help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, G.
Right arrow Articles by Soares, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, G.
Right arrow Articles by Soares, M. J.
Endocrinology Vol. 139, No. 12 5157-5163
Copyright © 1998 by The Endocrine Society

ARTICLES

A New Member of the Mouse Prolactin (PRL)-Like Protein-C Subfamily, PRL-Like Protein-C{alpha}: Structure and Expression1

Guoli Dai, Belinda M. Chapman, Bing Liu, Kyle E. Orwig2, Danhua Wang3, Robert A. White, Barry Preuett and Michael J. Soares

Department of Molecular & Integrative Physiology (G.D., B.M.C., B.L., K.E.O., D.W., M.J.S.), University of Kansas Medical Center, Kansas City, Kansas 66160; Section of Medical Genetics and Molecular Medicine (R.A.W., B.P.), Children’s Mercy Hospital, Kansas City, Missouri 64108

Address all correspondence and requests for reprints to: Michael J. Soares, Ph.D., Department of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, Kansas 66160-7401. E-mail: msoares{at}kumc.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we establish the presence of a unique member of the PRL-like protein-C (PLP-C) subfamily in the mouse, PLP-C{alpha}, characterize its complementary DNA and gene, and map its chromosomal location and pattern of expression during pregnancy. Mouse PLP-C{alpha} encodes for a 239 amino acid protein and possesses from 69–71% identity with rat PLP-C, PLP-Cv, PLP-D, and PLP-H. Another feature characteristic of PLP-C subfamily members that is also present in mouse PLP-C{alpha} is a 6-exon/5-intron gene structure including an aromatic domain encoded by exon 3. Southern analysis with mouse and rat PLP-C subfamily probes suggested the existence of a single mouse PLP-C{alpha} gene. Mouse PLP-C{alpha} maps to chromosome 13 along with other members of the mouse PRL family. Expression of mouse PLP-C{alpha} increases dramatically as gestation advances and is restricted to spongiotrophoblast and trophoblast giant cells of the junctional zone. In summary, we have established the presence of a new PLP-C subfamily member in the mouse and demonstrated its similarity in structure and expression to rat PLP-C subfamily members. This level of conservation between species expands the biological significance of the PLP-C subfamily and provides additional opportunities for genetically evaluating its function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE RODENT PRL gene family presently consists of at least 15 different members that are expressed in the pituitary, uterus, and/or placenta (1). A subfamily has been identified that consists of members possessing a 6 exon/5 intron gene structure and is referred to as the PRL-like protein-C (PLP-C) subfamily. In the rat, five members of the PLP-C subfamily have been identified (four close relatives: PLP-C, PLP-Cv, PLP-D, PLP-H; one distant relative: decidual/trophoblast PRL-related protein, d/tPRP), whereas in the mouse only d/tPRP has been isolated (2, 3, 4, 5, 6, 7, 8, 9). These orphan ligands represent major secretory products of the rat placenta during the second half of gestation (10).

Members of the PRL family can be divided into classical and nonclassical categories based on their biological activity (1). Classical PRL family members, including PRL, placental lactogen-I (PL-I), PL-I variant (PL-Iv), and PL-II, bind the PRL receptor and stimulate PRL-like bioactivities. The PLP-C subfamily is included in the nonclassical category because its members do not use the PRL receptor signaling pathway (11, 12, 13). Only limited information is available on possible cellular targets for some members of the rat PLP-C subfamily (13, 14).

Understanding the physiology of the PLP-C subfamily and other nonclassical PRL family members would be significantly advanced by the availability of a mouse model and the application of gene manipulation strategies. In this study, we establish the presence of a new member of the PLP-C family in the mouse, PLP-C{alpha}, characterize its complementary DNA (cDNA) and gene, and map its chromosomal location and pattern of expression during pregnancy.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
All restriction enzymes, polymerases, and DNA ligase were purchased from New England Biolabs, Inc. (Beverly, MA). DNA extraction kits were purchased from Quiagen (Chatsworth, CA). Nitrocellulose and nylon membranes were obtained from Schleicher & Schuell, Inc. (Keene, NH). Radiolabeled nucleotides were purchased from DuPont NEN (Boston, MA). Prime-it random primer labeling kits and Pfu polymerase were obtained from Stratagene (La Jolla, CA). TRIzol Reagent for RNA extraction, oligonucleotide primers, and SuperScript cDNA synthesis kits were obtained from Life Technologies (Gaithersburg, MD). TOPO TA Cloning kits were purchased from Invitrogen (San Diego, CA). Unless otherwise noted, all chemicals and reagents were purchased from Sigma Chemical Co. (St. Louis, MO).

Animals and tissue preparation
CD-1 mice were obtained from Charles River Laboratories, Inc. (Wilmington, MA). The animals were housed in an environmentally controlled facility, with lights on from 0600–2000 h and allowed free access to food and water. Timed pregnancies were generated and tissue dissections were performed as previously described (15). The presence of a copulatory plug was designated day 1 of pregnancy. Protocols for the care and use of animals were approved by the University of Kansas Animal Care and Use Committee.

Cloning and characterization of the PLP-C{alpha} cDNA
Total RNA was extracted with TRIzol reagent from mouse placental tissues isolated from day 19 of pregnancy. Five micrograms of total RNA and 0.5 µg of oligo (deoxythymidine) were used for the RT reaction. PCR reactions were performed using Pfu polymerase with a set of primers based on the rat PLP-Cv cDNA sequence (5' primer: 5' AGAACTCATCCTGCTTAGGAA 3'; 3' primer: 5' GCATAGCCCAAGCAGACATAA 3') for 30 cycles (denature, 94 C for 1 min; anneal, 60 C for 2 min; extension, 72 C for 2 min). The amplified product was subcloned into pCR2.1-TOPO vector flanked by M13 reverse primer and T7 promoter with the TOPO TA Cloning kit. DNA sequencing was performed using an PE Applied Biosystems Model 310 sequencer and PE Applied Biosystems Dye Terminator Cycle Sequencing kits (Foster City, CA). Both strands of the cDNAs were completely sequenced. Comparisons of PLP-C{alpha} with other members of the PRL family were performed with CLUSTAL W (version 1.6, European Molecular Biology Laboratory, Heidelberg, Germany, 16).

Isolation and characterization of the PLP-C{alpha} gene
A genomic DNA library generated from a 129/SvEv mouse strain liver and packaged in the Lambda FIX II vector was a generous gift of Lexicon Genetics, Inc. (Houston, TX). Approximately, 1 x 106 pfu were screened with a mouse PLP-C{alpha} cDNA as previously described (5). Three positive clones obtained were amplified. Integrity of the clones was verified by PCR with primers originally used to clone the PLP-C{alpha} cDNA. One of the two full length clones was used to inoculate LE392 Escherichia coli. A series of forward and reverse oligonucleotide primer sets based on the mouse PLP-C{alpha} cDNA were designed and used to sequence exons and exon-intron boundaries. These primers were also used to estimate 5' and 3' flanking DNA and intron sizes by PCR analysis and agarose electrophoresis. DNA sequencing was performed using an PE Applied Biosystems Model 310 sequencer and PE Applied Biosystems Dye Terminator Cycle Sequencing kits (Foster City, CA).

Southern blot analysis
Genomic DNA was isolated from mouse liver and individually digested with BamHI, EcoRI, or HindIII. Digested samples were electrophoretically separated in 0.8% agarose gels, transferred to nylon membranes, and probed with [32P]-labeled mouse PLP-C{alpha}, rat PLP-C, or rat PLP-Cv cDNAs. Hybridizations were performed in hybridization buffer (50% formamide, 6 x SSPE, 5 x Denhardt’s reagent, 1% SDS, and 100 µg/ml salmon sperm DNA) at 42 C overnight. Membranes were washed under low stringency conditions consisting of two 15 min washes in 7 x SSPE with 0.1% SDS at room temperature followed by two 15-min washes in 1 x SSPE with 0.5% SDS solution at 37 C.

Chromosomal assignment of the mouse PLP-C{alpha} gene
Chromosomal mapping of the mouse PLP-C{alpha} gene was determined using The Jackson Laboratory Interspecific Backcross Panel (17). Genomic DNAs from C57BL/6J, Mus spretus and a (M. spretus x C57BL/6J)F1 x M. spretus (BSS type) backcross were analyzed by Southern blotting as previously described (18). Approximately 5 µg of genomic DNAs from the C57BL6/J and M. spretus progenitors were digested with 28 different restriction enzymes to find a suitable restriction fragment length variation (RFLV) for mapping. Southern blots were probed with the mouse PLP-C{alpha} cDNA. Approximately 2 µg of DNA from the BSS type backcross panel were digested for each sample with BclI overnight. Segration of alleles was compared with other loci from a database at The Jackson Laboratory Backcross DNA map Panel Service (17).

Analysis of PLP-C{alpha} expression
Northern blot analysis. Northern blots were performed as previously described in our laboratory (19, 20). RNA was extracted from tissues essentially as described by Chomczynski and Sacchi (21), using TRIzol. Total RNA (15 µg) was separated on a 1% agarose gel and transferred to a nylon membrane. Blots were probed with [32P]-labeled mouse PLP-C{alpha} cDNA. The ribosomal protein L7 (rpL7) control probe was generated by PCR (22). Specific oligonucleotide primers amplified a 246 bp rpL7 fragment that was random primer labeled using Klenow and [32P]-dATP.

In situ hybridization
PLP-C{alpha} messenger RNA (mRNA) was detected in frozen tissue sections as previously described (19, 23). The full-length mouse PLP-C{alpha} cDNA was subcloned into pGEM-T vector flanked by T7 and SP6 promoters, linearized, and used as a template for the synthesis of [35S]-labeled sense and antisense RNA probes.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
PLP-C{alpha} cDNA and gene characterization
In our attempt to identify members of the PLP-C subfamily in the mouse, we used two approaches: 1) survey of the National Center for Biotechnology Information dbEST database and 2) a PCR strategy using primers from putative rat homologs. Other than mouse d/tPRP, which has been previously characterized (8, 9), we were unable to find any mouse homologs of the rat PLP-C subfamily in the dbEST database. However, our efforts with the PCR strategy yielded a cDNA that was amplified from day 19 placental RNA using primers based on the nucleotide sequence of rat PLP-Cv. The cDNA was subcloned, sequenced, and shown to encode for a 239 amino acid protein that possesses from 69–71% identity with rat PLP-C, PLP-Cv, PLP-D, and PLP-H (Figs. 1Go and 2Go; Table 1Go; GenBank Accession number, AF090140). We named this mouse PLP-C subfamily member, PLP-C{alpha}, because of its significant homology with all members of the PLP-C subfamily but lack of additional overall homology with any one member. Based on homology with the rat PLP-C protein, it was determined that the mouse PLP-C{alpha} contains a 29 amino acid signal peptide (2). The mature mouse PLP-C{alpha} encodes for a protein with a number of features similar to other members of the PLP-C subfamily including a homologously positioned putative N-linked glycosylation site and six homologously situated cysteine residues, and the characteristic 14 amino acid aromatic domain (Fig. 2Go).



View larger version (65K):
[in this window]
[in a new window]
  		Figure 1. Mouse PLP-C{alpha} gene structure: nucleotide sequence, exon/intron boundaries, and amino acid sequence. The locations of six exons are indicated by capital letters and intronic regions are in lower case. Encoded amino acids are indicated by single letter designations beneath their respective codons. An arrow indicates the predicted signal peptide cleavage site between Ser-1 and Asn+1 inferred from sequence alignment with rat PLP-C. Mouse PLP-C{alpha} encodes for a 239 amino acid protein. A putative N-linked glycosylation site is denoted by shading and the location of the presumed polyadenylation site is underlined.

 


View larger version (97K):
[in this window]
[in a new window]
  		Figure 2. Amino acid homology between mouse PLP-C{alpha} and other PLP-C subfamily proteins. Amino acid sequences of mouse PLP-C{alpha} (present study), rat PLP-C (2 5 ), rat PLP-Cv (5 ), rat PLP-D (6 ), rat d/tPRP (4 ), and mouse d/tPRP (9 ) are listed by one-letter designations. Sequences were aligned using CLUSTAL W multiple sequence alignment program (version 1.6, 16). Shaded areas denote identity with mouse PLP-C{alpha}.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Sequence comparison between mouse PLP-C{alpha} and other members of the rodent PRL family1

 
The mouse PLP-C{alpha} cDNA was then used to screen a mouse genomic library resulting in the identification of three positive phage clones. One of the two full length clones was further characterized by restriction enzyme mapping, PCR, and sequencing. The PLP-C{alpha} gene has a 6-exon/5-intron gene organization (Figs. 2Go and 3Go) similar to other members of the PLP-C subfamily (5, 20). Southern analysis with a mouse PLP-C{alpha} (Fig. 4Go) and rat PLP-C subfamily probes (data not shown) suggested the existence of a single mouse PLP-C{alpha} gene.



View larger version (9K):
[in this window]
[in a new window]
  		Figure 3. Schematic representation of the 12.9 kb mouse PLP-C{alpha} genomic clone. Sequence analysis of exon (E)/intron (I) boundaries revealed that the mouse PLP-C{alpha} gene is comprised of six exons and five introns. The beginning of exon 1 is defined as the putative translation start site (ATG), and the end of exon 6 is defined as the polyadenylation site (AATAAA). Shaded boxes correspond with actual exon sizes. The sizes of the 5' and 3' flanking regions were determined by PCR and agarose gel electrophoresis.

 


View larger version (19K):
[in this window]
[in a new window]
  		Figure 4. Southern blot analysis of mouse PLP-C{alpha} from mouse genomic DNA. Genomic DNA was isolated from mouse liver and individually digested with BamHI (B), EcoRI (E), or HindIII (H). Digested samples were then electrophoretically separated in 0.8% agarose gels, transferred to nylon membranes, and probed with [32P]-labeled mouse PLP-C{alpha} cDNA. Please note the relatively simple hybridation pattens observed with the three restriction enzymes.

 
Chromosomal mapping
The mouse PLP-C{alpha} cDNA was used to determine the chromosomal location of the gene encoding PLP-C{alpha} by analyzing the segregation of a BclI RFLV in genomic DNAs derived from the offspring of a (M. spretus x C57BL/6J)F1 x M. spretus backcross. The gene symbol, Prlpc, has been assigned to the mouse PLP-C{alpha} locus and has been approved by the International Mouse Nomenclature Committee. A BclI RFLV for Prlpc was identified by the presence of a 2.6 kb genomic DNA fragment in C57BL/6J or the presence of a 3.3 kb fragment in M. spretus (Fig. 5AGo). Mapping data have been deposited with the Mouse Genome Database under Accession Number J:46755. Haplotype analysis of these mapping data (Fig. 5BGo) indicated that the Prlpc locus is closely linked to Dtprp (mouse decidual/trophoblast PRL-related protein gene) and Pl1 (mouse placental lactogen-I gene) on chromosome 13 in the mouse. Allelic segregation patterns for Prlpc, Dtprp, and Pl1 are identical, indicating a distance of less than 1 centimorgan among these three genes. The calculated map distances between Prlpc and two adjacent loci, Gpld1 (glycosylphophatidylinositol-specific phospholipase D) and D13Bwg0938e (DNA segment, Chr 13, Brigham and Women’s Genetics 0938 expressed), including 95% confidence limits were determined:



View larger version (21K):
[in this window]
[in a new window]
  		Figure 5. Chromosomal localization of the mouse PLP-C{alpha} gene (Prlpc). A, BclI restriction pattern for C57Bl/6J (B) genomic DNA and M. spretus (S) genomic DNA probed with the mouse PLP-C{alpha} cDNA. The sizes of the fragments in kb are indicated. B, Haplotype analysis of chromosome 13 genetic markers in (C57BL/6J x M. spretus)F1 x M. spretus (BSS type) backcross mice showing linkage and relative position of Prlpc. Closed boxes indicate inheritance of the C57BL/6J (B) allele, and open boxes indicate the inheritance of the M. spretus (S) allele from the (C57BL/6J x M. spretus)F1 parent. Gene names and references to these loci can be found in the Mouse Genome Database (MGD). These data are accessible through MGD (http://www.jax.org). The first two columns indicate the number of backcross progeny with no recombinations. The following columns indicate recombinational events between adjacent loci (signified by a change from an open box to a closed box). The number of recombinants are listed below each column and the recombination frequency (REC %) between adjacent loci is indicated.

 
Gpld1-1.1 ± 1.1 cM-Prlpc-2.1 ± 1.5 cM-D13Bwg0938e

PLP-C{alpha} expression patterns
The tissue distribution of mouse PLP-C{alpha} mRNA was determined by Northern blot analysis (Fig. 6Go). PLP-C{alpha} expression was detected in chorioallantoic placental tissues from days 13, 16, and 19 of pregnancy. Expression of PLP-C{alpha} increased progressively from midgestation to the end of pregnancy. PLP-C{alpha} transcripts were not detected in mouse deciduoma, brain, thymus, heart, lung, diaphragm, liver, spleen, kidney, or ovary. This pattern of expression is identical to the expression patterns of rat PLP-C and PLP-Cv (5). Integrity of the RNA was verified by hybridization with the rpL7 probe.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 6. Placental-specific expression of mouse PLP-C{alpha}. Total RNA was collected from placental tissues (day 13, day 16, and day 19), day 8 deciduoma tissue, brain, thymus, heart, lung, diaphragm, liver, spleen, kidney, and ovary. The distribution of PLP-C{alpha} mRNA in mouse tissues was determined by Northern blot analysis. PLP-C{alpha} expression was restricted to placental tissues and increased as gestation progressed. The control probe for rpL7 was used to demonstrate loading accuracy and the integrity of the RNA.

 
In situ hybridization was used to determine the cellular localization of PLP-C{alpha} in mouse uteroplacental tissues from day 8 to day 19 of gestation. PLP-C{alpha} mRNA was localized to spongiotrophoblast and trophoblast giant cells from the junctional zone of the chorioallantoic placenta (Fig. 7Go, day 19 placental tissues). Antisense PLP-C{alpha} hybridization signals increased in intensity as gestation progressed (data not shown). Sense probes did not exhibit significant hybridization with the placental tissues (Fig. 7Go). The cellular localization of PLP-C{alpha} mRNA is identical to the intraplacental site of expression for rat PLP-C subfamily members: PLP-C, PLP-D, and PLP-H (2, 3, 6, 7).



View larger version (84K):
[in this window]
[in a new window]
  		Figure 7. Localization of PLP-C{alpha} expression in developing placental structures. PLP-C{alpha} mRNA localization in uteroplacental tissues was determined by in situ hybridization. Day 19 placental sections were hybridized with [35S]-labeled PLP-C{alpha} sense or antisense riboprobes. A, brightfield micrograph showing no hybridization signal using the PLP-C{alpha} sense probe, magnification x100; B, brightfield micrograph demonstrating intense hybridization with the PLP-C{alpha} antisense probe in both trophoblast giant cells and spongiotrophoblast cells from the junctional zone of the chorioallantoic placenta, magnification x250; C, darkfield micrograph of B.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this report, we have identified and characterized a new member of the mouse PRL gene family. This new member is part of the PLP-C subfamily. We have given this new ligand the name PLP-C{alpha} because of its significant homology with all members of the rat PLP-C subfamily but lack of additional overall homology with any one member. Mouse PLP-C{alpha} is similar to its rat counterparts in sequence, gene structure, tissue distribution, and temporal expression patterns (2, 3, 5, 6, 7).

Structural features of the mouse PLP-C{alpha} gene are consistent with its inclusion in the PLP-C subdivision of the PRL gene family. Mouse PLP-C{alpha} possesses a 6-exon/5-intron organization that is typical of other PLP-C subfamily members (5, 20) but differs from the 5-exon/4-intron pattern shared by other PRL family members (PRL, PL-II, and proliferin genes; 24–30). The additional exon is situated between exons 2 and 3 of the prototypical PRL gene structure and codes for a well conserved aromatic domain that is a feature of all PLP-C subfamily members (2, 3, 5, 6, 7) and the more distantly related proliferin-related protein (31). The aromatic domain and other commonalities among PLP-C subfamily members are apparent; however, a true appreciation of their structural and functional relevance awaits discovery of the biological actions of these orphan ligands.

The mouse PLP-C{alpha} gene, Prlpc, maps to mouse chromosome 13 along with other members of the mouse PRL family (8, 9, 32, 33). The accumulation of data regarding the clustering of PRL family members on the same chromosome supports the hypothesis that individual members arose from duplication and divergent evolution from a common ancestral gene (34, 35, 36). The mouse Prlpc locus is closely linked to the Prl locus which is within a conserved region of homology with rat chromosome 17 and human chromosome 6. PLP-C subfamily members have been localized to rat chromosome 17 (3, 4, 5). A human homolog for the PLP-C subfamily has not been reported. The specific alignments of PRL family members on chromosome 13 have not been presented; however, such information may provide some insights regarding the coordinated patterns of expression for each of the family members.

The tissue-specific and temporal expression pattern of PLP-C{alpha} in the mouse closely parallels expression patterns for its counterparts in the rat. In both species, spongiotrophoblast cells and trophoblast giant cells are responsible for the expression of this cohort of ligands (2, 3, 6, 7; present study). Placental expression is initiated at midgestation and continues until parturition (2, 3, 5–7; present study). The high levels of expression and conservation across species are consistent with the potential physiological importance of PLP-C{alpha} during pregnancy.

Relationships between rat and mouse PLP-C subfamilies implies the existence of differing selective pressures on their origins. The rat contains four closely related PLP-C subfamily members (PLP-C, PLP-Cv, PLP-D, and PLP-H), whereas the mouse, at least for now, contains only a single PLP-C subfamily member (PLP-C{alpha}) bearing similarity to these rat members. As noted above, this mouse PLP-C subfamily member has approximately similar extents of homology with each of the four rat PLP-C subfamily members. Furthermore, we have not been able to isolate specific mouse homologs for rat PLP-C subfamily members other than for d/tPRP. These observations are somewhat surprising but may suggest different patterns of evolution for the PLP-C subfamily in the mouse vs. the rat. It will be of considerable interest to determine the spectrum of biological roles for each of the PLP-C subfamily members and to evaluate whether mouse PLP-C{alpha} possesses a broader range of actions that includes the range of actions represented by the closely related rat PLP-C subfamily (PLP-C, PLP-Cv, PLP-D, and PLP-H).

In summary, we have identified a new member of the PLP-C family in the mouse, PLP-C{alpha}, characterized its cDNA and gene, and determined its chromosomal position and pattern of expression during gestation. Collectively, these findings are significant for two important reasons: 1) the high degree of PLP-C{alpha} conservation with members of the rat PLP-C subfamily implies physiological relevance during pregnancy; and 2) the availability of a mouse model creates new genetic-based opportunities for studying the physiology of the PLP-C subfamily.


   Acknowledgments
 
The authors wish to thank Michael Rusnak of Lexicon Genetics Inc. for the gift of the mouse genomic library and Lucy Rowe and Mary Barter of The Jackson Laboratory for performing the linkage analyzes.


   Footnotes
 
1 This work was supported by grants from the National Institute of Child Health and Human Development (HD-20676, HD-29797, HD-33994; to M.J.S.) and the Paul Patton Memorial Trust (to R.A.W.). Back

2 Supported in part by fellowships from the Kansas Health Foundation and the Lalor Foundation. Present address: Laboratory of Reproductive Physiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia 19104-6009. Back

3 Supported in part by a fellowship from the Kansas Health Foundation. Back

Received July 8, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Soares MJ, Dai G, Orwig KE, Peters TJ, Müller H 1998 The uteroplacental PRL family and pregnancy. Biol Reprod 58:273–284[Free Full Text]
  2. Deb S, Roby KF, Faria TN, Larsen D, Soares MJ 1991 Identification and immunochemical characterization of a major placental secretory protein related to the PRL-growth hormone family, PRL-like protein-C. Endocrinology 128:3066–3072[Abstract/Free Full Text]
  3. Deb S, Roby KF, Faria TN, Szpirer C, Levan G, Kwok SCM, Soares MJ 1991 Molecular cloning and characterization of PRL-like protein-C complementary deoxyribonucleic acid. J Biol Chem 266:23027–23032[Abstract/Free Full Text]
  4. Roby KF, Deb S, Gibori G, Szpirer C, Levan G, Kwok SCM, Soares MJ 1993 Decidual PRL-related protein. Identification, molecular cloning, and characterization. J Biol Chem 268:3136–3142[Abstract/Free Full Text]
  5. Dai G, Liu B, Szpirer C, Levan G, Kwok SCM, Soares MJ 1996 PRL-like protein-C variant: complementary deoxyribonucleic acid, unique six exon gene structure, and trophoblast cell-specific expression. Endocrinology 137:5009–5019[Abstract]
  6. Iwatsuki K, Shinozaki M, Hattori N, Hirasawa K, Itagaki S-I, Shiota K, Ogawa T 1996 Molecular cloning and characterization of a new member of the rat placental prolactin (PRL) family, PRL-like protein D (PLP-D). Endocrinology 137:3849–3855[Abstract]
  7. Iwatsuki K, Oda M, Sun W, Satoshi T, Ogawa T, Shiota K 1998 Molecular cloning and characterization of a new member of the rat placental prolactin (PRL) family, PRL-like protein H (PLP-H). Endocrinology 139:4976–4983[Abstract/Free Full Text]
  8. Lin J, Poole J, Linzer DIH 1997 Three new members of the mouse PRL/growth hormone family are homologous to proteins expressed in the rat. Endocrinology 138:5541–5549[Abstract/Free Full Text]
  9. Orwig KE, Ishimura R, Müller H, Liu B, Soares MJ 1997 Identification and characterization of a mouse homolog for decidual/trophoblast PRL-related protein. Endocrinology 139:5511–5517
  10. Ogilvie S, Buhi WC, Olson JA, Shiverick KT 1990 Identification of a novel family of growth hormone-related proteins secreted by rat placenta. Endocrinology 126:3271–3273[Abstract/Free Full Text]
  11. Conliffe PR, Farmerie WG, Charles GD, Buhi WC, Kelly PA, Simmen RCM, Shiverick KT 1994 Expression and characterization of recombinant rat placental PRL-like protein C. Mol Cell Endocrinol 106:121–130[CrossRef][Medline]
  12. Rasmussen CA, Hashizume K, Orwig KE, Xu L, Soares MJ 1996 Decidual PRL-related protein: heterologous expression and characterization. Endocrinology 137:5558–5566[Abstract]
  13. Dai G, Takahashi T, Liu B, Chapman BM, Müller H, Soares MJ Heterologous expression and identification of target tissues for PRL-like protein-C (PLP-C) and PLP-C variant (PLP-Cv). Program of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998, Abstract P3–461
  14. Wang D, Ishimura R, Dai G, Müller H, Liu B, Soares MJ Target cells for decidual/trophoblast PRL-related protein within the uteroplacental compartment. Program of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1988, Abstract P3–460
  15. Soares MJ, Colosi P, Ogren L, Talamantes F 1983 Identification and partial characterization of a lactogen from the midpregnant mouse conceptus. Endocrinology 112:1313–1317[Abstract/Free Full Text]
  16. Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680[Abstract/Free Full Text]
  17. Rowe LB, Nadeau JH, Turner R, Frankel WN, Letts VA, Eppig JT, Ko MSH, Thurston SJ, Birkenmeier EH 1994 Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mamm Genome 5:253–274[CrossRef][Medline]
  18. White RA, Peters LL, Adkison LR, Korsgren C, Cohen CM, Lux SE 1992 The murine pallid mutation is a platelet storage pool disease associated with the protein 4.2 (pallidin) gene. Nat Genet 2:80–83[CrossRef][Medline]
  19. Faria TN, Deb S, Kwok SCM, Talamantes F, Soares MJ 1990 Ontogeny of placental lactogen-I and placental lactogen-II expression in the developing rat placenta. Dev Biol 141:279–291[CrossRef][Medline]
  20. Orwig KE, Dai G, Rasmussen CA, Soares MJ 1997 Decidual/trophoblast PRL-related protein: characterization of gene structure and cell-specific expression. Endocrinology 138:2491–2500[Abstract/Free Full Text]
  21. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanididium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  22. Meyuhas O, Klein A 1990 The mouse ribosomal protein L7 gene. Its primary structure and functional analysis of the promoter region. J Biol Chem 265:11465–11473[Abstract/Free Full Text]
  23. Rasmussen CA, Orwig KE, Vellucci S, Soares MJ 1997 Dual expression of PRL-related protein in decidual and trophoblast tissues during pregnancy. Biol Reprod 56:647–654[Abstract]
  24. Chien Y-H, Thompson EB 1980 Genomic organization of rat PRL and growth hormone genes. Proc Natl Acad Sci USA 77:4583–4587[Abstract/Free Full Text]
  25. Maurer RA, Erwin CR, Donelson JD 1981 Analysis of 5' flanking sequences and intron-exon boundaries of the rat PRL gene. J Biol Chem 256:10524–10528[Free Full Text]
  26. Cooke NE, Baxter JD 1982 Structural analysis of the PRL gene suggests a separate origin for its 5' end. Nature 297:603–606[CrossRef][Medline]
  27. Linzer DIH, Talamantes F 1985 Nucleotide sequence of mouse PRL and growth hormone mRNAs and expression of these mRNAs during pregnancy. J Biol Chem 260:9574–9579[Abstract/Free Full Text]
  28. Shida MM, Jackson-Grusby LL, Ross SR, Linzer DIH 1992 Placental-specific expression from the mouse placental lactogen II gene promoter. Proc Natl Acad Sci USA 89:3864–3868[Abstract/Free Full Text]
  29. Shah P, Sun Y, Szpirer C, Duckworth ML 1998 Rat placental lactogen II gene: characterization of gene structure and placental-specific expression. Endocrinology 139:967–973[Abstract/Free Full Text]
  30. Connor AM, Waterhouse P, Khokha R, Denhardt DT 1989 Characterization of a mouse mitogen-regulated protein/proliferin gene and its promoter: a member of the growth hormone/PRL gene superfamily. Biochim Biophys Acta 1009:75–82[Medline]
  31. Linzer DIH, Nathans D 1985 A new member of the PRL-growth hormone gene family expressed in mouse placenta. EMBO J 4:1419–1423[Medline]
  32. Jackson-Grusby LL, Pravtcheva D, Ruddle FH, Linzer DIH 1988 Chromosomal mapping of the PRL/growth hormone gene family in the mouse. Endocrinology 122:2462–2466[Abstract/Free Full Text]
  33. Lin J, Poole J, Linzer DIH 1997 Two novel members of the PRL/growth hormone family are expressed in the mouse placenta. Endocrinology 138:5535–5540[Abstract/Free Full Text]
  34. Niall HD, Hogan ML, Rosenblum IY, Greenwood FC 1971 Sequence of pituitary and placental lactogenic and growth hormones: evolution from a primordial peptide by gene reduplication. Proc Natl Acad Sci USA 68:866–869[Abstract/Free Full Text]
  35. Miller WL, Eberhardt NL 1983 Structure and evolution of the growth hormone gene family. Endocr Rev 4:97–130[Abstract/Free Full Text]
  36. Goffin V, Shiverick KT, Kelly PA, Martial JA 1996 Sequence-function relationships within the expanding family of PRL, growth hormone, placental lactogen, and related proteins in mammals. Endocr Rev 17:385–410[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Genome ResHome page
M. G. Carter, T. Hamatani, A. A. Sharov, C. E. Carmack, Y. Qian, K. Aiba, N. T. Ko, D. B. Dudekula, P. M. Brzoska, S. S. Hwang, et al.
In Situ-Synthesized Novel Microarray Optimized for Mouse Stem Cell and Early Developmental Expression Profiling
Genome Res., May 1, 2003; 13(5): 1011 - 1021.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. O. Wiemers, L.-j. Shao, R. Ain, G. Dai, and M. J. Soares
The Mouse Prolactin Gene Family Locus
Endocrinology, January 1, 2003; 144(1): 313 - 325.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
I.-T. Hwang, Y.-H. Lee, B.-C. Moon, K.-Y. Ahn, S.-W. Lee, and J.-Y. Chun
Identification and Characterization of a New Member of the Placental Prolactin-Like Protein-C (PLP-C) Subfamily, PLP-C{beta}
Endocrinology, September 1, 2000; 141(9): 3343 - 3352.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
D. J. Toft and D. I.H. Linzer
Identification of Three Prolactin-Related Hormones as Markers of Invasive Trophoblasts in the Rat
Biol Reprod, August 1, 2000; 63(2): 519 - 525.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
J. T. FASSETT, R. T. HAMILTON, and M. NILSEN-HAMILTON
Mrp4, A New Mitogen-Regulated Protein/Proliferin Gene; Unique in this Gene Family for its Expression in the Adult Mouse Tail and Ear
Endocrinology, May 1, 2000; 141(5): 1863 - 1871.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Su, S. A. Liebhaber, and N. E. Cooke
The Human Growth Hormone Gene Cluster Locus Control Region Supports Position-independent Pituitary- and Placenta-specific Expression in the Transgenic Mouse
J. Biol. Chem., March 10, 2000; 275(11): 7902 - 7909.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. J. Toft and D. I. H. Linzer
Prolactin (PRL)-Like Protein J, a Novel Member of the PRL/Growth Hormone Family, Is Exclusively Expressed in Maternal Decidua
Endocrinology, November 1, 1999; 140(11): 5095 - 5101.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
G. Dai, M. W. Wolfe, and M. J. Soares
Distinct Regulatory Regions from the Prolactin-Like Protein C Variant Promoter Direct Trophoblast Giant Cell Versus Spongiotrophoblast Cell-Specific Expression
Endocrinology, October 1, 1999; 140(10): 4691 - 4698.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, G.
Right arrow Articles by Soares, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, G.
Right arrow Articles by Soares, M. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals