was identified by the presence of a 2.6 kb genomic DNA
fragment in C57BL/6J or the presence of a 3.3 kb fragment in M.
spretus (Fig. 5A
|
PLP-C
expression patterns
The tissue distribution of mouse PLP-C
mRNA was
determined by Northern blot analysis (Fig. 6
). PLP-C
expression was detected in
chorioallantoic placental tissues from days 13, 16, and 19 of
pregnancy. Expression of PLP-C
increased progressively from
midgestation to the end of pregnancy. PLP-C
transcripts were not
detected in mouse deciduoma, brain, thymus, heart, lung, diaphragm,
liver, spleen, kidney, or ovary. This pattern of expression is
identical to the expression patterns of rat PLP-C and PLP-Cv (5).
Integrity of the RNA was verified by hybridization with the rpL7
probe.
|
in mouse uteroplacental tissues from day 8 to
day 19 of gestation. PLP-C
mRNA was localized to spongiotrophoblast
and trophoblast giant cells from the junctional zone of the
chorioallantoic placenta (Fig. 7
hybridization signals increased
in intensity as gestation progressed (data not shown). Sense probes did
not exhibit significant hybridization with the placental tissues (Fig. 7
mRNA is identical to the
intraplacental site of expression for rat PLP-C subfamily members:
PLP-C, PLP-D, and PLP-H (2, 3, 6, 7).
|
| Discussion |
|---|
|
|
|---|
because of
its significant homology with all members of the rat PLP-C subfamily
but lack of additional overall homology with any one member. Mouse
PLP-C
is similar to its rat counterparts in sequence, gene
structure, tissue distribution, and temporal expression patterns (2, 3, 5, 6, 7).
Structural features of the mouse PLP-C
gene are consistent with its
inclusion in the PLP-C subdivision of the PRL gene family. Mouse
PLP-C
possesses a 6-exon/5-intron organization that is typical of
other PLP-C subfamily members (5, 20) but differs from the
5-exon/4-intron pattern shared by other PRL family members (PRL, PL-II,
and proliferin genes; 2430). The additional exon is situated
between exons 2 and 3 of the prototypical PRL gene structure and codes
for a well conserved aromatic domain that is a feature of all PLP-C
subfamily members (2, 3, 5, 6, 7) and the more distantly related
proliferin-related protein (31). The aromatic domain and other
commonalities among PLP-C subfamily members are apparent; however, a
true appreciation of their structural and functional relevance awaits
discovery of the biological actions of these orphan ligands.
The mouse PLP-C
gene, Prlpc, maps to mouse chromosome
13 along with other members of the mouse PRL family (8, 9, 32, 33). The
accumulation of data regarding the clustering of PRL family members on
the same chromosome supports the hypothesis that individual members
arose from duplication and divergent evolution from a common ancestral
gene (34, 35, 36). The mouse Prlpc locus is closely linked to
the Prl locus which is within a conserved region of homology
with rat chromosome 17 and human chromosome 6. PLP-C subfamily members
have been localized to rat chromosome 17 (3, 4, 5). A human homolog for
the PLP-C subfamily has not been reported. The specific alignments of
PRL family members on chromosome 13 have not been presented; however,
such information may provide some insights regarding the coordinated
patterns of expression for each of the family members.
The tissue-specific and temporal expression pattern of PLP-C
in the
mouse closely parallels expression patterns for its counterparts in the
rat. In both species, spongiotrophoblast cells and trophoblast giant
cells are responsible for the expression of this cohort of ligands (2,
3, 6, 7; present study). Placental expression is initiated at
midgestation and continues until parturition (2, 3, 57; present
study). The high levels of expression and conservation across species
are consistent with the potential physiological importance of PLP-C
during pregnancy.
Relationships between rat and mouse PLP-C subfamilies implies the
existence of differing selective pressures on their origins. The rat
contains four closely related PLP-C subfamily members (PLP-C, PLP-Cv,
PLP-D, and PLP-H), whereas the mouse, at least for now, contains only a
single PLP-C subfamily member (PLP-C
) bearing similarity to these
rat members. As noted above, this mouse PLP-C subfamily member has
approximately similar extents of homology with each of the four rat
PLP-C subfamily members. Furthermore, we have not been able to isolate
specific mouse homologs for rat PLP-C subfamily members other than for
d/tPRP. These observations are somewhat surprising but may suggest
different patterns of evolution for the PLP-C subfamily in the mouse
vs. the rat. It will be of considerable interest to
determine the spectrum of biological roles for each of the PLP-C
subfamily members and to evaluate whether mouse PLP-C
possesses a
broader range of actions that includes the range of actions represented
by the closely related rat PLP-C subfamily (PLP-C, PLP-Cv, PLP-D, and
PLP-H).
In summary, we have identified a new member of the PLP-C family in the
mouse, PLP-C
, characterized its cDNA and gene, and determined its
chromosomal position and pattern of expression during gestation.
Collectively, these findings are significant for two important reasons:
1) the high degree of PLP-C
conservation with members of the rat
PLP-C subfamily implies physiological relevance during pregnancy; and
2) the availability of a mouse model creates new genetic-based
opportunities for studying the physiology of the PLP-C subfamily.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Supported in part by fellowships from the Kansas Health Foundation
and the Lalor Foundation. Present address: Laboratory of Reproductive
Physiology, School of Veterinary Medicine, University of Pennsylvania,
Philadelphia 19104-6009. ![]()
3 Supported in part by a fellowship from the Kansas Health
Foundation. ![]()
Received July 8, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. G. Carter, T. Hamatani, A. A. Sharov, C. E. Carmack, Y. Qian, K. Aiba, N. T. Ko, D. B. Dudekula, P. M. Brzoska, S. S. Hwang, et al. In Situ-Synthesized Novel Microarray Optimized for Mouse Stem Cell and Early Developmental Expression Profiling Genome Res., May 1, 2003; 13(5): 1011 - 1021. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. Wiemers, L.-j. Shao, R. Ain, G. Dai, and M. J. Soares The Mouse Prolactin Gene Family Locus Endocrinology, January 1, 2003; 144(1): 313 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-T. Hwang, Y.-H. Lee, B.-C. Moon, K.-Y. Ahn, S.-W. Lee, and J.-Y. Chun Identification and Characterization of a New Member of the Placental Prolactin-Like Protein-C (PLP-C) Subfamily, PLP-C{beta} Endocrinology, September 1, 2000; 141(9): 3343 - 3352. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Toft and D. I.H. Linzer Identification of Three Prolactin-Related Hormones as Markers of Invasive Trophoblasts in the Rat Biol Reprod, August 1, 2000; 63(2): 519 - 525. [Abstract] [Full Text] |
||||
![]() |
J. T. FASSETT, R. T. HAMILTON, and M. NILSEN-HAMILTON Mrp4, A New Mitogen-Regulated Protein/Proliferin Gene; Unique in this Gene Family for its Expression in the Adult Mouse Tail and Ear Endocrinology, May 1, 2000; 141(5): 1863 - 1871. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Su, S. A. Liebhaber, and N. E. Cooke The Human Growth Hormone Gene Cluster Locus Control Region Supports Position-independent Pituitary- and Placenta-specific Expression in the Transgenic Mouse J. Biol. Chem., March 10, 2000; 275(11): 7902 - 7909. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Toft and D. I. H. Linzer Prolactin (PRL)-Like Protein J, a Novel Member of the PRL/Growth Hormone Family, Is Exclusively Expressed in Maternal Decidua Endocrinology, November 1, 1999; 140(11): 5095 - 5101. [Abstract] [Full Text] |
||||
![]() |
G. Dai, M. W. Wolfe, and M. J. Soares Distinct Regulatory Regions from the Prolactin-Like Protein C Variant Promoter Direct Trophoblast Giant Cell Versus Spongiotrophoblast Cell-Specific Expression Endocrinology, October 1, 1999; 140(10): 4691 - 4698. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |