help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maggi, D.
Right arrow Articles by Cordera, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maggi, D.
Right arrow Articles by Cordera, R.
Endocrinology Vol. 139, No. 2 496-504
Copyright © 1998 by The Endocrine Society

ARTICLES

Cys860 in the Extracellular Domain of Insulin Receptor ß-Subunit Is Critical for Internalization and Signal Transduction1

Davide Maggi, Gabriella Andraghetti, Jean-Louis Carpentier and Renzo Cordera

Department of Endocrinology and Metabolism, University of Genova, Genova, Italy; and the Department of Morphology, University of Geneva (J.-L.C.), Geneva, Switzerland

Address all correspondence and requests for reprints to: Dr. Renzo Cordera, Viale Benedetto XV 6, 16132 Genova, Italy. E-mail: record{at}unige.it


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The C860S mutation (IRC860S) in the extracellular domain of the insulin receptor ß-subunit has previously been shown to result in an inhibition of insulin receptor internalization. The present work aims at further dissecting the consequences of this mutation not only on insulin receptor internalization, but also on the signaling of the receptor. Following transfection of Chinese hamster ovary (CHO) cells with insulin receptors with the C860S mutation (CHO-IRC860S) and quantitative electron microscopic analysis of [125I]insulin localization in these cells, the inhibition of receptor internalization appears to be due to an inhibition of the lateral translocation of the receptor from microvilli to nonvillous domains of the cell surface. At 37 C, insulin-stimulated insulin receptor substrate-1 (IRS-1) phosphorylation is inhibited by 50% in CHO-IRC860S, whereas Shc phosphorylation remains unaffected. The inhibition of IRS-1 phosphorylation is still present when experiments are conducted at 4 C, a temperature at which insulin receptor internalization is prevented, suggesting that the defect in IRS-1 phosphorylation is not due to the reduced internalization of the receptor. In terms of biological effects, the mutation has negative consequences on insulin-stimulated c-fos expression and DNA synthesis as well as on glycogen synthase activity. Eventually, the events observed are specific for Cys860, as individual substitution of the two more proximal Cys residues (795 and 872) to Ser is not accompanied by any change in either insulin-induced insulin receptor internalization or IRS-1 phosphorylation. Thus, the present analysis of CHO-IRC860S 1) reveals that insulin receptor surface redistribution is not solely dependent on receptor autophosphorylation, 2) emphasizes that IRS-1 phosphorylation is not dependent on receptor internalization and can be triggered from microvilli, and 3) stresses divergent aspects between two of the major signaling pathways of the insulin receptor.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE INSULIN receptor is a transmembrane glycoprotein and a member of the family of receptor tyrosine kinases (1). After binding to receptor {alpha}-subunit, hormone signaling is mediated by activation of cytoplasmic ß-subunit tyrosine kinase, which, in turn, phosphorylates intracellular substrates such as insulin receptor substrate-1 (IRS-1) and Shc proteins (2, 3). The cellular compartment, where activated insulin receptors bind IRS-1 and Shc proteins in the intact cell, remains, however, a subject of debate; although it was proposed that this interaction was occurring at the plasma membrane (4), others have provided evidence for a delayed interaction at the level of the endosomal membranes (5, 6). To complicate the problem, the distribution of IRS-1 in several cells lines varies from mostly cytosolic, as in rat fat cells (6), to predominantly associated with intracellular membranes, as in 3T3-L1 adipocytes (4). In the case of Shc, a prevalent cytosolic association was described (7).

In addition to transducing insulin signal, insulin receptor mediates the internalization of the hormone by a process called receptor-mediated endocytosis (8). Insulin-insulin receptor complex internalization is a multistep process. It requires insulin-induced autophosphorylation of the receptor ß-subunit (9), which itself triggers the redistribution of insulin-receptor complexes from microvilli to the nonvillous domains of the cell surface where the internalization gates (clathrin-coated pits) are localized. This endocytotic process also requires conserved juxtamembrane cytoplasmic motifs, involved in the segregation of insulin receptors in clathrin-coated pits (10, 11) and interaction with other proteins, such as annexin-2 (12, 13) The physiological relevance of insulin receptor internalization in the transmission of insulin biological signal has been a subject of debate. Recently, the question became more controversial than ever. Two lines of evidence suggest the absence of a role for insulin receptor internalization in the transduction of insulin signal: 1) insulin receptor mutants that failed to undergo internalization appeared fully effective in inducing IRS-1 phosphorylation and in the transduction of various biological effects of insulin (14, 15, 16, 17); and 2) at 4 C, in conditions where internalization is almost absent, insulin can phosphorylate IRS-1 (4). On the other hand, similarly to what had previously been demonstrated in the case of epidermal growth factor receptors (18), internalized insulin receptors are phosphorylated and remain active toward exogenous substrates (19). More recent studies revealed in addition that insulin receptors present in endosomes exhibit greater autophosphorylation (6) and exogenous kinase activities than plasma membrane receptors (20), and a good parallelism between the phosphotyrosine content of these receptors and the phosphorylation state of the first substrate of the insulin receptor (IRS-1) present in the low density microsomes was reported (6). Based on these observations, it was proposed that tyrosine phosphorylation of IRS-1 occurred in endosomes, and consequently, that insulin receptor internalization is necessary for the initiation of the phosphorylation cascade leading to the biological activity of insulin. Thus, at this stage, the crucial question of the possible implication of insulin receptor internalization in insulin signaling and its physiological relevance remains unresolved.

To help resolve this dilemma, we took advantage of a recently described cell line expressing transfected insulin receptors with a mutation (C860S) that inhibits insulin receptor internalization but does not affect insulin receptor autophosphorylation (21). The present study was designed first to localize these receptors at the electron microscopic level, second to investigate IRS-1 and Shc phosphorylation and insulin biological activity in cells expressing these mutated receptors, and third to try to establish a correlation between the localization of the receptor and the biological effects induced. The data presented demonstrate that the C860S mutation 1) reduces insulin receptor lateral translocation from microvilli to nonvillous domains of the cell surface, 2) does not affect insulin-induced Shc phosphorylation, 3) reduces insulin-stimulated IRS-1 phosphorylation at both 4 and 37 C, and 4) inhibits insulin-induced metabolic and mitogenic effects.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Oligonucleotides were purchased from TIB MOLBIOL (Genova, Italy). Chinese hamster ovary (CHO) cells, CHO-K1, and pRSV-Neo plasmid were obtained from American Type Culture Collection (Rockville, MD). pCMV vector was previously described (22). Glutamine, penicillin G, and streptomycin sulfate were purchased from ICN Flow (Costa Mesa, CA). DMEM and poly(Glu4-Tyr1) were obtained from Sigma Chemical Co. (St. Louis, MO). Human recombinant insulin, [methyl-3H]thymidine, D-[U-14C]glucose, [125I]insulin, Hybond-C, and enhanced chemiluminescence reagents were purchased from Amersham (Arlington Heights, IL). [{gamma}-32P]ATP was obtained from DuPont-New England Nuclear (Boston, MA). Afl2, Taq polymerase, and G418 were purchased from Boehringer Mannheim (Mannheim, Germany). T4 polynucleotide kinase (T4-PNK) and Bsm1 were obtained from New England Biolabs (Beverly, MA). RNAzol and RNAsin were purchased from Promega (Madison, WI). AMV reverse transcriptase and the Sequenase 2.0 kit were obtained from U.S. Biochemical Corp. (Cleveland, OH). Protein A-Sepharose CL-4B was obtained from Pharmacia LKB Biotechnology (Uppsala, Sweden). Anti-IRS-1 and anti-Shc polyclonal antibodies were purchased from Upstate Biotechnology (Lake Placid, NY). Antiinsulin receptor ß-subunit and antiphosphotyronine (PY20) antibodies were obtained from Transduction Laboratories (Lexington, KY).

Site-directed mutagenesis and construction of expression vectors
Site-directed mutagenesis of Cys860 was described previously (21). Mutants Ser795 and Ser872 were generated analogously by overlapping extension technique. For each mutation, two separate reactions were carried out, using pCMVHIR as a template, to give products with the desired mutation at their ends. For the C795S mutation, the oligonucleotides were 5'-GGAACGGTGCAGTGTGG and 3'-CCACACTGCACCGTTCC; for the C872S mutation, the oligonucleotides were 5'-GGAACGGGGCTGCAGGCTGC and 3'-ACGCAGCCTGCAGCCCCGTT. Flanking oligonucleotides for each reaction were 5'-CTGGTCACCTTTTCGGATGA and 3'-GCACTGGAGTGGCAACTTCC. PCR products for each mutation were then hybridized together and used as a template for further amplification using flanking primers. The resulting products were digested with Bsm1 and Afl2 and were ligated in pCMVHIR, replacing the corresponding Bsm1-Afl2 wild-type fragment. Sequences derived from PCR mutagenesis were confirmed by dideoxy sequencing.

Cell culture and transfection
CHO-K1 cells were grown in DMEM supplemented with 2 mM glutamine, 10% FCS, 100 U/ml penicillin G, and 100 µg/ml streptomycin sulfate. Subconfluent cells in 10-cm petri dishes were cotransfected with 1 µg pRSV-neo and 10 µg of each mutant expression vector by calcium phosphate precipitation. Four hours after transfection, a glycerol shock was performed. After 48 h, cells were replated at a lower density and selected by the addition of G418 (400 µg/ml). After 10–14 days, independent colonies were picked up and screened for a high level of insulin receptor expression by [125I]insulin binding. A clonal cell line was obtained from primary transformants by the limiting dilution subcloning technique. Experimental results were reproduced with three different clones of transfected cells.

Insulin binding studies and measurement of [125I]insulin internalization
Confluent cells grown in six-well plates were washed twice with PBS and incubated for 3 h at 16 C in HEPES buffer (25 mM HEPES, 120 mM NaCl, 5 mM KCl, 1 mM MgSO4, 1 mM CaCl2, and 1% BSA, pH 7.8) in the presence of [125I]insulin plus increasing amounts of unlabeled insulin. The nonspecific binding, determined in the presence of 1 µg insulin, was subtracted from each point. From competition curves, Scatchard analysis was obtained, and binding parameters were calculated.

For internalization studies, subconfluent monolayers of CHO-K1 cells, expressing an analogous amount of wild-type or mutated receptors, were washed twice with PBS and incubated at 37 C in HEPES buffer, pH 7.5, in the presence of [125I]insulin. At the indicated times, the supernatant was removed, and the cells were washed extensively with cold PBS and incubated in HEPES buffer, pH 3.5, for 10 min at 4 C. Finally, cells were washed extensively with cold PBS and solubilized by 0.4 N NaOH. Acid washes and solubilized cells were counted in a {gamma}-counter, as previously described (21).

Insulin receptor tyrosine kinase activity
For exogenous substrate phosphorylation studies, purified IRWT and IRC860S, preincubated with insulin, were added to reaction buffer (25 mM HEPES, 5 mM MnCl2, 10 mM MgCl2 and 50 mM [{gamma}-32P]ATP, pH 7.4) containing poly(Glu4-Tyr1) at a final concentration of 0.5 mg/ml. After incubation at 4 C for different periods, the reaction was terminated by the addition of unlabeled ATP (final concentration, 50 mM). Finally, samples were spotted on Whatman 3 MM filter papers (Whatman, Clifton, NJ), extensively washed with 10% trichloroacetic acid, and counted for radioactivity in a ß-scintillation counter. The Km and maximum velocity (Vmax) were expressed as picomoles per min/mg and milligrams per ml, respectively.

[3H]Thymidine incorporation into DNA
CHO-IRWT and CHO-IRC860S, seeded in six-well plates and grown to subconfluence, were serum starved in DMEM-1% BSA for 24 h. Insulin was added at the indicated concentrations for 16 h at 37 C. Then cells were pulsed with [methyl-3H]thymidine for an additional 3 h (18 kilobecquerels for each well). Finally, cell monolayers were rinsed twice with PBS, and ice-cold 10% trichloroacetic acid was added. After 1 h on ice, cells were rinsed once with 20% trichloroacetic acid, solubilized in 0.1% SDS, and counted for radioactivity in a ß-scintillation counter.

RT-PCR
Subconfluent CHO-IRWT and CHO-IRC860S were serum starved in DMEM-1% BSA for 16 h before experiments. Insulin, at the indicated concentrations, was then added for 20 min at 37 C. Total RNA was extracted from cells by RNAzol, and 1 µg was used to synthesize first strand complementary DNA (cDNA) in a 40-µl total volume under the following conditions: 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 1 U/µl RNAsin, 1 pmol/µl oligo(deoxythymidine), and 10 U/tube AMV reverse transcriptase. Incubation followed at 42 C for 30 min, and the reaction was terminated by heating at 95 C for 5 min to inactivate enzyme. PCR amplification was then performed. Primers were deduced from cDNA sequences (23, 24). For mouse c-fos, the 5'-primer was CTATCTCCTGAAGAGGAAGAGAAACG (corresponding to nucleotides 1836–1871), and the 3'-primer was AAGGTCATCGGGGATCTTGC (nucleotides 2170–2189), which generated a fragment of 217 bp; for mouse ß-actin, the 5'-primer was GAATGGGTCAGAAGGACTCC (corresponding to nucleotides 215–234), and the 3'-primer was CCATCACAATGCCTGTGGTACG (nucleotides 518–537), which generated a fragment of 324 bp. To detect PCR products, 1 pmol of each antisense was end labeled using T4-PNK and [{gamma}-32P]ATP. The amplification profile was 95 C for 30 sec, 60 C for 30 sec, and 72 C for 1 min after the initial denaturation step at 95 C for 5 min. Twenty-five amplification cycles were completed with an extension step of 10 min at 72 C. PCR products were separated on 12% SDS-PAGE and exposed at -80°C. Finally, bands of interest were excised under an autoradiographic guide, and radioactivity was counted in a ß-scintillation counter. As found in preliminary experiments, linear amplification of c-fos and ß-actin messenger RNA was achieved using 25 cycles of PCR. To test the presence of contaminating genomic DNA, reverse transcriptase and PCR amplification were also performed by omitting AMV reverse transcriptase.

Glucose incorporation into glycogen
Glycogen synthase activity was measured as previously described (25). Briefly, CHO-IRWT and CHO-IRC860S, were serum starved in DMEM-1% BSA for 18 h before experiments. Then cells were extensively washed and incubated in the same medium with D-[U-14C]glucose added in the presence or absence of insulin for 2 h at 37 C in a 5% CO2 incubator. Finally, cell monolayers were washed with ice-cold PBS and solubilized in 2 M NaOH at 55 C. Total cellular glycogen was collected by ethanol precipitation, washed, and precipitated, and the final pellet was resuspended in water and counted for radioactivity.

Immunoprecipitation and immunoblotting
Cells were grown to subconfluence and serum starved in DMEM for 16–24 h before the experiments. Then 10 nM insulin was added to cell monolayers for the indicated times at either 37 or 4 C. Cells were washed extensively in ice-cold PBS, and 500 µl lysis solution [150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycolate, 0.1% SDS, 50 mM Tris (pH 8), 20 mM NaF, 5 mM EGTA, 4 µg/ml aprotinin, 4 µg/ml leupeptin, 1 mM phenylmethylsulfonylfluoride, and 1 mM sodium orthovanadate] was added. Cell lysates were centrifuged at 15,000 x g for 40 min at 4 C, and supernatants were immunoprecipitated with the indicated antibody for 16 h at 4 C with rocking. Protein A-Sepharose were then added for an additional incubation of 90 min. Sepharose-bound immunocomplexes were washed extensively in lysis buffer and boiled for 5 min in Laemmli sample buffer under reducing conditions, and supernatants were resolved in 7.5% SDS-PAGE. Protein electrotransfer to nitrocellulose was performed in Towbin buffer (20 mM Tris, 150 mM glycine, 20% methanol, and 0.02% SDS) for 1 h at 150 mA. Nitrocellulose filters were blocked in either PBS, 0.1% Tween-20, and 5% BSA (antiphosphotyrosine antibody) or PBS, 0.1% Tween-20, and 3% dry milk (anti-IRS-1 or anti-IR antibodies) for 1 h at room temperature. Filters were incubated with the primary antibody for 2 h at room temperature with gentle rocking and washed extensively in PBS-0.1% Tween-20, and appropriated secondary antibody was added for 1 h at room temperature. After a final washing in PBS-0.1% Tween-20, bound antibodies were detected using enhanced chemiluminescence reagents. All procedures were carried out according to manufacturer’s instructions. Bands of interest were quantitated by densitometry using the NIH Image software.

Electron microscopic autoradiography
Before each incubation, cells were washed twice in incubation buffer containing 100 mM HEPES, 120 mM NaCl, 1.2 mM MgSO4, 15 mM CH3COONa, 10 mM glucose, and 1% BSA (pH 7.4) at 4 or 37 C. Cells were then incubated for 2 at 4 C or for 5, 15, 30, or 60 min at 37 C in the presence of human A14 monoiodo-[125I]insulin (3 pM; a gift from Hoechst, Frankfurt, Germany). At the end of these incubations, the cells were fixed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, for 30 min at room temperature. Fixed cells were dehydrated, processed for electron microscope autoradiography, and quantitated as previously described (10). For each incubation time analyzed, three Epon blocks were prepared, and sections were cut from each block. For each time point studied, about 300–400 grains were analyzed for each cell line from all cells judged to be morphologically intact. Their association with the plasma membrane as well as with the various domains of this membrane was estimated by overlying each grain with a circle of 250-nm diameter. Grains within a distance of 250 nm from the plasma membrane were considered associated with the cell surface; grains overlying the cytoplasm and more than 250 nm from the plasma membrane were considered internalized. Grains associated with the plasma membrane were divided into the following classes: 1) microvilli, 2) clathrin-coated pits, 3) nonvillous nonclathrin-coated pit segments, and 4) uninterpretable. Grains were considered associated with microvilli or coated pits if their center was less than 250 nm from these surface domains; they were categorized as uninterpretable when the structures underlying the grain could not be unequivocally identified.

Statistical analysis
Statistical analysis was performed using paired Student’s t test. P < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Stably transfected CHO cells clones expressing wild-type or mutated receptors were obtained by the limiting dilution technique. CHO-IRC860S cells expressed a higher amount of insulin receptor than CHO-IRWT cells. Results were, therefore, normalized by insulin receptor number as determined by Western blotting and/or insulin binding studies. As determined by immunoprecipitation with anti-PY antibody followed by immunoblotting with an antiinsulin receptor antibody, 10 nM insulin (10 min at 37 C) stimulated autophosphorylation of insulin receptor ß-subunit in both CHO-IRWT and CHO-IRC860S cells. This stimulation was not affected by the C860S mutation (Fig. 1Go). Insulin receptor tyrosine kinase activity was also measured in vitro, using poly(Glu4-Tyr1) as a substrate. Kinetic analysis demonstrated superimposable values (IRWT: Km = 0.33; Vmax = 54.2; IRC860S: Km = 0.31; Vmax = 53.8); this indicated that the C860S mutation does not affect the ß-subunit enzymatic activity. By contrast, the stimulation by insulin of [3H]thymidine incorporation into DNA, an overall index of mitogenesis, as well as of transcriptional activation of the early gene c-fos, which is representative of insulin as a progression factor in cell cycle, were both reduced in CHO-IRC860S cells compared with those in CHO-IRWT cells (Fig. 2Go, A and B) by 41% and 56%, respectively, at 10 nM insulin. Also, a metabolic action of insulin, glycogen synthase induction, was reduced in CHO-IRC860S cells (Fig. 2CGo). Another biological effect of insulin was perturbed in CHO-IRC860S cells, [125I]insulin internalization. Indeed, as shown at the electron microscopic level, inhibition of insulin receptor redistribution from microvilli to clathrin-coated pits was noted in CHO-IRC860S cells, which resulted in a reduced association with clathrin-coated pits and explained the previously described inhibition of insulin receptor internalization (21) (Figs. 3Go and 4Go).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 1. Insulin-dependent tyrosine phosphorylation of insulin receptor ß-subunit in CHO-K1 cells expressing wild-type or mutated receptors. CHO-IRWT and CHO-IRC860S cells were incubated with 10 nM insulin for 10 min at 37 C, and cell lysates were immunoprecipitated with anti-PY antibody. Immunoprecipitated proteins were resolved in 7.5% SDS-PAGE, electrophoretically transferred to nitrocellulose, and immunoblotted with antiinsulin receptor ß-subunit antibody (upper panel). Insulin receptor ß-subunit phosphorylation was quantitated by scanning densitometry and expressed as a ratio of ß-subunit PY/insulin receptor (IR) number in arbitrary units (lower panel).

 


View larger version (15K):
[in this window]
[in a new window]
  		Figure 2. Insulin biological effects in CHO-IRWT and CHO-IRC860S. A, [3H]Thymidine incorporation into DNA. CHO-IRWT and CHO-IRC860S, grown to subconfluence, were serum starved in DMEM-1% BSA for 24 h before experiments. Cells were then incubated with insulin at the indicated concentrations for 16 h. [Methyl-3H]thymidine (18 kilobecquerels or 0.5 µCi in each well) was then added for 3 h. Finally, cell monolayers were rinsed twice with ice-cold PBS, and ice-cold 10% trichloroacetic acid was added. After 1 h on ice, cells were rinsed and solubilized, and radioactivity was counted in a ß-scintillation counter, as described in Materials and Methods. Data are the mean ± SE of three independent experiments performed in triplicate. *, P < 0.05; **, P < 0.01 (vs. CHO-IRWT). B. Insulin induced c-fos expression. Subconfluent cells were serum starved for 16 h before experiments, then insulin was added at the indicated concentrations for 20 min at 37 C. Total RNA was extracted and reverse transcribed to synthesize first strand cDNA, as detailed in Materials and Methods. PCR amplification was performed in the presence of end-labeled antisense oligonucleotides. PCR products were resolved on 12% PAGE, and gel was dried and exposed at -80 C. Finally, bands of interest were cut from gel under autoradiographic guide, and radio-activity was counted in a ß-scintillation counter. Results presented are the mean ± SE of three independent experiments performed in duplicate. *, P < 0.05; **, P < 0.01 (vs. CHO-IRWT). C, Glucose incorporation into glycogen. Serum-starved CHO-IRWT and CHO-IRC860S were incubated in DMEM-1% BSA with D-[U-14C]glucose in the absence or presence of insulin at the indicated concentrations. After a 2-h incubation at 37 C in 5% CO2 incubator, ethanol-precipitable glycogen was collected and counted for radioactivity in a ß-scintillation counter. Data are the mean ± SE of three independent experiments performed in duplicate. **, P < 0.01 (vs. CHO-IRWT).

 


View larger version (140K):
[in this window]
[in a new window]
  		Figure 3. Localization of [125I]insulin by electron microscopic autoradiography in CHO-IRWT and CHO-IRC860S. Representative examples of the localization of autoradiographic grains on electron microscopic thin sections of CHO cells transfected with normal or mutant human insulin receptors and incubated in the presence of [125I]insulin. Grains localizing internalized [125I]insulin are indicated by arrows (A and B). A grain in the close vicinity of a clathrin-coated pit and quantitated as associated with this surface domain is illustrated in C.

 


View larger version (17K):
[in this window]
[in a new window]
  		Figure 4. Surface redistribution (A) and association of [125I]insulin with clathrin-coated pits (B) in CHO cells transfected with wild-type or C860S-mutated insulin receptors. The results presented are the average of the analysis of three different Epon blocks and are expressed as a percentage of the total number of grains associated with the cell surface as detailed in Materials and Methods.

 
To determine whether these functional abnormalities were related to alterations in the initial steps of the signaling cascade, we investigated IRS-1 phosphorylation in CHO-IRC860S cells. The same anti-PY immunoprecipitates as those one described above were probed by immunoblotting with an anti-IRS-1 antibody. As shown in Fig. 5Go, tyrosine phosphorylation of IRS-1 is greatly reduced (~50%) in CHO-IRC860S cells compared with that in CHO-IRWT cells.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 5. Tyrosine-phosphorylated IRS-1 in anti PY immunoprecipitates from insulin-stimulated CHO-IRWT and CHO-IRC860S cells at 37 C. CHO-IRWT and CHO-IRC860S cells were incubated with 10 nM insulin for 10 min at 37 C, and cell lysates were immunoprecipitated with anti-PY antibody. Immunoprecipitated proteins were resolved in 7.5% SDS-PAGE and electrophoretically transferred to nitrocellulose. Filter was then incubated with anti-IRS-1 antibody, as detailed in Materials and Methods. The immunoblot presented (upper panel) is representative of three experiments. The band of interest was quantitated by densitometry and expressed as the ratio of IRS-1 PY content/insulin receptor (IR) number ± SE (lower panel). *, P < 0.05 vs. CHO-IRWT.

 
Preliminary experiments were conducted to exclude the possibility that this finding could be due to a decreased amount of IRS-1. A quantitative immunoblotting of total cellular lysates was performed using anti-IRS-1 antibody. CHO-IRC860S cells expressed the same amount of IRS-1 as CHO-IRWT cells (data not shown). The possibility that a conformational change in the IRC860S cells could interfere with insulin receptor ß-subunit binding to IRS-1 was also tested. After solubilization, CHO-IRC860S and CHO-IRWT cells were immunoprecipitated with anti-IRS-1 antibody and probed by immunoblotting with antiinsulin receptor antibody. As shown in Fig. 6Go, a significant amount of IRC860S coprecipitates with IRS-1 in an insulin-stimulated manner, indicating an efficient binding between these two proteins. IRS-1 phosphorylation was also tested at 4 C, because, as previously described, such phosphorylation is occurring in the presence of insulin (4). Figure 7Go illustrates that even at 4 C, insulin-induced IRS-1 phosphorylation is consistently lower in CHO-IRC860S than in CHO-IRWT cells (a 25% reduction, as measured densitometrically).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 6. Coimmunoprecipitation of insulin receptor ß-subunit and IRS-1 in insulin-stimulated CHO-IRWT and CHO-IRC860S cells. CHO-IRWT and CHO-IRC860S cells were stimulated with 10 nM insulin, and cell lysates were immunoprecipitated with anti-IRS-1 antibody. Immunoprecipitated proteins were resolved on 7.5% SDS-PAGE and transferred to nitrocellulose, and filter was incubated with antiinsulin receptor ß-subunit antibody, as detailed in Materials and Methods. The data, obtained from densitometric scanning, were normalized for insulin receptor number and expressed in arbitrary units as the mean ± SE of three independent experiments (lower panel).

 


View larger version (28K):
[in this window]
[in a new window]
  		Figure 7. Tyrosine-phosphorylated IRS-1 in anti-PY immunoprecipitates from insulin-stimulated CHO-IRWT and CHO-IRC860S cells at 4 C. This experiment was conducted exactly as described in Fig. 4Go, but at 4 C. *, P < 0.05 vs. CHO-IRWT.

 
The insulin signaling pathway downstream of IRS-1 was also investigated by measuring phosphatidylinositol 3-kinase activity in CHO cells overexpressing wild-type and mutated receptors. Insulin-stimulated phosphatidylinositol 3-kinase activation was severely impaired in CHO-IRC860S cells (13).

It has been suggested that termination of insulin action requires dephosphorylation of both insulin receptor and IRS-1, and the time course of dephosphorylation of insulin receptor and IRS-1 was similar in rat fat cells (6). Based on these observations, one possibility was that the lower IRS-1 phosphorylation in CHO-IRC860S cells resulted from increased tyrosine phosphatase activity in these cells compared with that in CHO-IRWT cells under insulin-stimulated conditions. To explore this possibility, CHO-IRWT and CHO-IRC860S were insulin stimulated in the presence or absence of NaVO4, a phosphatase inhibitor. The addition of NaVO4 affected neither IRS-1 phosphorylation nor insulin receptor phosphorylation, suggesting that the lower IRS-1 phosphorylation in CHO-IRC860S is not the result of an increased dephosphorylation rate (data not shown).

In addition to IRS-1, Shc proteins, which are implicated in mitogenic signaling by a number of tyrosine kinase receptors (26, 27, 28), participate in insulin receptor signal transduction (3). Moreover, Shc was recently shown to directly associate to {alpha}- and ß-adaptins, which have been implicated in membrane receptor sorting into clathrin-coated pits (29). Thus, a novel role of Shc in endocytosis has been proposed. Therefore, Shc phosphorylation as a potential target of the inhibitory effect of C860S mutation was investigated. To that end, CHO-IRWT and CHO-IRC860S cells were treated with insulin (10 nM), and whole cell lysates were immunoprecipitated with anti-PY antibody and probed using immunoblotting with anti-Shc antibodies. Surprisingly, insulin stimulates tyrosine phosphorylation of Shc to the same extent in the two cell lines, in striking contrast with the results obtained in the case of IRS-1 (Fig. 8Go).



View larger version (37K):
[in this window]
[in a new window]
  		Figure 8. Insulin induces tyrosine phosphorylation of 66 and 52 Shc proteins in CHO-IRWT and CHO-IRC860S cells. Cell lysates were immunoprecipitated with anti-PY antibody, separated on 7.5% SDS-PAGE, electrophoretically transferred to nitrocellulose, and finally incubated with anti-Shc antibody. Bands corresponding to 66 and 52 isoforms of Shc are indicated by arrows in a representative immunoblot (upper panel). The amount of Shc-PY, normalized by insulin receptor number, was evaluated by densitometric scanning of three different autoradiographs and expressed as the mean ± SE (lower panel).

 
Three other Cys residues are present in the extracellular domain of the ß-subunit. To test whether the above-described effects on insulin signal transduction were specifically due to the C860S mutation, the two proximal Cys (795 and 872) were mutated to Ser as detailed inMaterials and Methods. In CHO-IRC795S and CHO-IRC872S cells, insulin binding affinity as well as ß-subunit autophosphorylation and internalization rate were similar to those observed in CHO-IRWT cells. Interestingly, IRS-1 phosphorylation was unaffected (Fig. 9Go), indicating that neither Cys795 nor Cys872 can substitute Cys860 in this specific function.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 9. Tyrosine-phosphorylated IRS-1 in anti-PY immunoprecipitates from insulin-stimulated CHO-IRWT, CHO-IRC795S, and CHO-IRC872S. CHO-IRWT, CHO-IRC795S, and CHO-IRC872S cells were incubated with 10 nM insulin for 10 min at 37 C, and cell lysates were immunoprecipitated with anti-PY antibody. Immunoprecipitated proteins were resolved in 7.5% SDS-PAGE and electrophoretically transferred to nitrocellulose. Filter was then incubated with anti-IRS-1 antibody as detailed in Materials and Methods. The immunoblot presented (upper panel) is representative of three experiments. The band of interest was quantitated by densitometry and expressed as the ratio of IRS-1 PY content/insulin receptor (IR) number ± SE (lower panel).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Taking advantage of the previously described C860S mutation of the extracellular domain of the ß-subunit of the insulin receptor (21), we have investigated the functional consequences of this mutation. Three major conclusions can be drawn: 1) despite a normal insulin-induced autophosphorylation of IRC860S, the insulin-mediated IRS-1 phosphorylation at both 4 and 37 C is impaired in cells expressing this receptor, whereas the phosphorylation of another major substrate of the insulin receptor, Shc, is not affected; 2) the decreased IRS-1 phosphorylation detected in IRC860S-expressing cells is accompanied by a reduction of insulin-stimulated metabolic and mitogenic responses; and 3) C860S determines the inhibition of insulin receptor translocation from microvilli to the nonvillous domains of the cell surface, leading to an inhibition of insulin receptor internalization.

Insulin receptor internalization may be regulated at different stages of the process. First, insulin-mediated receptor kinase activation as well as autophosphorylation of tyrosines 1146, 1150, and 1151 are mandatory for the triggering of the process and the induction of the redistribution from microvilli to the nonvillous domain of the cell surface (9, 10). Second, the velocity of this redistribution has been shown to be dependent on the mobility of the receptor on the cell surface, which itself relies on the conformation of the transmembrane and neighboring juxtamembrane domains (30). Third, the association with the internalization gates (clathrin-coated pits) is mediated via internalization motifs present in the juxtamembrane cytoplasmic domain of the ß-subunit of the receptor (9, 10, 11, 31). In addition, alteration of specific regions of the extracellular ß-domain (glycosylated side-chains) perturb the internalization process by maintaining the receptor on microvilli despite its normal activation by insulin, which suggests that this domain participates in some way in control of the internalization process (Carpentier, J.-L., unpublished observations). The present observations, indicating that the C860S mutation inhibits insulin receptor surface redistribution despite normal receptor kinase activation and autophosphorylation, confirm that surface redistribution of the insulin receptor is not solely dependent on these enzymatic and phosphorylation events. They also support an implication of the extracellular domain of the ß-subunit in the triggering and control of this redistribution process, as previously proposed in the case of the mutation of the site of attachment of the first glycosylated side-chain of the ß-subunit of the insulin receptor (14). The exact mechanism through which the C860S mutation inhibits this process, however, remains to be determined.

In parallel to the inhibition of insulin receptor internalization, a reduction of IRS-1 phosphorylation was noted in CHO-IRC860S cells. This result is not due to an impairment of insulin receptor-IRS-1 recognition, as experiments with insulin receptor-IRS-1 coimmunoprecipitation show that IRC860S binds IRS-1 effectively. Also, a dephosphorylation reaction, via a tyrosine phosphatase, reducing IRS-1 phosphorylation seems unlikely because NaVO4 did not rescue IRS-1 phosphorylation.

The specificity of insulin receptor internalization inhibition and IRS-1-reduced phosphorylation contrasting with the normal phosphorylation of the receptor itself and of another major substrate of the insulin receptor, Shc, suggests that the two events could be related. If so, the question of which of the two occurs first remains open. Together with previous similar observations (4), our detection of insulin-stimulated IRS-1 phosphorylation at 4 C (a condition where insulin receptor internalization is greatly prevented) argues against an implication of internalization in IRS-1 phosphorylation and thus would support the other alternative, the implication of IRS-1 in insulin-induced receptor internalization. This observation suggests that IRS-1 phosphorylation and hence the insulin receptor signaling cascade that depends on IRS-1 phosphorylation can be initiated from these specialized surface domains.

The data presented demonstrate that the C860S mutation in the extracellular domain of the ß-subunit of the insulin receptor allows a dissociation of two major signal transduction pathways of the insulin receptor involving IRS-1 and Shc, respectively. The maintenance of insulin-induced Shc phosphorylation in the absence of IRS-1 activation at 37 C suggests that insulin-mediated Shc phosphorylation is not sufficient to transduce insulin mitogenic signals and trigger insulin receptor internalization. C860S mutation, by decreasing the level of IRS-1 phosphorylation, markedly impairs insulin metabolic action also. Then, the conserved Shc pathway cannot overcome IRS-1-defective phosphorylation. IRS-1 and Shc lie on largely overlapping pathways in insulin-mediated metabolic and mitogenic responses, but their relative contributions remain highly controversial. In Rat-1 fibroblasts (32), CHO-K1 and 32D cells overexpressing IRWT (33, 34), Shc is the prevalent signaling molecule in insulin-mediated mitogen-activated protein kinase activation and mitogenic response. Moreover, natural occurring insulin receptor mutants, devoid of autophosphorylation activity and Shc activation, show relevant impairment of insulin action despite normal IRS-1 phosphorylation (35, 36). Also, in IRS-1-deficient transgenic mice, impairment in insulin action has been observed in muscle, but not in liver, cells (37). Together, these findings suggest intracellular overlapping pathways and support the idea of a cellular specificity in insulin signaling machinery.

Interestingly, the C-terminal domain of insulin receptor {alpha}-subunit contains the same number of cysteine residues as the N-terminal extracellular ß-subunit. Their function in insulin receptor structure and hormone signaling was recently elucidated by Cheatham and Kahn, who suggested that Cys647 is only responsible for {alpha}-ß linkage, and the remaining residues participate in different types of interactions (38). In the present study in addition to challenging the role of Cys860, as discussed above, we have assessed the function of Cys795 and Cys872 of the extracellular domain of the ß-subunit and have shown that substitution of Ser for Cys in either position does not affect insulin binding, insulin receptor internalization, or IRS-1 phosphorylation.

In conclusion, the mutation of Cys860 for a Ser residue has allowed a dissection of the two major signaling pathway of the insulin receptor and an analysis of their possible implication in insulin receptor internalization and function.


   Acknowledgments
 
We thank Ms. G. Porcheron-Berthet for skilled technical assistance.


   Footnotes
 
1 This work was supported by Grant O46 Telethon, CNR P. F. Ingegneria Genetica, MURST 40% and 60%, and Grant 31–43409.95 from the Swiss National Science Foundation. Back

Received July 14, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rosen OM 1987 After insulin binds. Science 237:1452–1458[Abstract/Free Full Text]
  2. Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA, Cahill DA, Goldstein BJ, White MF 1991 Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352:73–77[CrossRef][Medline]
  3. Pronk GJ, McGlade J, Pelicci G, Pawson T, Bos JL 1993 Insulin-induced phosphorylation of the 46- and 52-kDa Shc proteins. J Biol Chem 268:5748–5753[Abstract/Free Full Text]
  4. Heller-Harrison RA, Morin M, Czech MP 1995 Insulin regulation of membrane-associated insulin receptor substrate 1. J Biol Chem 270:24442–24450[Abstract/Free Full Text]
  5. Burgess JW, Wada I, Ling N, Khan MN, Bergeron JJM, Posner BI 1992 Decrease in ß-subunit phosphotyrosine correlates with internalization and activation of the endosomal insulin receptor kinase. J Biol Chem 267:10077–10086[Abstract/Free Full Text]
  6. Kublaoui B, Lee J, Pilch P 1995 Dynamics of signaling during insulin-stimulated endocytosis of its receptor in adipocytes. J Biol Chem 270:59–65[Abstract/Free Full Text]
  7. Di Guglielmo GM, Baass PC, Ou W-J, Posner BI, Bergeron JJM 1994 Compartimentalization of Shc, Grb2 and mSos, and hyperphosphorylation of Raf-1 by EGF but not insulin in liver parenchyma. EMBO J 13:4269–4277[Medline]
  8. Carpentier J-L 1994 Insulin receptor internalization: molecular mechanisms and physiopathological implications. Diabetologia 37:S117–S124
  9. Backer JM, Shoelson SE, Haring E, White MF 1991 Insulin receptors internalize by a rapid, saturable pathway requiring receptor autophosphorylation and an intact juxtamembrane region. J Cell Biol 115:1535–1545[Abstract/Free Full Text]
  10. Carpentier J-L, Paccaud JP, Baecker J, Gilbert A, Orci L, Kahn CR 1993 Two steps of insulin receptor internalization depend on different domains of the ß-subunit. J Cell Biol 122:1243–1252[Abstract/Free Full Text]
  11. Hamer I, Renfrew-Haft C, Paccaud J-P, Maeder C, Taylor S, Carpentier J-L 1997 Dual role of a dileucine motif in insulin receptor endocytosis. J Biol Chem 272:21685–21691[Abstract/Free Full Text]
  12. Biener Y, Feinstein R, Mayak M, Kaburagi Y, Kadowaki T, Zick Y 1996 Annexin II is a novel player in insulin signal transduction. Possible association between annexin II phosphorylation and insulin receptor internalization. J Biol Chem 271:29489–29496[Abstract/Free Full Text]
  13. Laurino C, Maggi D, Andraghetti G, Cordera R Insulin receptor internalization: role of IRS-1 and annexin. 57th Annual Meeting and Scientific Session of American Diabetes Association, 1997, Boston, p 285A (Abstract)
  14. Leconte I, Carpentier J-L, Clauser E 1994 The functions of the human insulin receptor are affected in different ways by mutation of each of the four N-glycosylation sites in the ß subunit. J Biol Chem 269:18062–18071[Abstract/Free Full Text]
  15. Kaburagi Y, Momomura K, Yamamoto-Honda R, Tobe K, Tamori Y, Sakura H, Akanuma Y, Yazaki Y, Kadowaki T 1993 Site-directed mutagenesis of the juxtamembrane domain of the human insulin receptor. J Biol Chem 268:16610–16622[Abstract/Free Full Text]
  16. Kaburagi Y, Yamamoto-Honda R, Tobe K, Ueki K, Yachi M, Akanuma Y, Stephens RM, Kaplan D, Yazaki Y, Kadowaki T 1995 The role of NPXY motif in the insulin receptor in tyrosine phosphorylation of insulin receptor substrate-1 and Shc. Endocrinology 136:3437–3443[Abstract]
  17. He W, O’Neill TJ, Gustafson TA 1995 Distinct modes of interaction of Shc and insulin receptor substrate-1 with the insulin receptor NPEY region via non SH2 domains. J Biol Chem 270:23258–23262[Abstract/Free Full Text]
  18. Lai WH, Cameron PH, Doherty II J-J, Posner BI, Bergeron JJM 1989 Ligand-mediated autophosphorylation activity of the epidermal growth factor receptor during internalization. J Cell Biol 109:2751–2760[Abstract/Free Full Text]
  19. Khan MN, Baquiran G, Brule C, Burgess J, Foster B, Bergeron JJM, Posner B 1989 Internalization and activation of the rat liver insulin receptor kinase in vivo. J Biol Chem 264:12931–12940[Abstract/Free Full Text]
