help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, T.-J.
Right arrow Articles by Walker, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, T.-J.
Right arrow Articles by Walker, A. M.
Endocrinology Vol. 139, No. 2 609-616
Copyright © 1998 by The Endocrine Society


ARTICLES

Development of Recombinant Human Prolactin Receptor Antagonists by Molecular Mimicry of the Phosphorylated Hormone1

Tian-Jian Chen2, Chiaoyun Benson Kuo2, Kolistin F. Tsai, Jo-Wen Liu, Dih-Yih Chen and Ameae M. Walker

Division of Biomedical Sciences, University of California, Riverside, California 92521-0121

Address all correspondence to: Dr. Ameae M. Walker, Division of Biomedical Sciences, University of California, Riverside, California 92521-0121. E-mail: ameae.walker{at}ucr.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies have demonstrated that naturally phosphorylated PRL antagonizes the growth-promoting effects of unmodified PRL in two different PRL-responsive cell lines. In this study our aim was to produce a molecular mimic of phosphorylated PRL by substituting a fairly bulky, negatively charged amino acid (glutamate or aspartate) for the normally phosphorylated serine [serine 179 in human PRL (hPRL)]. In addition, because of the marked effect of phosphorylation on biological activity, we investigated the importance of the unmodified serine in the growth-promoting activity of PRL. hPRL complementary DNA was obtained from the American Type Culture Collection and subcloned into pT7-SCII after site-directed mutagenesis using the deoxyuridine approach. Proteins were expressed in Escherichia coli BL21 (DE3) and were primarily found in inclusion bodies. Agonist and antagonist activities of each serine 179 mutant were assessed using the Nb2 bioassay. Compared with standard hPRL, the recombinant wild-type was more active in the Nb2 assay, attesting to both the absence, or low level, of endotoxin contamination in preparations from these cells and the appropriate folding of the molecule. The aspartate and glutamate mutants had no intrinsic agonist activity, but both antagonized the growth-promoting activity of wild-type PRL, with the aspartate mutant proving to be a very effective antagonist. Two hundred picograms per ml of the aspartate mutant negated 75% of the growth response to 400 pg/ml wild-type PRL. When serine 179 was mutated to alanine or valine, mutant PRLs with 0% and 14% of the biological activity of wild-type PRL, respectively, were produced. These results demonstrate 1) that molecular mimicry of the phosphorylated hormone does produce a PRL antagonist, and 2) that the serine at position 179 is crucial to the growth-promoting activity of PRL. The aspartate mutant can now be used to study many aspects of the physiology of PRL.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
WE HAVE previously demonstrated that naturally phosphorylated rat PRL (rPRL) antagonizes the growth-promoting effects of unmodified PRL in 1) the Nb2 T lymphoma assay (1) and 2) the autocrine regulation of GH3 cell proliferation (2). Others, however, have failed to find evidence of antagonism in the Nb2 assay using isolated preparations of more negatively charged bovine PRL (bPRL), but have found that dephosphorylation of bPRL increased Nb2 biological activity (3). With the rat hormone, we found that the ratio of unmodified to phosphorylated PRL in large part determines the response to administered hormone. At high ratios of unmodified to phosphorylated PRL, cell proliferation is promoted (1), whereas at low ratios, proliferation is inhibited (1, 2) and, in the case of GH3 cells, differentiation is promoted (4). The ratio of unmodified to phosphorylated PRL produced by the pituitary varies reproducibly according to the stage of the estrous cycle (5) and during pregnancy and pseudopregnancy (6), with elevations in estrogen producing a more mitogenic PRL (5, 6).

To further investigate the functions of phosphorylated PRL and the mechanism by which it antagonizes the unmodified form, we set out to determine whether mutation of the normally phosphorylated serine to an acidic residue of similar mass to phosphoserine, would produce a molecular mimic of phosphorylated PRL.

Previous work from our laboratory has demonstrated that rPRL is primarily phosphorylated on serine 177 (7), which is an absolutely conserved residue in all PRLs in a very highly conserved region of the molecule (8). The equivalent residue in human PRL (hPRL) is serine 179 (8). Because of the potential therapeutic value of a PRL antagonist, we chose to make recombinant hPRL rather than rPRL mutants. Thus, serine 179 in hPRL was mutated to either glutamate or aspartate.

In addition, because of the dramatic effect of phosphorylation of serine 177/179 on biological activity, we determined the importance of the unmodified serine on the growth-promoting activity of PRL. This was accomplished by mutating the serine to two neutral amino acids of reasonably similar size to serine: alanine and valine.

We report the production of a highly effective antagonist by mutation of serine 179 to aspartate, and in so doing reconfirm the importance of phosphorylation at this site. In addition, it appears that the serine 179 residue in the unmodified molecule is crucial to the growth-promoting activity of PRL.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subcloning and site-directed mutagenesis
The hPRL complementary DNA clone (pBR-hPRL) was obtained from the American Type Culture Collection (Rockville, MD). A 686-bp PpuMI fragment, which contained the full hPRL-coding region, was subcloned into the SmaI site of pUC118 (U.S. Biochemical Corp., Cleveland, OH) in which the BamHI site was nullified. This recombinant was transformed into Escherichia coli CJ236 cells, which produce deoxyuridine (dU)-containing single-stranded DNA after infection with M13K07 helper phage and incubation in 0.25 µg/ml uridine.

Site-directed mutagenesis was performed using a Muta-Gene in vitro mutagenesis kit (Bio-Rad, Hercules, CA). One primer (ACGCAGGGATGNKATAAAATCG) was designed to substitute serine 179 with glutamate, aspartate, alanine, or valine. A second primer (CGTGGCCCCCATATGTTGCCCATCTG) was used to facilitate cloning into an expression vector via the production of an NdeI site. Appropriate mutations were confirmed by sequencing. Mutated DNA was subcloned into pT7-SCII (U.S. Biochemical Corp.), which was placed into E. coli BL21 (DE3) for protein expression.

Protein expression
Cells were cultured in Luria broth with ampicillin (200 µg/ml) overnight at 37 C. The overnight culture was diluted 10 times in the same medium, aliquoted into 3-ml amounts, and incubated at 37 C with agitation until the OD 600 nm reached 0.55–0.6. Isopropyl ß-thiogalactoside (final concentration, 0.5 mM) was added to the culture to induce expression of the protein. Optimizing experiments determined that the best yield coupled to the best purity was obtained after a 2-h induction. The bacteria (3 ml) were pelleted and resuspended in 500 µl ice-cold 50 mM Tris-HCl, pH 7.5. They were then lysed using a MicroUltrasonic cell disrupter (Kontes, Plainview, NJ) (five 15-sec pulses at setting 9 on ice, with a 30-sec pause between pulses) and then centrifuged at 14,000 x g for 10 min at 4 C.

Expressed PRLs were primarily in inclusion bodies that formed the 14,000 x g pellet. After washing in ice-cold 50 mM Tris-HCl, pH 7.5, they were denatured in 8 M urea-1% ß-mercaptoethanol in 0.2 M sodium phosphate, pH 7, and the resulting solution was dialyzed against 20 vol 50 mM NH4HCO3, with eight changes in 3 days at 4 C, with a final protein concentration of 0.1 mg/ml.

The amount of protein present was determined either by quantitative gel densitometry by comparison to hPRL standards or by using the NanoOrange kit (Molecular Probes, Eugene, OR). In the latter instance, NIDDK hPRL B-3 was dissolved in 50 mM NH4HCO3 and serially diluted to produce the reference standard curve. Both methods gave comparable results. Highly purified BSA (Sigma Chemical Co., St. Louis, MO) was added (to 0.05%) as soon as possible to reduce recombinant protein losses caused by adherence or proteolysis.

RIA analysis of the recombinant PRLs
Recognition of the mutant PRLs compared with two standard NIDDK PRLs, hPRL I-8 and rPRL B7, in a commercially available RIA was used as a measure of appropriate folding. Each protein was dissolved first in 50 mM NH4HCO3, accurately quantified, and then diluted in the O calibrator provided with the kit. The kit was purchased from Diagnostic Products Corp. (Los Angeles, CA).

Endotoxin analysis of the preparations
Endotoxin contamination of the PRLs was first tested using the E-TOXATE kit from Sigma and by gel analysis for bacterial lysate endotoxins (9). Briefly, for the latter, proteinase K-deproteinated samples were run on a 14% SDS reducing polyacrylamide gel and then silver stained to detect endotoxin bands.

Preparations were also tested for toxicity at concentrations up to 0.5 µg/ml by analyzing changes in cell proliferation over a 72-h period in bone SaOs cells (American Type Culture Collection).

In addition, parallel preparations of the various mutants and the wild-type PRL were made so that on each occasion the wild-type PRL could be analyzed for biological activity relative to the other preparations as well as to NIDDK standards in the Nb2 bioassay.

Dephosphorylation of standard hPRL
Standard hPRL I-8 was exposed to acid phosphatase (from human semen; Sigma) at a ratio of 10 µg to 1 U enzyme in 0.1 M sodium citrate buffer, pH 5, for 2 h at 37 C. Control aliquots of the hormone alone and enzyme alone were incubated in buffer for the same period and at the same temperature. After 2 h of incubation, the samples were diluted 40-fold in Dulbecco’s PBS (DPBS) containing 0.1% BSA (highly purified from Sigma). Each sample (enzyme-treated, buffer-incubated, and enzyme in buffer) was sterilized by filtration and stored frozen at -20 C until further dilution in 0% FBS-10% horse serum (HS)-Nb2 assay medium.

Biological activity of the wild-type, mutant PRLs and dephosphorylated NIDDK standard PRL
The Nb2 bioassay was performed as described by Tanaka et al. (10). Briefly, Nb2 T lymphoma cells (originally obtained from Henry Friesen, now at Medical Research Council, Ottawa, Canada) were maintained in Fisher’s medium containing 10% FBS, 10% HS, 0.1 mM NaHCO3, 0.1 mM ß-mercaptoethanol, and penicillin (20 U/ml)/streptomycin (20 µg/ml). Before the assay, cells were transferred to 1% FBS-10% HS medium overnight. The cells were then plated onto 96-well plates in 100 µl 0% FBS-10% HS medium/well. Different concentrations and combinations of PRLs, diluted in 0% FBS-10% HS medium, were added to give a total volume of 200 µl/well. For measurement of proliferation, 5000 cells/well were used. For studies of antagonism, 1000 cells/well were used to increase competition for the receptors. The number of cells required to produce receptor-limiting conditions during a 3-day incubation was determined empirically. In each experiment (5000 or 1000 cells/well), the response to wild-type PRL alone was used as a positive control and a measure of comparability among experiments. Cell number was assessed 72 h after plating using an MTS assay (1, 11). Briefly, MTS dye [3(4,5-dimethylthiazol-2-yl)-5(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolin, Promega Corp., Madison, WI] at 2 mg/ml in DPBS was mixed with phenazine methosulfate (Sigma; 0.92 mg/ml DPBS) at a ratio of 20:1 (vol/vol). Twenty microliters of the mixture were then added to the 200 µl medium in each well, and the plate was incubated for 2 h at 37 C before reading the absorbance at 492 nm in an enzyme immunoassay plate reader (Bio-Rad). Results are expressed as the absorbance in the test wells minus the absorbance in the wells containing cells but no added PRL.

Within each assay, each test substance, combination, or amount was assayed in quadruplicate. Each assay result was replicated at least twice with each preparation of protein, and each result was replicated with at least two, and in most instances three, separate preparations of protein.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein purity
Figure 1Go shows a reducing SDS protein gel of the recombinant PRLs. The yields for each PRL were very similar, although losses during processing were slightly greater for the glutamate and aspartate mutants, a result perhaps attributable to the small increase in negative charge on these molecules. Based on densitometric scans of Coomassie blue-stained gels, the purity of the PRL preparations was greater than 95% when using a 2-h induction period with isopropyl ß-thiogalactoside. Longer induction periods led to an increase in higher mol wt contaminants in the inclusion bodies with no significant increases in final yield. Nonreducing gels showed no evidence of oligomeric forms after folding (data not shown).



View larger version (87K):
[in this window]
[in a new window]
 
Figure 1. Reducing SDS-12% polyacrylamide gel of the recombinant PRLs. Lane 1, Molecular mass markers in kilodaltons; lane 2, hPRL B-3 containing BSA (upper band); lane 3, glutamate mutant; lane 4, alanine mutant; lane 5, valine mutant; lane 6, recombinant wild-type; lane 7, aspartate mutant. Proteins were stained with Coomassie blue. Note the doublet band in the hPRL B-3 that shows the presence of approximately 25% glycosylated hormone.

 
Because our aim was to develop an antagonist, it was important to demonstrate that antagonism in our recombinant preparations was not due to endotoxin contamination. The two most frequently used assays for endotoxin contamination (gel analysis and E-Toxate), however, did not prove very useful. Neither showed any evidence of endotoxin, but gel analysis is not very sensitive, and the recombinant proteins themselves interfered with gelation in the E-Toxate assay, so this assay was not conclusive. It was, therefore, important to develop alternate methods of assessment of endotoxin contamination. The first of these was analysis of general toxic effects of the preparation on a PRL-unresponsive cell line, SaOs cells. The recombinant proteins, up to concentrations of 0.5 µg/ml (i.e. 1000-fold the concentrations used in the Nb2 bioassays), had no effect on cell proliferation (data not shown). In addition, we developed a standard procedure by which at least wild-type and one other and usually all recombinant proteins were expressed, isolated, and folded in parallel. As all of the proteins are expressed in the same bacteria, parallel expression and purification should ensure equivalent contamination with any non-PRL factors with either a positive or negative effect on Nb2 cell proliferation. Thus, if there were any non-PRL antiproliferative substance in the glutamate and aspartate mutants, they should also be present in the alanine, valine, and wild-type preparations. Likewise, any non-PRL proliferative substances in the wild-type preparation should also be present in the glutamate, aspartate, and alanine preparations. As, for example, the wild-type preparation has such high proliferative activity and the aspartate and glutamate mutants have none, it seems unlikely that the preparations contain either proliferative or antiproliferative activity besides that inherent to the PRL molecules.

Biological activity
As can be seen in Fig. 2Go, the recombinant wild-type PRL had greater biological activity in the Nb2 bioassay than did the NIDDK hPRL B-3 preparation. This result attests to 1) the absence, or very low levels, of endotoxin in the preparation; and 2) appropriate folding of the molecule during the dialysis period. Accurate comparisons were assured by dissolution of the NIDDK standard in 50 mM NH4HCO3 and the use of this to produce both the bioassay stock and the standard curve in the NanoOrange protein assay.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Biological activity of recombinant wild-type hPRL. Nb2 cells were plated at 5000/well and incubated with the test PRLs for 3 days. OD 492 is a measure of cell number using the MTS assay. Data are presented as the mean ± SE. B-3 is a standard NIDDK preparation of hPRL.

 
NIDDK PRL is extracted from pituitaries and contains a mixture of nonphosphorylated and phosphorylated forms of the hormone (12, 13) in addition to at least one glycosylated form (14). As phosphorylated PRL acts as an antagonist to nonphosphorylated PRL in the Nb2 bioassay, its presence reduces the Nb2 response (1). In addition, glycosylated PRL has been shown to have about one third to one fourth the biological activity of unmodified PRL (15), and the B3 preparation contains about 25% glycosylated PRL based on analysis of gels similar to the one shown in Fig. 1Go. Recombinant wild-type hormone produced in E. coli, by contrast, contains no phosphorylated or glycosylated hormone, and hence, a larger proliferative response to a recombinant preparation can be obtained.

That some of the increased activity is probably due to the absence of phosphorylated hormone in the recombinant wild-type PRL is demonstrated in Fig. 3Go. For this experiment, a similar preparation of human pituitary PRL, hPRL I-8, which has less than 10% phosphorylated hormone, was subjected to dephosphorylation by acid phosphatase. As can be seen, dephosphorylation of the I-8 preparation increased its ability to stimulate the proliferation of Nb2 cells. Assay of enzyme alone showed no ability to stimulate Nb2 cell proliferation (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Biological activity of recombinant wild-type hPRL vs. dephosphorylated NIDDK hPRL I-8. Nb2 cells were plated at 5000/well and incubated with the test PRLs for 3 days. hPRL I-8 and dephos-hPRL I-8 were identical aliquots of PRL incubated without or with acid phosphatase at pH 5 (see Materials and Methods for details), respectively. Data are presented as the mean ± SE.

 
The results presented in Figs. 2Go and 3Go and the wild-type curves in Figs. 4Go and 5Go also show evidence of PRL self antagonism at high concentrations (16). Unlike the report by Goffin et al. (16), however, this self antagonism was observed using human hormone and rat cells. In other experiments, using doses up to only 1000 pg/ml (Figs. 6Go and 7Go), self antagonism was not reached. The degree of self antagonism observed was related to the dose necessary for the peak response, which varied among different sets of cells. Despite all attempts to standardize all apparent possible variables in the cultures, some variation in peak response (400 or 800 pg/ml) still persisted.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Titration of glutamate and aspartate mutant against wild-type PRL. Nb2 cells were plated at 1000/well and incubated in wild-type PRL with or without the addition of the glutamate (A) or aspartate (B) mutant at the concentrations indicated. All other conditions are described in Fig. 2Go. Because the absorbance of the cells incubated without PRL was subtracted from all results, occasional absorbances below 0 were obtained in the figures. These were not statistically significantly different from 0.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Intrinsic agonist activities of the glutamate and asparate mutants. Nb2 cells were plated at 5000 cells/well and incubated as described in Fig. 2Go.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Intrinsic agonist activities of the alanine and valine mutants. Nb2 cells were plated at 5000 cells/well and incubated as described in Fig. 2Go.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 7. Test for additive agonist activity of the alanine and valine mutants with wild-type PRL. Nb2 cells were plated at 5000 cells/well and incubated in wild-type PRL with or without addition of the alanine (A) or valine (B) mutant at the concentrations indicated.

 
Glutamate and asparate mutants
Substitution of serine 179 with aspartate or glutamate produced a molecule that acted as an antagonist (Fig. 4Go, A and B). When either was titrated against the wild-type recombinant, a dose-related inhibition of proliferation vs. wild-type PRL alone was observed. The aspartate mutant was a more potent antagonist than the glutamate mutant, with 200 pg/ml aspartate mutant inhibiting the growth response to 400 pg/ml wild-type PRL by 75%. In both instances the mutants showed titration curves apparently consistent with noncompetitive inhibition (see Discussion).

When tested alone for intrinsic agonist activity, neither the aspartate nor the glutamate mutant showed any ability to stimulate Nb2 cell proliferation (Fig. 5Go).

Importance of serine 179 to bioactivity
Because of the major effects of phosphorylation on the proliferative activity of PRL and its mimicry by the substitution of glutamate or aspartate at serine 179, we examined the role of serine 179 itself in producing proliferative activity. This was accomplished by conservatively mutating it to either alanine or valine. Contrary to our initial expectations, the alanine mutant was essentially without biological activity, whereas the valine mutant proved to be a mild agonist (Fig. 6Go). When titrated with recombinant wild type PRL, no additive proliferative activity was seen for the alanine mutant, but some additive proliferative activity was seen at low concentrations of wild-type PRL for the valine mutant (Fig. 7Go, A and B). When the alanine and valine mutants were titrated with wild-type under receptor-limiting conditions (i.e. using 1000 cells/well), both were found to be mild antagonists, indicating that they could bind to the receptor to some degree (data not shown).

RIA analysis
Figure 8Go illustrates the cross-reactivity of an anti-hPRL antibody with the recombinant proteins and with NIDDK standard human and rat PRL. The degree of antibody recognition can be used as a monitor of three-dimensional structure and, therefore, provides some measure of appropriate molecular folding. As can be seen, the aspartate mutant, the NIDDK standard, hPRL I-8, the alanine mutant, and the assay standard were all very similarly recognized. This suggests that they each have average conformations that are very similar. The valine mutant and wild-type proteins were recognized somewhat more efficiently by the antibody, and the glutamate mutant was recognized much less efficiently, suggesting changes in conformation vs. that of the assay standard. According to the manufacturers, the assay standards were normal preparations of circulating PRL, containing posttranslationally modified forms. As can be seen, the assay is also fairly sensitive to structural changes, as it was entirely unable to recognize rPRL at concentrations up to 200 ng/ml.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 8. Recognition of the mutant molecules in a standard RIA. rPRL B-7 is an NIDDK preparation. Glu, Glutamate substitution at position 179; Asp, aspartate substitution; hPRL I-8, NIDDK preparation; STD, the standard provided by the kit manufacturer; Ala, alanine substitution; Val, valine substitution; Ser, wild-type recombinant. The data presented are the average of duplicate assay determinations. This assay was performed twice with the same result.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While two groups have previously investigated the effect of one or more amino acid substitutions on the Nb2 mitogenic activity of the PRLs produced (8, 17–21; reviewed in Ref. 22), no one has previously mutated hPRL serine 179 or its equivalent in other species. It has been deleted with subsequent loss of biological activity (18), but given the likely effect of this deletion on the conformation of an important helix, this result is hard to interpret. Residues very close to this serine, including the arginine at -2 and the lysine at +2, have been shown to be crucial for tight binding to the receptor. Thus, when either residue was mutated to alanine, Nb2 receptor binding (19) was reduced to 1% or less of wild-type binding. Even a conservative change in the -2 arginine to a lysine reduced the biological activity by 90% (18). Thus, this appears to be a very sensitive region of helix 4, necessary either for direct interaction with the receptor or for structural stabilization of the molecule so that optimal ligand-receptor interactions can occur.

With the substitution of alanine for serine, we expected very little effect on agonist activity. To our surprise this substitution negated essentially all agonist activity. The RIA results attest to appropriate folding of the alanine-substituted molecule. It appears, therefore, that the serine is crucial for appropriate PRL-receptor interactions. Substitution of another neutral, but somewhat more bulky than alanine, amino acid (valine) produced a partial agonist. It seems likely, therefore, that the physical bulk of the serine is of significance as is perhaps the hydroxyl moiety.

When this serine is phosphorylated, an antagonist to nonphosphorylated PRL is produced (1). When phosphoserine was mimicked in the present study by mutating the serine to glutamate or aspartate, an antagonist was also the result. In the case of naturally phosphorylated PRL, titrations and dephosphorylation experiments have shown that relatively low percentages of phosphorylated PRL are required to negate the proliferative activity of nonphosphorylated PRL (1). Likewise, the aspartate mutant is a more potent antagonist than the wild type is an agonist. The mechanisms by which this relative potency may be achieved are varied, in part because what is being measured in an Nb2 bioassay is cell number at the end of a 3-day incubation. During the 3-day incubation, several doublings have taken place, and PRL receptors have recycled to the cell surface many times. Included in the possibilities are a significantly higher affinity of the aspartate mutant for the receptor or both receptors, induction of apoptosis by the aspartate mutant, or inhibition of signal amplification by the aspartate mutant (see below).

However the potency of the aspartate antagonist is achieved, it is apparently not due to a major ligand conformational change, as the aspartate mutant is seen as readily in the RIA as the assay standard. The glutamate mutant, on the other hand, has a significantly altered conformation that may well affect binding to a second receptor.

Both the glutamate and aspartate mutants show titration curves consistent with noncompetitive inhibition, i.e. increased concentrations of wild-type do not overcome the inhibition. This apparent noncompetitive inhibition, however, is probably due to the self antagonism of the wild type, i.e. when more agonist is added past the peak response, a significant amount of this will be producing one to one wild-type to receptor complexes and not one to two signal transducing complexes.

The mechanism by which phosphorylated PRL or its mimic acts as an antagonist is unknown. To date, antagonists for GH and PRL have been designed by mutating a region of these molecules involved in the binding of a second receptor, thus preventing receptor dimerization and signal transduction (16, 23). Serine 179 is in the region of the molecule that forms site 1 (22), and it is not immediately obvious how it might affect site 2 binding, if, in fact, it does. The conformational changes that could result from a bulky phosphate group, however, may well affect relatively distant parts of the molecule. When one creates a helical wheel representation (24) of helix 4 (Fig. 9Go) and makes the assumption that residues found critical to biological activity by others directly participate in receptor binding (R177, K181, and K187) (18, 19), then one can appreciate that serine 179 lies on the opposite side of the helix. In the model of Goffin et al. (22) this would face helix 3. If it stays in this orientation after phosphorylation, then it could well affect helix 3 orientation and, hence, site 2 binding. However, the presence of a large phosphate group in the hydrophobic interior of a molecule seems unlikely. It seems more likely that phosphorylation significantly changes the orientation of helix 4 and the way it interacts with the receptor. Perhaps the altered conformation of the receptor under these circumstances prevents signal transduction and amplification. If the second receptor has a fast on and off rate, as Gertler has demonstrated it has in homologous systems (25), and the one-receptor one-ligand complex, therefore, interacts with multiple second receptors to amplify the signal, the inability to amplify the signal with the phosphorylated hormone/aspartate mutant may account for the apparent potency of the antagonist. This possibility remains the subject of future investigations. In this regard, there is precedent for the production of members of the PRL family that can bind to, but not activate, the PRL receptor (26, 27).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 9. Helical wheel representation of helix 4 in the region being mutated. Arrows mark the residues referred to in Discussion, the mutation of which has been shown by others to markedly affect PRL receptor binding or Nb2 biological activity. The arrowhead shows the relative position of serine 179.

 
Other investigators have successfully produced PRL antagonists (16, 23), but none reported to date is as potent as the glutamate or aspartate mutants. Thus, the hGH G120R mutant of Fuh and Wells (23) has an IC50 6-fold that of the wild-type PRL agonist, and the best mutants described by Goffin et al. (16) have an IC50 10-fold that of the agonist using a rat receptor. The aspartate mutant we have described has an IC50 0.25-fold that of the agonist. In other words, 100 pg/ml of the aspartate mutant inhibits proliferation induced by 400 pg/ml wild-type PRL by 50% (data not shown). What is shown in the figures is 75% inhibition by 200 pg/ml.

Molecular mimicry of phosphorylation has been successfully applied to a variety of enzymes turned constitutively on or off by phosphorylation (28, 29, 30). In one instance, the structural changes observed after phosphorylation have also been shown to be accurately reproduced by an aspartate mutant (31).

Molecular mimicry of phosphorylated PRL has been claimed before, but for the bovine hormone (32). In this instance, serine 90 in bPRL, a site previously shown to be posttranslationally modified (33) was mutated to glutamate. When mutated to glutamate, the resultant bPRL, like preparations of phosphorylated bPRL, had reduced ability to stimulate Nb2 cell proliferation (32). This, however, is true of many single amino acid substitutions in bPRL (18). In the current manuscript, we describe the production of a molecular mimic of the phosphorylated hormone, which, like the phosphorylated hormone, very effectively antagonizes growth promotion in response to unmodified hormone. This positive measure of activity is a stronger indication of mimicry.

The production of a recombinant mimic of the phosphorylated hormone has several advantages. First, it can relatively easily be produced in large quantities, entirely free of its nonphosphorylated counterpart. Second, it cannot be dephosphorylated either during in vitro or in vivo experiments, thus making interpretation of experimental data more straightforward. When potentially administered therapeutically, the mimic cannot be converted to the growth-promoting form of PRL. Although we have demonstrated that phosphorylated PRL is actually very resistant to phosphatase activity, requiring 2- to 4-h incubations (i.e. many fold the half-life of PRL in serum) in concentrated enzyme to remove the phosphate (1, 2), this advantage may be significant with slow release or extended lifetime forms of the hormone.

As it is now known that a variety of extrapituitary tissues produce PRL (reviewed in Ref.34) and that a number of these also respond to or have the potential to respond to PRL (35), there is growing acceptance and accumulating evidence that autocrine/paracrine PRL may contribute to the progression of certain diseases, such as breast cancer (36, 37, 38, 39, 40, 41) and lymphomas (42). Although the secretion of all forms of PRL from the anterior pituitary is readily controlled by existing pharmaceuticals, a need is now appreciated for a PRL receptor antagonist that can negate autocrine/paracrine growth promotion in these other tissues.

In summary, we have produced a molecular mimic of phosphorylated PRL that maintains the antagonist properties of the phosphorylated hormone. This pseudophosphorylated PRL can now be used to study many aspects of the physiology of PRL and has the potential to be a useful therapeutic.


    Acknowledgments
 
The authors thank Dr. Neal L. Schiller, Division of Biomedical Sciences, University of California-Riverside, for advice on endotoxin assays and for conducting the gel analysis of endotoxin contamination, and Ms. Nancy Price for processing the manuscript. The authors acknowledge the gift of hPRL standard from the National Hormone and Pituitary Program of the NIDDK, NICHHD, and USDA.


    Footnotes
 
1 This work was supported in part by NIH Grant HD-28726, in part by a University of California multicampus research initiative grant, and in part by a grant from Sensus Corp. (Austin, TX). Some of this work was presented at the 79th Annual Meeting of The Endocrine Society, Minneapolis, Minnesota, June 11–14, 1997. Back

2 Co-first authors. Back

Received July 25, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wang Y-F, Walker AM 1993 Dephosphorylation of standard prolactin produces a more biologically active molecule. Evidence for antagonism between non-phosphorylated and phosphorylated prolactin in the stimulation of Nb2 cell proliferation. Endocrinology 133:2156–2160[Abstract]
  2. Krown KA, Wang Y-F, Ho TWC, Kelly PA, Walker AM 1992 Prolactin isoform 2 as an autocrine growth factor for GH3 cells. Endocrinology 131:595–602[Abstract]
  3. Wicks JR, Brooks CL 1995 Biological activity of phosphorylated and dephosphorylated bovine prolactin. Mol Cell Endocrinol 112:223–229[CrossRef][Medline]
  4. Ho TWC, Greenan JR, Walker AM 1989 Mammotroph autoregulation: the differential role of the 24K isoforms of prolactin. Endocrinology 124:1507–1514[Abstract]
  5. Ho TWC, Leong FS, Olaso CH, Walker AM 1993 Secretion of specific non-phosphorylated and phosphorylated rat PRL isoforms at different stages of the estrus cycle. Neuroendocrinology 58:160–165[Medline]
  6. Ho TWC, Kawaminami M, Walker AM 1993 Secretion of phosphorylated and non-phosphorylated monomer PRL isoforms during rat pregnancy and pseudopregnancy. Endocr J 1:435–439
  7. Wang Y-F, Liu J-W, Mamidi M, Walker AM 1996 Identification of the major site of rat prolactin phosphorylation as serine 177. J Biol Chem 271:2462–2469[Abstract/Free Full Text]
  8. Luck DN, Gout PW, Beer CT, Smith M 1989 Bioactive recombinant methionyl bovine prolactin: structure-function studies using site-specific mutagenesis. Mol Endocrinol 3:822–831[CrossRef][Medline]
  9. Yotis WW, Sharma VK, Gopalsami C, Chegini S, McNulty J, Hoerman K, Keene Jr J, Simonson LG 1991 Biochemical properties of the outer membrane of Treponema denticola. J Clin Microbiol 29:1397–1406[Abstract/Free Full Text]
  10. Tanaka T, Shiu RPC, Gout PW, Beer LT, Noble RL, Friesen HG 1980 A new sensitive and specific bioassay for lactogenic hormone: measurement of prolactin and growth hormone in human serum. J Clin Endocrinol Metab 51:1058–1063[Abstract]
  11. Cory AH, Owen TC, Barltrop JA, Cory JG 1991 Use of an aqueous soluble tetrazolium/formazan assay for cell growth assays in culture. Cancer Commun 3:207–212[Medline]
  12. Greenan JR, Balden E, Ho TWC, Walker AM 1989 Biosynthesis of the secreted 24K isoforms of prolactin. Endocrinology 125:2041–2048[Abstract]
  13. Walker AM 1994 Phosphorylated and nonphosphorylated prolactin isoforms. Trends Endocrinol Metab 5:195–200[Medline]
  14. Sinha YN, Gilligan TA, Lee DW 1984 Detection of high molecular weight variant of prolactin in human plasma by a combination of electrophoretic and immunologic techniques. J Clin Endocrinol Metab 58:752–754[Abstract]
  15. Price AE, Lagvinenko KB, Higgins EA, Cole ES, Richards SM 1995 Studies on the microheterogeneity and in vitro activity of glycosylated and non-glycosylated recombinant human prolactin separated using a novel purification process. Endocrinology 136:4827–4833[Abstract]
  16. Goffin V, Kinet S, Ferrag F, Binart N, Martial JA, Kelly PA 1996 Antagonistic properties of human prolactin analogs that show paradoxical agonistic activity in the Nb2 bioassay. J Biol Chem 271:16573–16579[Abstract/Free Full Text]
  17. Luck DN, Gout PW, Kelsay K, Atkinson T, Beer CT, Smith M 1990 Recombinant methionyl bovine prolactin: loss of bioactivity after single amino acid deletions from putative helical regions. Mol Endocrinol 4:1011–1016[CrossRef][Medline]
  18. Luck DN, Huyer M, Gout PW, Beer CT, Smith M 1991 Single amino acid substitutions in recombinant bovine prolactin that markedly reduce its mitogenic ativity in Nb2 cell cultures. Mol Endocrinol 5:1880–1886[CrossRef][Medline]
  19. Goffin V, Norman M, Martial JA 1992 Alanine scanning mutagenesis of human prolactin: importance of the 58–74 region for bioactivity. Mol Endocrinol 6:1381–1392[Abstract]
  20. Goffin V, Struman I, Goormaghtigh E, Martial JA 1993 The addition of nine residues at the C-terminus of human prolactin drastically alters its biological properties. Eur J Biochem 214:483–490[Medline]
  21. Goffin V, Struman I, Mainfroid V, Kinet S, Martial JA 1994 Evidence for a second receptor binding site on human prolactin. J Biol Chem 269:32598–32606[Abstract/Free Full Text]
  22. Goffin V, Martial JA, Summers NL 1995 Use of a model to understand prolactin and growth hormone specificities. Protein Engin 8:1215–1231[Abstract/Free Full Text]
  23. Fuh G, Colosi P, Wood WI, Wells JA 1993 Mechanism-based design of prolactin receptor antagonists. J Biol Chem 268:5376–5381[Abstract/Free Full Text]
  24. Schiffer M, Edmundson AB 1967 Use of helical wheels to represent the structures of proteins and to identify segments with helical potential. Biophys J 7:121–135
  25. Gertler A, Grosclaude J, Strausburger CJ, Nir S, Djiane J 1996 Real-time kinetic measurements of the interactions between lactogenic hormones and prolactin-receptor extracellular domains from several species support the model of hormone-induced transient receptor dimerization. J Biol Chem 271:24482–24491[Abstract/Free Full Text]
  26. Davis JA, Linzer DIH 1989 A mutant lactogenic hormone binds, but does not activate, the prolactin receptor. Mol Endocrinol 3:949–953[CrossRef][Medline]
  27. Walker AM, Montgomery DW, Saraiya S, Ho TWC, Garewal HS, Wilson J, Lorand L 1995 Prolactin-immunoglobulin G complexes from human serum act as costimulatory ligands causing proliferation of malignant B lymphocytes. Proc Natl Acad Sci USA USA 92:3278–3282[Abstract/Free Full Text]
  28. Thorsness PE, Koshland Jr DE 1987 Inactivation of isocitrate dehydrogenase by phosphorylation is mediated by the negative charge of the phosphate. J Biol Chem 262:10422–10425[Abstract/Free Full Text]
  29. Reizer J, Sutrina SL, Saier MH, Stewart GC, Peterofsky A, Reddy P 1989 Mechanistic and physiological consequences of HPr (ser) phosphorylaton on the activities of the phosphoenyl pyruvate-sugar phosphotransferase system in gram positive bacteria: sugar specific mutants of HPr. EMBO J 8:2111–2120[Medline]
  30. Kaufman RJ, Davis MB, Pathak UK, Hershey JW 1989 The phosphorylation state of eukaryotic initiation factor 2 alters translational efficiency of specific mRNAs. Mol Cell Biol 9:946–958[Abstract/Free Full Text]
  31. Wittekind M, Reizer J, Deutscher J, Saier MH, Klevit RE 1989 Common structural changes accompany the functional inactivation of HPr by seryl phosphorylation or by serine to aspartate substitution. Biochemistry 28:9908–9912[CrossRef][Medline]
  32. Maciejewski P, Peterson FC, Anderson PJ, Brooks CL 1995 Mutation of serine 90 to glutamic acid mimics phosphorylation of bovine prolactin. J Biol Chem 270:27661–27665[Abstract/Free Full Text]
  33. Kim BG, Brooks CL 1993 Isolation and characterization of phosphorylated bovine prolactin. Biochem J 296:41–47
  34. Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW 1996 Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr Rev 17:639–669[CrossRef][Medline]
  35. Nagano M, Kelly PA 1994 Tissue distribution and regulation of rat prolactin receptor gene expression. J Biol Chem 269:13337–13345[Abstract/Free Full Text]
  36. Ginsburg E, Vonderhaar BK 1995 Prolactin synthesis and secretion by human breast cancer cells. Cancer Res 55:2590–2595
  37. Clevenger CV, Chang WP, Ngo W, Pasha TL, Montone KT, Tomaszewski JE 1995 Expression of prolactin and prolactin receptor in human breast carcinoma. Evidence for autocrine/paracrine loop. Am J Pathol 146:695–705[Abstract]
  38. Mershon J, Sall W, Mitchner N, Ben-Jonathan N 1995 Prolactin is a local growth factor in rat mammary tumors. Endocrinology 136:3619–3623[Abstract]
  39. Manni A, Wright C, Davis G, Glenn J, Joehl R, Feil P 1986 Promotion by prolactin of the growth of human breast neoplasms cultured in vitro in the soft agar clinogenic assay. Cancer Res 46:1669–1672[Medline]
  40. Malarkey WB, Kennedy M, Allred LE, Milo G 1983 Physiological concentrations of prolactin can promote the growth of human breast tumor cells in culture. J Clin Endocrinol Metab 56:673–677[Abstract]
  41. Mansfield CM 1993 A review of the etiology of breast cancer. J Natl Med Assoc 85:217–221[Medline]
  42. DiMattia GE, Gellersen B, Bohnet HG, Friesen HG 1988 A human lymphoblastoid cell line produces prolactin. Endocrinology 122:2508–2517[Abstract]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. A. Svensson, K. Bondensgaard, L. Norskov-Lauritsen, L. Christensen, P. Becker, M. D. Andersen, M. J. Maltesen, K. D. Rand, and J. Breinholt
Crystal Structure of a Prolactin Receptor Antagonist Bound to the Extracellular Domain of the Prolactin Receptor
J. Biol. Chem., July 4, 2008; 283(27): 19085 - 19094.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
V. L. Williams, A. DeGuzman, H. Dang, M. Kawaminami, T. W. C. Ho, D. G. Carter, and A. M. Walker
Common and specific effects of the two major forms of prolactin in the rat testis
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1795 - E1803.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Comitato, C. Spampanato, C. Chakarova, D. Sanges, S. S. Bhattacharya, and V. Marigo
Mutations in splicing factor PRPF3, causing retinal degeneration, form detrimental aggregates in photoreceptor cells
Hum. Mol. Genet., July 15, 2007; 16(14): 1699 - 1707.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
B C Nephew, J Amico, H M Cai, A M Walker, and R S Bridges
Intracerebroventricular administration of the prolactin (PRL) receptor antagonist, S179D PRL, disrupts parturition in rats
Reproduction, July 1, 2007; 134(1): 155 - 160.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. K. Ueda, H.-L. Lo, P. Bartolini, and A. M. Walker
S179D Prolactin Primarily Uses the Extrinsic Pathway and Mitogen-Activated Protein Kinase Signaling to Induce Apoptosis in Human Endothelial Cells
Endocrinology, October 1, 2006; 147(10): 4627 - 4637.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E. Ueda, U. Ozerdem, Y.-H. Chen, M. Yao, K. T. Huang, H. Sun, M. Martins-Green, P. Bartolini, and A. M Walker
A molecular mimic demonstrates that phosphorylated human prolactin is a potent anti-angiogenic hormone.
Endocr. Relat. Cancer, March 1, 2006; 13(1): 95 - 111.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Wu, E. Ginsburg, B. K. Vonderhaar, and A. M. Walker
S179D Prolactin Increases Vitamin D Receptor and p21 through Up-regulation of Short 1b Prolactin Receptor in Human Prostate Cancer Cells
Cancer Res., August 15, 2005; 65(16): 7509 - 7515.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. J. Naylor, S. R. Oakes, M. Gardiner-Garden, J. Harris, K. Blazek, T. W. C. Ho, F. C. Li, D. Wynick, A. M. Walker, and C. J. Ormandy
Transcriptional Changes Underlying the Secretory Activation Phase of Mammary Gland Development
Mol. Endocrinol., July 1, 2005; 19(7): 1868 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Goffin, S. Bernichtein, P. Touraine, and P. A. Kelly
Development and Potential Clinical Uses of Human Prolactin Receptor Antagonists
Endocr. Rev., May 1, 2005; 26(3): 400 - 422.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Tan, D. A. Johnson, W. Wu, L. Zeng, Y. H. Chen, W. Y. Chen, B. K. Vonderhaar, and A. M. Walker
Unmodified Prolactin (PRL) and S179D PRL-Initiated Bioluminescence Resonance Energy Transfer between Homo- and Hetero-Pairs of Long and Short Human PRL Receptors in Living Human Cells
Mol. Endocrinol., May 1, 2005; 19(5): 1291 - 1303.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. D. Schroeder, J. L. Brockman, A. M. Walker, and L. A. Schuler
Inhibition of Prolactin (PRL)-Induced Proliferative Signals in Breast Cancer Cells by a Molecular Mimic of Phosphorylated PRL, S179D-PRL
Endocrinology, December 1, 2003; 144(12): 5300 - 5307.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bernichtein, C. Kayser, K. Dillner, S. Moulin, J. J. Kopchick, J. A. Martial, G. Norstedt, O. Isaksson, P. A. Kelly, and V. Goffin
Development of Pure Prolactin Receptor Antagonists
J. Biol. Chem., September 19, 2003; 278(38): 35988 - 35999.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Naylor, E. Ginsburg, T. P. Iismaa, B. K. Vonderhaar, D. Wynick, and C. J. Ormandy
The Neuropeptide Galanin Augments Lobuloalveolar Development
J. Biol. Chem., August 1, 2003; 278(31): 29145 - 29152.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
A M Walker
Unmodified and phosphorylated prolactin and gamma delta T cell development and function
Lupus, October 1, 2001; 10(10): 735 - 741.
[Abstract] [PDF]


Home page
EndocrinologyHome page
S. Bernichtein, S. Kinet, S. Jeay, M. Llovera, D. Madern, J. A. Martial, P. A. Kelly, and V. Goffin
S179D-Human PRL, a Pseudophosphorylated Human PRL Analog, Is an Agonist and Not an Antagonist
Endocrinology, September 1, 2001; 142(9): 3950 - 3963.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Xu, E. Kreye, C. B. Kuo, and A. M. Walker
A Molecular Mimic of Phosphorylated Prolactin Markedly Reduced Tumor Incidence and Size When DU145 Human Prostate Cancer Cells Were Grown in Nude Mice
Cancer Res., August 1, 2001; 61(16): 6098 - 6104.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. S. Bridges, B. A. Rigero, E. M. Byrnes, L. Yang, and A. M. Walker
Central Infusions of the Recombinant Human Prolactin Receptor Antagonist, S179D-PRL, Delay the Onset of Maternal Behavior in Steroid-Primed, Nulliparous Female Rats
Endocrinology, February 1, 2001; 142(2): 730 - 739.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. Coss, L. Yang, C. B. Kuo, X. Xu, R. A. Luben, and A. M. Walker
Effects of prolactin on osteoblast alkaline phosphatase and bone formation in the developing rat
Am J Physiol Endocrinol Metab, December 1, 2000; 279(6): E1216 - E1225.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. E. Freeman, B. Kanyicska, A. Lerant, and G. Nagy
Prolactin: Structure, Function, and Regulation of Secretion
Physiol Rev, October 1, 2000; 80(4): 1523 - 1631.
[Abstract] [Full Text] [PDF]


Home page
Endocrinology