| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Division of Biomedical Sciences, University of California, Riverside, California 92521-0121
Address all correspondence to: Dr. Ameae M. Walker, Division of Biomedical Sciences, University of California, Riverside, California 92521-0121. E-mail: ameae.walker{at}ucr.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To further investigate the functions of phosphorylated PRL and the mechanism by which it antagonizes the unmodified form, we set out to determine whether mutation of the normally phosphorylated serine to an acidic residue of similar mass to phosphoserine, would produce a molecular mimic of phosphorylated PRL.
Previous work from our laboratory has demonstrated that rPRL is primarily phosphorylated on serine 177 (7), which is an absolutely conserved residue in all PRLs in a very highly conserved region of the molecule (8). The equivalent residue in human PRL (hPRL) is serine 179 (8). Because of the potential therapeutic value of a PRL antagonist, we chose to make recombinant hPRL rather than rPRL mutants. Thus, serine 179 in hPRL was mutated to either glutamate or aspartate.
In addition, because of the dramatic effect of phosphorylation of serine 177/179 on biological activity, we determined the importance of the unmodified serine on the growth-promoting activity of PRL. This was accomplished by mutating the serine to two neutral amino acids of reasonably similar size to serine: alanine and valine.
We report the production of a highly effective antagonist by mutation of serine 179 to aspartate, and in so doing reconfirm the importance of phosphorylation at this site. In addition, it appears that the serine 179 residue in the unmodified molecule is crucial to the growth-promoting activity of PRL.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Site-directed mutagenesis was performed using a Muta-Gene in vitro mutagenesis kit (Bio-Rad, Hercules, CA). One primer (ACGCAGGGATGNKATAAAATCG) was designed to substitute serine 179 with glutamate, aspartate, alanine, or valine. A second primer (CGTGGCCCCCATATGTTGCCCATCTG) was used to facilitate cloning into an expression vector via the production of an NdeI site. Appropriate mutations were confirmed by sequencing. Mutated DNA was subcloned into pT7-SCII (U.S. Biochemical Corp.), which was placed into E. coli BL21 (DE3) for protein expression.
Protein expression
Cells were cultured in Luria broth with ampicillin (200 µg/ml)
overnight at 37 C. The overnight culture was diluted 10 times in the
same medium, aliquoted into 3-ml amounts, and incubated at 37 C with
agitation until the OD 600 nm reached 0.55–0.6. Isopropyl
ß-thiogalactoside (final concentration, 0.5 mM) was added
to the culture to induce expression of the protein. Optimizing
experiments determined that the best yield coupled to the best purity
was obtained after a 2-h induction. The bacteria (3 ml) were pelleted
and resuspended in 500 µl ice-cold 50 mM Tris-HCl, pH
7.5. They were then lysed using a MicroUltrasonic cell disrupter
(Kontes, Plainview, NJ) (five 15-sec pulses at setting 9 on ice, with a
30-sec pause between pulses) and then centrifuged at 14,000 x
g for 10 min at 4 C.
Expressed PRLs were primarily in inclusion bodies that formed the 14,000 x g pellet. After washing in ice-cold 50 mM Tris-HCl, pH 7.5, they were denatured in 8 M urea-1% ß-mercaptoethanol in 0.2 M sodium phosphate, pH 7, and the resulting solution was dialyzed against 20 vol 50 mM NH4HCO3, with eight changes in 3 days at 4 C, with a final protein concentration of 0.1 mg/ml.
The amount of protein present was determined either by quantitative gel densitometry by comparison to hPRL standards or by using the NanoOrange kit (Molecular Probes, Eugene, OR). In the latter instance, NIDDK hPRL B-3 was dissolved in 50 mM NH4HCO3 and serially diluted to produce the reference standard curve. Both methods gave comparable results. Highly purified BSA (Sigma Chemical Co., St. Louis, MO) was added (to 0.05%) as soon as possible to reduce recombinant protein losses caused by adherence or proteolysis.
RIA analysis of the recombinant PRLs
Recognition of the mutant PRLs compared with two standard NIDDK
PRLs, hPRL I-8 and rPRL B7, in a commercially available RIA was used as
a measure of appropriate folding. Each protein was dissolved first in
50 mM NH4HCO3, accurately
quantified, and then diluted in the O calibrator provided with the kit.
The kit was purchased from Diagnostic Products Corp. (Los Angeles,
CA).
Endotoxin analysis of the preparations
Endotoxin contamination of the PRLs was first tested using the
E-TOXATE kit from Sigma and by gel analysis for bacterial lysate
endotoxins (9). Briefly, for the latter, proteinase K-deproteinated
samples were run on a 14% SDS reducing polyacrylamide gel and then
silver stained to detect endotoxin bands.
Preparations were also tested for toxicity at concentrations up to 0.5 µg/ml by analyzing changes in cell proliferation over a 72-h period in bone SaOs cells (American Type Culture Collection).
In addition, parallel preparations of the various mutants and the wild-type PRL were made so that on each occasion the wild-type PRL could be analyzed for biological activity relative to the other preparations as well as to NIDDK standards in the Nb2 bioassay.
Dephosphorylation of standard hPRL
Standard hPRL I-8 was exposed to acid phosphatase (from
human semen; Sigma) at a ratio of 10 µg to 1 U enzyme in 0.1
M sodium citrate buffer, pH 5, for 2 h at 37 C.
Control aliquots of the hormone alone and enzyme alone were incubated
in buffer for the same period and at the same temperature. After 2
h of incubation, the samples were diluted 40-fold in Dulbecco’s PBS
(DPBS) containing 0.1% BSA (highly purified from Sigma). Each sample
(enzyme-treated, buffer-incubated, and enzyme in buffer) was sterilized
by filtration and stored frozen at -20 C until further dilution in 0%
FBS-10% horse serum (HS)-Nb2 assay medium.
Biological activity of the wild-type, mutant PRLs and
dephosphorylated NIDDK standard PRL
The Nb2 bioassay was performed as described by Tanaka
et al. (10). Briefly, Nb2 T lymphoma cells (originally
obtained from Henry Friesen, now at Medical Research Council, Ottawa,
Canada) were maintained in Fisher’s medium containing 10% FBS, 10%
HS, 0.1 mM NaHCO3, 0.1 mM
ß-mercaptoethanol, and penicillin (20 U/ml)/streptomycin (20
µg/ml). Before the assay, cells were transferred to 1% FBS-10% HS
medium overnight. The cells were then plated onto 96-well plates in 100
µl 0% FBS-10% HS medium/well. Different concentrations and
combinations of PRLs, diluted in 0% FBS-10% HS medium, were added to
give a total volume of 200 µl/well. For measurement of proliferation,
5000 cells/well were used. For studies of antagonism, 1000 cells/well
were used to increase competition for the receptors. The number of
cells required to produce receptor-limiting conditions during a 3-day
incubation was determined empirically. In each experiment (5000 or 1000
cells/well), the response to wild-type PRL alone was used as a positive
control and a measure of comparability among experiments. Cell number
was assessed 72 h after plating using an MTS assay (1, 11).
Briefly, MTS dye
[3(4,5-dimethylthiazol-2-yl)-5(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolin,
Promega Corp., Madison, WI] at 2 mg/ml in DPBS was mixed with
phenazine methosulfate (Sigma; 0.92 mg/ml DPBS) at a ratio of 20:1
(vol/vol). Twenty microliters of the mixture were then added to the 200
µl medium in each well, and the plate was incubated for 2 h at
37 C before reading the absorbance at 492 nm in an enzyme immunoassay
plate reader (Bio-Rad). Results are expressed as the absorbance in the
test wells minus the absorbance in the wells containing cells but no
added PRL.
Within each assay, each test substance, combination, or amount was assayed in quadruplicate. Each assay result was replicated at least twice with each preparation of protein, and each result was replicated with at least two, and in most instances three, separate preparations of protein.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
shows a reducing
SDS protein gel of the recombinant PRLs. The yields for each PRL were
very similar, although losses during processing were slightly greater
for the glutamate and aspartate mutants, a result perhaps attributable
to the small increase in negative charge on these molecules. Based on
densitometric scans of Coomassie blue-stained gels, the purity of the
PRL preparations was greater than 95% when using a 2-h induction
period with isopropyl ß-thiogalactoside. Longer induction periods led
to an increase in higher mol wt contaminants in the inclusion bodies
with no significant increases in final yield. Nonreducing gels showed
no evidence of oligomeric forms after folding (data not shown).
|
Biological activity
As can be seen in Fig. 2, the
recombinant wild-type PRL had greater biological activity in the Nb2
bioassay than did the NIDDK hPRL B-3 preparation. This result attests
to 1) the absence, or very low levels, of endotoxin in the preparation;
and 2) appropriate folding of the molecule during the dialysis period.
Accurate comparisons were assured by dissolution of the NIDDK standard
in 50 mM NH4HCO3 and the use of
this to produce both the bioassay stock and the standard curve in the
NanoOrange protein assay.
|
. Recombinant wild-type hormone produced in E.
coli, by contrast, contains no phosphorylated or glycosylated
hormone, and hence, a larger proliferative response to a recombinant
preparation can be obtained.
That some of the increased activity is probably due to the absence of
phosphorylated hormone in the recombinant wild-type PRL is demonstrated
in Fig. 3. For this experiment, a similar
preparation of human pituitary PRL, hPRL I-8, which has less than 10%
phosphorylated hormone, was subjected to dephosphorylation by acid
phosphatase. As can be seen, dephosphorylation of the I-8 preparation
increased its ability to stimulate the proliferation of Nb2 cells.
Assay of enzyme alone showed no ability to stimulate Nb2 cell
proliferation (data not shown).
|
and 3 and the wild-type curves in
Figs. 4 and 5 also show evidence of PRL self
antagonism at high concentrations (16). Unlike the report by Goffin
et al. (16), however, this self antagonism was observed
using human hormone and rat cells. In other experiments, using doses up
to only 1000 pg/ml (Figs. 6 and 7), self antagonism was not reached. The
degree of self antagonism observed was related to the dose necessary
for the peak response, which varied among different sets of cells.
Despite all attempts to standardize all apparent possible variables in
the cultures, some variation in peak response (400 or 800 pg/ml) still
persisted.
|
|
|
|
, A and B). When either was
titrated against the wild-type recombinant, a dose-related inhibition
of proliferation vs. wild-type PRL alone was observed. The
aspartate mutant was a more potent antagonist than the glutamate
mutant, with 200 pg/ml aspartate mutant inhibiting the growth response
to 400 pg/ml wild-type PRL by 75%. In both instances the mutants
showed titration curves apparently consistent with noncompetitive
inhibition (see Discussion).
When tested alone for intrinsic agonist activity, neither the aspartate
nor the glutamate mutant showed any ability to stimulate Nb2 cell
proliferation (Fig. 5).
Importance of serine 179 to bioactivity
Because of the major effects of phosphorylation on the
proliferative activity of PRL and its mimicry by the substitution of
glutamate or aspartate at serine 179, we examined the role of serine
179 itself in producing proliferative activity. This was accomplished
by conservatively mutating it to either alanine or valine. Contrary to
our initial expectations, the alanine mutant was essentially without
biological activity, whereas the valine mutant proved to be a mild
agonist (Fig. 6). When titrated with recombinant wild type PRL, no
additive proliferative activity was seen for the alanine mutant, but
some additive proliferative activity was seen at low concentrations of
wild-type PRL for the valine mutant (Fig. 7, A and B). When the alanine
and valine mutants were titrated with wild-type under receptor-limiting
conditions (i.e. using 1000 cells/well), both were found to
be mild antagonists, indicating that they could bind to the receptor to
some degree (data not shown).
RIA analysis
Figure 8 illustrates the
cross-reactivity of an anti-hPRL antibody with the recombinant proteins
and with NIDDK standard human and rat PRL. The degree of antibody
recognition can be used as a monitor of three-dimensional structure
and, therefore, provides some measure of appropriate molecular folding.
As can be seen, the aspartate mutant, the NIDDK standard, hPRL I-8, the
alanine mutant, and the assay standard were all very similarly
recognized. This suggests that they each have average conformations
that are very similar. The valine mutant and wild-type proteins were
recognized somewhat more efficiently by the antibody, and the glutamate
mutant was recognized much less efficiently, suggesting changes in
conformation vs. that of the assay standard. According to
the manufacturers, the assay standards were normal preparations of
circulating PRL, containing posttranslationally modified forms. As can
be seen, the assay is also fairly sensitive to structural changes, as
it was entirely unable to recognize rPRL at concentrations up to 200
ng/ml.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
With the substitution of alanine for serine, we expected very little effect on agonist activity. To our surprise this substitution negated essentially all agonist activity. The RIA results attest to appropriate folding of the alanine-substituted molecule. It appears, therefore, that the serine is crucial for appropriate PRL-receptor interactions. Substitution of another neutral, but somewhat more bulky than alanine, amino acid (valine) produced a partial agonist. It seems likely, therefore, that the physical bulk of the serine is of significance as is perhaps the hydroxyl moiety.
When this serine is phosphorylated, an antagonist to nonphosphorylated PRL is produced (1). When phosphoserine was mimicked in the present study by mutating the serine to glutamate or aspartate, an antagonist was also the result. In the case of naturally phosphorylated PRL, titrations and dephosphorylation experiments have shown that relatively low percentages of phosphorylated PRL are required to negate the proliferative activity of nonphosphorylated PRL (1). Likewise, the aspartate mutant is a more potent antagonist than the wild type is an agonist. The mechanisms by which this relative potency may be achieved are varied, in part because what is being measured in an Nb2 bioassay is cell number at the end of a 3-day incubation. During the 3-day incubation, several doublings have taken place, and PRL receptors have recycled to the cell surface many times. Included in the possibilities are a significantly higher affinity of the aspartate mutant for the receptor or both receptors, induction of apoptosis by the aspartate mutant, or inhibition of signal amplification by the aspartate mutant (see below).
However the potency of the aspartate antagonist is achieved, it is apparently not due to a major ligand conformational change, as the aspartate mutant is seen as readily in the RIA as the assay standard. The glutamate mutant, on the other hand, has a significantly altered conformation that may well affect binding to a second receptor.
Both the glutamate and aspartate mutants show titration curves consistent with noncompetitive inhibition, i.e. increased concentrations of wild-type do not overcome the inhibition. This apparent noncompetitive inhibition, however, is probably due to the self antagonism of the wild type, i.e. when more agonist is added past the peak response, a significant amount of this will be producing one to one wild-type to receptor complexes and not one to two signal transducing complexes.
The mechanism by which phosphorylated PRL or its mimic acts as an
antagonist is unknown. To date, antagonists for GH and PRL have been
designed by mutating a region of these molecules involved in the
binding of a second receptor, thus preventing receptor dimerization and
signal transduction (16, 23). Serine 179 is in the region of the
molecule that forms site 1 (22), and it is not immediately obvious how
it might affect site 2 binding, if, in fact, it does. The
conformational changes that could result from a bulky phosphate group,
however, may well affect relatively distant parts of the molecule. When
one creates a helical wheel representation (24) of helix 4 (Fig. 9) and makes the assumption that residues
found critical to biological activity by others directly participate in
receptor binding (R177, K181, and K187) (18, 19), then one can
appreciate that serine 179 lies on the opposite side of the helix. In
the model of Goffin et al. (22) this would face helix 3. If
it stays in this orientation after phosphorylation, then it could well
affect helix 3 orientation and, hence, site 2 binding. However, the
presence of a large phosphate group in the hydrophobic interior of a
molecule seems unlikely. It seems more likely that phosphorylation
significantly changes the orientation of helix 4 and the way it
interacts with the receptor. Perhaps the altered conformation of the
receptor under these circumstances prevents signal transduction and
amplification. If the second receptor has a fast on and off rate, as
Gertler has demonstrated it has in homologous systems (25), and the
one-receptor one-ligand complex, therefore, interacts with multiple
second receptors to amplify the signal, the inability to amplify the
signal with the phosphorylated hormone/aspartate mutant may account for
the apparent potency of the antagonist. This possibility remains the
subject of future investigations. In this regard, there is precedent
for the production of members of the PRL family that can bind to, but
not activate, the PRL receptor (26, 27).
|
Molecular mimicry of phosphorylation has been successfully applied to a variety of enzymes turned constitutively on or off by phosphorylation (28, 29, 30). In one instance, the structural changes observed after phosphorylation have also been shown to be accurately reproduced by an aspartate mutant (31).
Molecular mimicry of phosphorylated PRL has been claimed before, but for the bovine hormone (32). In this instance, serine 90 in bPRL, a site previously shown to be posttranslationally modified (33) was mutated to glutamate. When mutated to glutamate, the resultant bPRL, like preparations of phosphorylated bPRL, had reduced ability to stimulate Nb2 cell proliferation (32). This, however, is true of many single amino acid substitutions in bPRL (18). In the current manuscript, we describe the production of a molecular mimic of the phosphorylated hormone, which, like the phosphorylated hormone, very effectively antagonizes growth promotion in response to unmodified hormone. This positive measure of activity is a stronger indication of mimicry.
The production of a recombinant mimic of the phosphorylated hormone has several advantages. First, it can relatively easily be produced in large quantities, entirely free of its nonphosphorylated counterpart. Second, it cannot be dephosphorylated either during in vitro or in vivo experiments, thus making interpretation of experimental data more straightforward. When potentially administered therapeutically, the mimic cannot be converted to the growth-promoting form of PRL. Although we have demonstrated that phosphorylated PRL is actually very resistant to phosphatase activity, requiring 2- to 4-h incubations (i.e. many fold the half-life of PRL in serum) in concentrated enzyme to remove the phosphate (1, 2), this advantage may be significant with slow release or extended lifetime forms of the hormone.
As it is now known that a variety of extrapituitary tissues produce PRL (reviewed in Ref.34) and that a number of these also respond to or have the potential to respond to PRL (35), there is growing acceptance and accumulating evidence that autocrine/paracrine PRL may contribute to the progression of certain diseases, such as breast cancer (36, 37, 38, 39, 40, 41) and lymphomas (42). Although the secretion of all forms of PRL from the anterior pituitary is readily controlled by existing pharmaceuticals, a need is now appreciated for a PRL receptor antagonist that can negate autocrine/paracrine growth promotion in these other tissues.
In summary, we have produced a molecular mimic of phosphorylated PRL that maintains the antagonist properties of the phosphorylated hormone. This pseudophosphorylated PRL can now be used to study many aspects of the physiology of PRL and has the potential to be a useful therapeutic.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 25, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  C. V. Helena, D. T. McKee, R. Bertram, A. M. Walker, and M. E. Freeman The Rhythmic Secretion of Mating-Induced Prolactin Secretion Is Controlled by Prolactin Acting Centrally Endocrinology, July 1, 2009; 150(7): 3245 - 3251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Deng, E. Ueda, K. E. Chen, C. Bula, A. W. Norman, R. A. Luben, and A. M. Walker Prolactin Blocks Nuclear Translocation of VDR by Regulating Its Interaction with BRCA1 in Osteosarcoma Cells Mol. Endocrinol., February 1, 2009; 23(2): 226 - 236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Svensson, K. Bondensgaard, L. Norskov-Lauritsen, L. Christensen, P. Becker, M. D. Andersen, M. J. Maltesen, K. D. Rand, and J. Breinholt Crystal Structure of a Prolactin Receptor Antagonist Bound to the Extracellular Domain of the Prolactin Receptor J. Biol. Chem., July 4, 2008; 283(27): 19085 - 19094. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Williams, A. DeGuzman, H. Dang, M. Kawaminami, T. W. C. Ho, D. G. Carter, and A. M. Walker Common and specific effects of the two major forms of prolactin in the rat testis Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1795 - E1803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Comitato, C. Spampanato, C. Chakarova, D. Sanges, S. S. Bhattacharya, and V. Marigo Mutations in splicing factor PRPF3, causing retinal degeneration, form detrimental aggregates in photoreceptor cells Hum. Mol. Genet., July 15, 2007; 16(14): 1699 - 1707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B C Nephew, J Amico, H M Cai, A M Walker, and R S Bridges Intracerebroventricular administration of the prolactin (PRL) receptor antagonist, S179D PRL, disrupts parturition in rats Reproduction, July 1, 2007; 134(1): 155 - 160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. K. Ueda, H.-L. Lo, P. Bartolini, and A. M. Walker S179D Prolactin Primarily Uses the Extrinsic Pathway and Mitogen-Activated Protein Kinase Signaling to Induce Apoptosis in Human Endothelial Cells Endocrinology, October 1, 2006; 147(10): 4627 - 4637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ueda, U. Ozerdem, Y.-H. Chen, M. Yao, K. T. Huang, H. Sun, M. Martins-Green, P. Bartolini, and A. M Walker A molecular mimic demonstrates that phosphorylated human prolactin is a potent anti-angiogenic hormone. Endocr. Relat. Cancer, March 1, 2006; 13(1): 95 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Wu, E. Ginsburg, B. K. Vonderhaar, and A. M. Walker S179D Prolactin Increases Vitamin D Receptor and p21 through Up-regulation of Short 1b Prolactin Receptor in Human Prostate Cancer Cells Cancer Res., August 15, 2005; 65(16): 7509 - 7515. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Naylor, S. R. Oakes, M. Gardiner-Garden, J. Harris, K. Blazek, T. W. C. Ho, F. C. Li, D. Wynick, A. M. Walker, and C. J. Ormandy Transcriptional Changes Underlying the Secretory Activation Phase of Mammary Gland Development Mol. Endocrinol., July 1, 2005; 19(7): 1868 - 1883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Goffin, S. Bernichtein, P. Touraine, and P. A. Kelly Development and Potential Clinical Uses of Human Prolactin Receptor Antagonists Endocr. Rev., May 1, 2005; 26(3): 400 - 422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Tan, D. A. Johnson, W. Wu, L. Zeng, Y. H. Chen, W. Y. Chen, B. K. Vonderhaar, and A. M. Walker Unmodified Prolactin (PRL) and S179D PRL-Initiated Bioluminescence Resonance Energy Transfer between Homo- and Hetero-Pairs of Long and Short Human PRL Receptors in Living Human Cells Mol. Endocrinol., May 1, 2005; 19(5): 1291 - 1303. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Schroeder, J. L. Brockman, A. M. Walker, and L. A. Schuler Inhibition of Prolactin (PRL)-Induced Proliferative Signals in Breast Cancer Cells by a Molecular Mimic of Phosphorylated PRL, S179D-PRL Endocrinology, December 1, 2003; 144(12): 5300 - 5307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bernichtein, C. Kayser, K. Dillner, S. Moulin, J. J. Kopchick, J. A. Martial, G. Norstedt, O. Isaksson, P. A. Kelly, and V. Goffin Development of Pure Prolactin Receptor Antagonists J. Biol. Chem., September 19, 2003; 278(38): 35988 - 35999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Naylor, E. Ginsburg, T. P. Iismaa, B. K. Vonderhaar, D. Wynick, and C. J. Ormandy The Neuropeptide Galanin Augments Lobuloalveolar Development J. Biol. Chem., August 1, 2003; 278(31): 29145 - 29152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A M Walker Unmodified and phosphorylated prolactin and gamma delta T cell development and function Lupus, October 1, 2001; 10(10): 735 - 741. [Abstract] [PDF]
|
|
|
|
|
|
S. Bernichtein, S. Kinet, S. Jeay, M. Llovera, D. Madern, J. A. Martial, P. A. Kelly, and V. Goffin S179D-Human PRL, a Pseudophosphorylated Human PRL Analog, Is an Agonist and Not an Antagonist Endocrinology, September 1, 2001; 142(9): 3950 - 3963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Xu, E. Kreye, C. B. Kuo, and A. M. Walker A Molecular Mimic of Phosphorylated Prolactin Markedly Reduced Tumor Incidence and Size When DU145 Human Prostate Cancer Cells Were Grown in Nude Mice Cancer Res., August 1, 2001; 61(16): 6098 - 6104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Bridges, B. A. Rigero, E. M. Byrnes, L. Yang, and A. M. Walker Central Infusions of the Recombinant Human Prolactin Receptor Antagonist, S179D-PRL, Delay the Onset of Maternal Behavior in Steroid-Primed, Nulliparous Female Rats Endocrinology, February 1, 2001; 142(2): 730 - 739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Coss, L. Yang, C. B. Kuo, X. Xu, R. A. Luben, and A. M. Walker Effects of prolactin on osteoblast alkaline phosphatase and bone formation in the developing rat Am J Physiol Endocrinol Metab, December 1, 2000; 279(6): E1216 - E1225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Freeman, B. Kanyicska, A. Lerant, and G. Nagy Prolactin: Structure, Function, and Regulation of Secretion Physiol Rev, October 1, 2000; 80(4): 1523 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Coss, C. B. Kuo, L. Yang, P. Ingleton, R. Luben, and A. M. Walker Dissociation of Janus Kinase 2 and Signal Transducer and Activator of Transcription 5 Activation after Treatment of Nb2 Cells with a Molecular Mimic of Phosphorylated Prolactin Endocrinology, November 1, 1999; 140(11): 5087 - 5094. [Abstract] [Full Text]
|
|
|
|
|
|
S. Kinet, S. Bernichtein, P. A. Kelly, J. A. Martial, and V. Goffin Biological Properties of Human Prolactin Analogs Depend Not Only on Global Hormone Affinity, but Also on the Relative Affinities of Both Receptor Binding Sites J. Biol. Chem., September 10, 1999; 274(37): 26033 - 26043. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