  20. Bevan AP, Burgess JW, Drake PG, Shaver A, Bergeron JJM, Posner BI 1995 Selective activation of the rat hepatic endosomal insulin receptor kinase. J Biol Chem 270:10784–10791[Abstract/Free Full Text]
  21. Maggi D, Andraghetti G, Cordera R 1995 A Ser for Cys mutation in the extracellular portion of insulin receptor ß subunit impairs the insulin-insulin receptor complex internalization in CHO cells. Biochem Biophys Res Commun 210:931–937[CrossRef][Medline]
  22. Andersson S, Davis DN, Dahlback H, Jornvall H, Russell DW 1989 Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264:8222–8229[Abstract/Free Full Text]
  23. Van Beveren C, van Straaten F, Curran T, Muller R, Verma IM 1983 Analysis of FBJ-MuSV provirus and c-fos (mouse) gene reveals that viral and cellular fos gene products have different carboxy termini. Cell 32:1241–1255[CrossRef][Medline]
  24. Tokunaga K, Taniguchi H, Yoda K, Shimizu M, Sakiyama S 1986 Nucleotide sequence of a full-length cDNA for mouse cytoskeletal ß-actin mRNA. Nucleic Acids Res 14:2829[Free Full Text]
  25. Ciaraldi TP, Goldberg M, Odom R, Stolpe M 1992 In vitro effects of amylin on carbohydrate metabolism in liver cells. Diabetes 41:975–981[Abstract]
  26. Pelicci G, Lanfrancone L, Grignani F, McGlade J, Cavallo F, Forni G, Nicoletti I, Grignani F, Pawson T, Pelicci PG 1992 A novel transforming protein (Shc) with an SH2 domain is implicated in mitogenic signal transduction. Cell 70:93–104[CrossRef][Medline]
  27. Yokote K, Mori S, Hansen J, McGlade J, Pawson T, Heldin KH, Claesson-Welsh L 1994 Direct interaction between Shc and the platelet-derived growth factor beta-receptor. J Biol Chem 269:15337–15443[Abstract/Free Full Text]
  28. Obermeier A, Lammers R, Weismuller K-H, Jung G, Schlessinger J, Ullrich A 1993 Identification of Trk binding sites for Shc and phosphatidylinositol 3'-kinase and formation of a multimeric signaling complex. J Biol Chem 268:22963–22966[Abstract/Free Full Text]
  29. Okabayashi Y, Sugimoto Y, Totty NF, Hsuan J, Kido Y, Sakaguci K, Gout I, Waterfield MD, Kasuga M 1996 Interaction of Shc with adaptor protein adaptins. J Biol Chem 271:5265–5269[Abstract/Free Full Text]
  30. Yamada K, Carpentier J-L, Cheatham B, Goncalves E, Shoelson SE, Kahn CR 1995 Role of the transmembrane domain and flanking amino acids in internalization and down-regulation of the insulin receptor. J Biol Chem 270:3115–3122[Abstract/Free Full Text]
  31. Thies RS, Webster NJ, McClain DA 1990 A domain of the insulin receptor required for endocytosis in rat fibroblasts. J Biol Chem 265:10132–10137[Abstract/Free Full Text]
  32. Sasaoka T, Draznin B, Leitner JW, Langlois WJ, Olefsky JM 1994 Shc is the predominant signaling molecule coupling insulin receptors to activation of guanine nucleotide releasing factor and p21ras-GTP formation. J Biol Chem 269:10734–10738[Abstract/Free Full Text]
  33. Yamauchi K, Pessin JE 1994 Insulin receptor substrate-1 (IRS-1) and Shc compete for a limited pool of Grb2 in mediating insulin downstream signaling. J Biol Chem 269:31107–31114[Abstract/Free Full Text]
  34. Harada S, Smith RM, Smith JA, White MF, Jarett L 1996 Insulin-induced egr-1 and c-fos expression in 32D cells requires insulin receptor, Shc and mitogen-activated protein kinase, but not insulin receptor substrate-1 and phosphatidylinositol 3-kinase activation. J Biol Chem 271:30222–30226[Abstract/Free Full Text]
  35. Krook A, Moller DE, Dib K, O’Rahilly S 1996 Two naturally occurring mutant insulin receptors phosphorylate insulin receptor substrate-1 (IRS-1) but fail to mediate the biological effects of insulin. Evidence that IRS-1 phosphorylation is not sufficient for normal insulin action. J Biol Chem 271:7134–7140[Abstract/Free Full Text]
  36. Krook A, Whitehead JP, Dobson S, Tavare J, Ouwens M, Maasen JA, Baker C, O’Rahilly S PI3-kinase activation alone is not sufficient for the mediation of insulin action. 16th International Diabetes Federation Congress, Helsinki, Finland, 1997, p 148 (Abstract)
  37. Yamauchi T, Tobe K, Tamemoto H, Ueki K, Kaburagi Y, Yamamoto-Honda R, Takahashi Y, Yoshizawa F, Aizawa S, Akanuma Y, Sonemberg N, Yazaki Y, Kadowaki T 1996 Insulin signalling and insulin actions in the muscles and livers of insulin-resistant, insulin receptor substrate 1-deficient mice. Mol Cell Biol 16:3074–3084[Abstract]
  38. Cheatham B, Kahn CR 1992 Cysteine 647 in the insulin receptor is required for normal covalent interaction between {alpha}- and ß-subunits and signal transduction. J Biol Chem 267:7108–7115[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 GlycobiologyHome page
K. Kabayama, T. Sato, F. Kitamura, S. Uemura, B. W. Kang, Y. Igarashi, and J.-i. Inokuchi
TNF{alpha}-induced insulin resistance in adipocytes as a membrane microdomain disorder: involvement of ganglioside GM3
Glycobiology, January 1, 2005; 15(1): 21 - 29.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Boura-Halfon, H. Voliovitch, R. Feinstein, K. Paz, and Y. Zick
Extracellular Matrix Proteins Modulate Endocytosis of the Insulin Receptor
J. Biol. Chem., April 25, 2003; 278(18): 16397 - 16404.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maggi, D.
Right arrow Articles by Cordera, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maggi, D.
Right arrow Articles by Cordera, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals