| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
The University of Melbourne, Department of Medicine (F.M.C., W.R.H., J.M.H., G.C.N.), The Geelong Hospital, Box 281, Geelong 3220, Australia; Department of Orthopaedic Surgery (W.H.H., L.L.D., M.H.Z.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia 6009, Australia; St. Vincents Institute of Medical Research and The University of Melbourne, Department of Medicine (M.T.G.), Fitzroy 3065, Australia
Address all correspondence and requests for reprints to: Professor G. C. Nicholson, The University of Melbourne, Department of Medicine, The Geelong Hospital, P.O. Box 281, Geelong 3220, Australia. E-mail: G.Nicholson{at}medicine.unimelb.edu.au
| Abstract |
|---|
|
|
|---|
and ER-ß messenger RNA (mRNA) by RT-PCR in samples from human
giant cell tumor of bone (GCT), including: whole tumor, cultured
mononuclear cells, and a pure osteoclast population obtained by
microisolation. Whole tumor expressed both ER-
and calcitonin
receptor (CTR) mRNA and apparently lower levels of ER-ß mRNA.
Passaged cultures of tumor mononuclear stromal cells also expressed
ER-
and low ER-ß but not CTR mRNA. In pure preparations of
microisolated osteoclasts, expression of ER-
or ER-ß mRNA was not
detected, whereas expression of CTR mRNA was readily identified.
Microisolated GCT mononuclear cells expressed ER-
, but no detectable
CTR mRNA. Fluorescence in situ hybridization (FISH)
using an ER-
riboprobe demonstrated strong signal in the mononuclear
cells but multinucleated osteoclasts showed no detectable signal. In
contrast, CTR mRNA was detected in multinucleated osteoclasts but not
in stromal-like tumor cells by FISH. 17ß-estradiol consistently
showed no effect on bone resorbing activity of osteoclasts from GCT
cultured on cortical bone, although calcitonin was a potent inhibitor.
These findings indicate that significant expression of ER does not
occur in osteoclasts derived from human GCT and suggest that estrogen
effects are mediated by other cells of the bone environment. | Introduction |
|---|
|
|
|---|
Although there is general agreement that cells of the osteoblast
lineage possess ER, their presence in osteoclasts has been difficult to
prove or disprove because pure preparations have not been available.
Some investigators have used enriched osteoclast preparations, in which
ER has been examined by molecular techniques (15, 16, 17, 18). Oursler and
colleagues found evidence of ER in 9095% pure preparations of avian
osteoclasts using Northern and Western analyses (15), and also in
osteoclasts of similar purity derived from giant cell tumor of bone
(GCT, also called osteoclastoma) using RT-PCR and Western analysis
(16). In both cases, estrogen treatment of the cultures inhibited bone
resorption and induced changes in expression of specific messenger RNAs
(mRNAs). Mano and colleagues (17) demonstrated low levels of ER mRNA by
Northern analysis in 95% pure rabbit osteoclast populations and also
showed estrogen-induced inhibition of bone resorption. Recently, Kameda
and co-workers (18) also used highly purified rabbit osteoclast
preparations to demonstrate expression of ER
by Northern analysis
together with estrogen-induced inhibition of bone resorption and
promotion of apoptosis.
Another approach to the problem of contaminated preparations has been direct visualization of ER or ER mRNA using in situ techniques. For example, Pensler and colleagues (19) used immunocytochemistry to demonstrate nuclear ER and progesterone receptors in human osteoclasts. However, other studies using histochemical (20) and immunocytochemical (21) techniques have failed to demonstrate ER in osteoclasts from GCT. In a recent preliminary study employing in situ hybridization, no ER mRNA expression was found in mammalian osteoclasts, although expression was present in chondrocytes and osteoblasts (22). In contrast, ER mRNA was shown in human osteoclasts using the more sensitive technique of in situ RT-PCR, although the signal in osteoclasts was less than in osteoblasts (23). Other recent work has produced evidence that indirect effects mediated by cytokines (24), including IL-6 (25, 26), IL-1 (27), TGFß (28), and TNF (29) are important in the actions of estrogen in bone, although these results do not exclude the possibility of coexistent direct effects.
In summary, although there is evidence that osteoclasts possess ER, there are conflicting data, and the issue remains controversial (30). To overcome the problem of impure osteoclast preparations, we have used the novel technique of microisolation (31) to prepare 100% pure osteoclasts from GCT. Using this approach, together with RT-PCR, we found that multinucleate osteoclasts present in GCT do not express ER mRNA, and we have confirmed this finding using fluorescent in situ hybridization. Furthermore, we found that estrogen has no effect on the bone resorbing activity of GCT osteoclasts.
| Materials and Methods |
|---|
|
|
|---|
Preparation of whole giant cell tumor mixed cell suspension
The protocol was approved by The Geelong Hospital Human Research
and Ethics Advisory Committee. A total of fifteen cases of GCT were
collected after informed consent. Tumor tissue was chopped crudely in
the operating room and transported on ice to the laboratory in sterile
HEPES-buffered medium 199. Tissue fragments were passed initially
through a cell dissociation sieve of 380 µm mesh, then filtered
through 280 µm mesh to produce a mixed cell suspension. This
suspension was used immediately for total RNA extraction and to prepare
enriched osteoclasts. Primary cultures of the mixed cells, settled onto
bone slices and glass slides, were used for the bone resorption and
in situ hybridization experiments, respectively, whereas
long-term cultures of two to five passages were used to prepare stromal
cells.
Stromal cell culture
Stromal cell cultures were established in 25-cm2
culture flasks by addition of the GCT mixed cell suspension to MEM
containing 10% FBS. Cells were cultured until confluent (
3 weeks)
and subcultured by treatment with EDTA and trypsin. Total RNA was
extracted from one flask of cells at each passage.
Osteoclast enrichment for microisolation and pit assay
To achieve osteoclast enrichment, the GCT mixed cell suspension
was layered over 5 ml FBS in a sterile conical tube and allowed to
stand for 20 min at 4 C. Two fractions were sequentially removed by
pipette and characterized by microscopy. These were: 1) upper fraction,
which comprised mainly mononuclear cells; and 2) lower fraction, in
which the larger osteoclasts had settled more rapidly into the serum
and contained less mononuclear contamination. The FBS sedimentation
achieved enrichment of osteoclasts to 1050% purity, depending on the
initial purity of the individual tumor preparation and the number of
times the sedimentation was performed (13 times).
Osteoclast and mononuclear cell microisolation
Osteoclasts were microisolated from the osteoclast-enriched
lower fraction according to Tong et al. (31) with
modifications. Thirty microliters of this fraction were added to a
sterile culture dish with 10 ml HEPES buffered medium 199 containing
0.85 g/liter sodium bicarbonate, 0.5 mM EDTA, and 10% FBS.
Microisolation was performed with a Nikon/Narishige Micromanipulator
system (NT-88; Tokyo, Japan) attached to a Nikon inverted microscope.
Using phase contrast optics, osteoclasts were identified by their size,
multinuclearity, and characteristic appearance. Fifty to 100 of these
were individually aspirated into a glass micropipette (tip diameter,
100 µm) with particular care to exclude mononuclear cells. The
osteoclasts within the micropipette were then transferred to a culture
dish containing fresh medium and checked for any contaminating
mononuclear cells that, if present, were removed by aspiration with the
micropipette. Likewise, a pure population of 400600 mononuclear cells
was obtained by microisolation of cells from the mononuclear
cell-enriched upper fraction. Total RNA was extracted immediately from
the microisolated osteoclasts and mononuclear cells.
RNA isolation and RT-PCR
The GCT mixed cell suspension, cultured stromal cells, and
microisolated cells were directly lyzed in RNAzol B solution and total
RNA extracted according to the manufacturers instructions. The RNA
pellet was resuspended in DEPC-treated H2O, and the
quantity and quality assessed by UV absorbance at 260 nm and 280 nm
(except for the microisolated cellular RNA in which the concentration
was below the measurement threshold). Ratios were in the range
1.72.0.
For RT and PCR reactions, a Perkin Elmer/Cetus DNA Thermal Cycler was used. For most samples, 1 µg total RNA was reverse-transcribed in the presence of 5 mM MgCl2, 1 mM deoxynucleotide mix, 3.2 µg random primers, 50 U RNase inhibitor, and 20 U AMV reverse transcriptase. The final mixture of 20 µl was reacted at 25 C for 10 min, 42 C for 60 min, and 95 C for 5 min to denature the enzyme. In the case of the microisolated cells, all the RNA extracted was dissolved in 5 µl DEPC treated H2O and reverse transcribed to give a 20 µl aliquot of cDNA. One tenth of the cDNA was used in each PCR reaction.
Sense and antisense primers were synthesized on an Oligo100
M synthesizer (Beckman, Fullerton, CA). Oligonucleotide
primers for human ER-
were based on the cDNA sequence, accession
number X03635 M11457. The primers (5' to 3') (CTACTGCATCAGATCCAAGG) and
(GTCATTGGTACTGGCCAATCT) amplified a 471-bp fragment. Oligonucleotide
primers for human ER-ß were based on the cDNA sequence, accession
number X99101. The primers (5' to 3') (TGGTCAGGGACATCATCATGG) and
(TCAAAGAGGGATGCTCACTTCTG) amplified a 475-bp fragment. Both ER products
were confirmed by restriction enzyme digest analysis. The
oligonucleotides for human calcitonin receptor (CTR) were: (5' to 3')
(hCTR1, GCAATGCTTTCACTCCTGAGAAAC) and (hCTR2,
CAGTAAACACACAGCCACGACAAT-GAG). These primers permitted the
identification of the two CTR isoforms that differ by inclusion or
exclusion of a 16-amino acid insert. The resultant PCR fragments were
364 and 412 bp. To determine the presence of cDNA from microisolated
cell samples, oligonucleotide primers specific for human GAPDH were
also used. The oligonucleotides were: (5' to 3') (GAPDH 4,
CATGGAGAAGGCTGGGGCTC); and (GAPDH 3, CACTGACACGTTGGCAGTGG), which
amplified a fragment of 414 bp (32). All the primer pairs spanned
intron-exon splice sites allowing for the detection of mRNA only.
PCR amplification was performed with cycles of denaturation at 95 C for
1 min, annealing at 52 C (ER), 55 C (GAPDH), or 56 C (CTR) for 2 min
and extension at 72 C for 1 min. The reaction mixture contained 40 pmol
of each primer, 200 µM dNTPs, 2 µl of 10 x
reaction buffer, optimized concentrations of MgCl2, 0.75
mM (CTR), and 1.0 mM (ER-
, ER-ß, and
GAPDH), 1 U Taq DNA polymerase, and sterile distilled water
up to 20 µl. The mixture was then overlayed with paraffin oil. PCR
products were resolved on a 1.2% agarose gel and visualized using
ethidium bromide. The size of the bands were confirmed by a 100 bp DNA
ladder (Life Technologies, GIBCO-BRL). MCF-7 cells (human mammary
carcinoma) and Saos-2 cells (human osteoblast-like osteosarcoma), both
purchased from ATCC, were used as positive controls for ER-
and
ER-ß, respectively. cDNA from a GCT that had shown maximal inhibition
of resorption after treatment with calcitonin (GCT 10) and cDNA lacking
the insert isoform were the positive controls for CTR.
Fluorescent in situ hybridization
The GCT mixed cell suspension was settled onto sterile glass
cover slips for 2 h, rinsed in PBS, and fixed in freshly prepared
4% paraformaldehyde in DEPC-treated PBS for 15 min. A rat ER-
cDNA-fragment that also encoded 637 bp of the human ER-
was
subcloned into pGEM-T for generation of riboprobes as described (33).
T7 polymerase was used to generate the antisense strand of ER-
fragment and in situ hybridization was performed as
previously described (34). Coverslips were washed in 0.2% Triton X in
DEPC-treated PBS for 5 min after fixation. The cells were digested with
proteinase K at 2 mg/ml in 0.1 M Tris buffer (pH 8.0) and
50 mM EDTA for 20 min at 37 C in a humidified chamber,
followed by 0.1% glycine in PBS for 2 min. They were then postfixed in
4% paraformaldehyde in PBS for 15 min and pretreated with RNase-free
DNase (1 U/ml) for 30 min at 37 C before hybridization to ensure
specificity of mRNA hybridization. Coverslips were rinsed in PBS
between each pretreatment. All procedures were carried out at room
temperature unless otherwise indicated. The hybridization solution
consisted of 45% deionized formamide, 10% dextran sulfate, 5-fold
SSC, and 100 ng/ml of denatured and sonicated salmon sperm DNA. For
negative controls, coverslips were incubated with 100 µg/ml of RNase
at 37 C for 60 min before prehybridization. Prehybridization was
performed at 37 C for 1 h in hybridization solution. The
digoxigenin (DIG)-labeled probe of ER-
was diluted with
hybridization solution to a final concentration of 0.2 ng/ml. The
mixtures were heated at 65 C for 10 min and then 30 µl placed on each
coverslip in a petri dish and incubated at 37 C for 16 h in a
humidified chamber. Coverslips were washed twice sequentially in
2-fold, 1-fold, and 0.1-fold SSC at 37 C for 15 min each. They were
then incubated with 1% blocking solution for 30 min at room
temperature. Probe detection was performed with a fluorescent antibody
enhancer set according to the manufacturers instructions. The slides
were incubated sequentially in anti-DIG (1° antibody), antimouse-DIG
(2° antibody), and anti-DIG-fluorescein (3° antibody) each for 60
min at 37 C in a humidified chamber. Slides were rinsed in washing
buffer at 37 C after each incubation and the 3° antibody incubation
was performed in the dark. Some slides were counterstained with 3 mg/ml
of propidium iodide for 30 min at room temperature to view nuclei.
After air drying in the dark, the slides were covered with antifade
solution and a coverslip. Signal was detected by confocal
microscopy.
Bone resorption assay
Methods used were modified from those previously described (35).
The GCT mixed cell suspension was settled for 20 or 60 min onto 48
numbered slices of devitalized bovine cortical bone (4 x 4
x 0.1 mm) in a 96-well plate. Bone slices were then washed in medium
to remove nonadherent cells. The cultures were incubated in phenol
red-free MEM supplemented with 100 IU/ml benzylpenicillin and 0.1%
BSA, pH 7.2, at 37 C in a humidified atmosphere of 95% air, 5%
CO2, in the presence of vehicle, sCT (10-9
M), or increasing concentrations of 17ß-estradiol
(10-1110-7 M). After incubation
for periods from 1696 h, the cells were fixed in 1% formalin/PBS for
5 min, reacted cytochemically for TRAP and alkaline phosphatase (ALP),
and the number of adherent TRAP+ve multinucleated cells and ALP+ve
cells counted. The bone slices were then stripped of cells by
ultrasonication in 0.25 M NH4OH and processed
for scanning electron microscopy. The total number of pits per bone
slice was counted in all experiments and pit plan areas measured in
representative experiments. Resorption pits were identified by their
characteristic surface and defined as being completely circumscribed by
unresorbed bone. All measurements were performed blind.
To determine whether length of culture period or degree of stromal/mononuclear cell contamination affected osteoclastic bone resorption in the presence of 17ß-estradiol, the bone resorption assays were established using a number of protocols, including enriched osteoclasts, short settlement (20 min), and long settlement (60 min) of the GCT mixed cell suspension. Bone slices were then incubated for varying times (16, 24, 48, and 96 h).
| Results |
|---|
|
|
|---|
, ER-ß, and CTR mRNA in GCT mixed cell
suspension and stromal cell cultures
and ER-ß mRNA in all samples (Fig. 1a
signal in all the GCT samples. In contrast, the Saos-2
cells showed a much greater signal for ER-ß than ER-
, suggesting
that the disparity in the two signals seen in the GCT samples was not
simply due to differences in the efficiency of the PCR reaction. CTR
mRNA was expressed in all whole GCT samples examined (see Figs. 1b
|
|
|
mRNA was demonstrated in stromal cell
cultures derived from GCT 9, 11, and 12 and remained evident up to five
passages (Fig. 1b
and ER-ß mRNA but not CTR mRNA.
Detection of ER and CTR mRNA in pure osteoclast and mononuclear
preparations
To determine which cells express ER mRNA, pure osteoclasts
and mononuclear cells from three tumors (GCT 9, GCT 12, and GCT 15)
were microisolated from the lower and upper fractions, respectively, of
the FBS sedimentation gradient. Total RNA from the microisolated cells
was reverse transcribed to prepare cDNA and one tenth of the cDNA
sample was used for the PCR reactions. In 80 osteoclasts microisolated
from GCT 12, expression of CTR mRNA was readily demonstrated, whereas
there was no band visible for ER-
mRNA (Fig. 2
). Evaluation by PCR (52 cycles) showed
that total RNA from approximately 400 mononuclear cells was required to
produce a GAPDH product equivalent to 50 microisolated osteoclasts
(Fig. 3a
). In a separate experiment,
ER-
PCR product was shown in 600 microisolated mononuclear cells but
not in 80 osteoclasts that had been amplified for an equivalent number
of cycles (Fig. 3b
). This demonstrated that ER-
mRNA was expressed
in mononuclear cells but not in a matched quantity of cDNA from pure
osteoclasts. A similar result was seen with pure osteoclasts and a
sample of mononuclear cells microisolated from GCT 9 (data not shown).
Osteoclasts microisolated from a third tumor (GCT 15) demonstrated CTR
product but no detectable ER-
(Fig. 4
)
or ER-ß mRNA (data not shown).
|
and CTR
was performed on cultures of whole tumor (Fig. 5
mRNA in osteoclasts
was no greater than background (Fig. 5a
|
|
| Discussion |
|---|
|
|
|---|
Our PCR studies showed expression of ER-
and ER-ß mRNA in both GCT
mixed cell suspension and passaged stromal cells from three tumors.
ER-ß mRNA expression in the GCT specimens was negligible compared
with that demonstrated in control transformed cell lines, suggesting,
although not proving, that ER-
is the predominant subtype in GCT.
The expression of ER-ß mRNA has recently been reported in rat
osteoblasts and cancellous bone, although its role there remains
uncertain (43). The presence of ER-
mRNA in GCT stroma is in
concordance with current evidence that bone marrow stromal cells
possess ER (12, 13, 14), and also with a recent study demonstrating that
osteoclast-depleted, passaged stromal cells from GCT express osteoblast
phenotype and become osteogenic under appropriate culture conditions
(44).
Using the novel method of cellular microisolation, we were able to show
that ER-
mRNA expression was not detectable in multinucleate
osteoclasts isolated from three GCT. However, after equal
amplification, ER-
mRNA was readily detectable in a matched quantity
of cDNA from microisolated mononuclear cells. The mononuclear fraction
of GCT is composed of a heterogeneous population of cells, including
osteoclast precursors, which have previously been purified and
characterized (45). Although we demonstrated expression of ER-
mRNA
in passaged tumor stromal cells, the possibility that other mononuclear
cells may also express ER mRNA cannot be excluded. In view of the known
effects of estrogen on osteoclastogenesis (46, 47), and the
demonstration of ER expression in osteoclast-like cell lines (48), the
possibility exists that osteoclast precursors may possess functional ER
which are lost with differentiation or fusion.
In support of our findings with the microisolation/RT-PCR procedure, we
have used in situ hybridization, a technique that has been
useful in the investigation of osteoclast biology (34, 36, 49). The
sensitivity and specificity of in situ hydridization is
substantially improved by FISH with DIG-FITC enhancer. The latter
increases the number of fluorescent molecules per hapten, resulting in
higher sensitivity than other in situ hybridization
techniques. Using FISH, we have clearly demonstrated that CTR, but no
significant ER-
mRNA, is present in multinucleate osteoclasts. The
spindle-shaped mononuclear cells, which were the predominant cell in
the mixed cultures, expressed ER-
but no CTR mRNA. Expression of
both transcripts was observed in the less abundant round
macrophage-like mononuclear cells, again suggesting that ER may be
present on CTR+ve mononuclear osteoclast precursors. Previously, using
autoradiography, we found that CTR+ve mononuclears comprised only
12% of the total cell population in GCT cultures (42). In the
absence of double labeling, we cannot exclude the possibility that ER
and CTR are present in two different populations of round mononuclear
cells.
We showed that 17ß-estradiol had no effect on bone resorption in 21 bone resorption assays (from eight different GCT) with a wide variation of mononuclear cell contamination. Previous in vitro investigations of estrogen effects on bone resorption have shown variable results. Inhibition has been reported in a number of species, including rabbit osteoclast cultures (17, 18), PTH-stimulated mouse calvarial cultures (3), and purified avian and GCT osteoclasts (15, 16). No effect of estrogen (50) or slight stimulation of resorption (51) has been noted in neonatal rat osteoclast bone resorption assays. Using this rat model, we have consistently found no effect of 17ß estradiol on resorption pit formation (our unpublished results). In some reports, the decrease in resorption has been due to inhibition in osteoclast formation and not to reduction in pit formation per se (46, 47). Overall, the data relating to the effects of estrogen on bone cell cultures are inconsistent and may be dependent on the culture system used and the species studied.
Although we found no effect of 17ß-estradiol on bone resorption, a number of studies provide evidence for indirect effects of estrogen in bone, via the alteration in production of local regulatory cytokines such as IL-1, IL-6 (25, 27), TNF (29), and TGFß (28). In the latter study, Hughes and colleagues reported that estrogen promoted apoptosis of murine osteoclasts, an effect apparently mediated by TGFß. Kameda et al. (18) have also shown that estrogen induces apoptosis of purified rabbit osteoclasts, although they suggested that this was a direct effect. However, we observed no change in osteoclast number in response to estrogen, suggesting that it does not induce apoptosis under the culture conditions used.
A number of studies have looked specifically for the presence of ER in GCT, as the tumors are characterized by female predominance and have a peak incidence in the third and fourth decades of life. Malawer and colleagues (20), using fluorescent histochemical techniques, showed that stromal cells, but not osteoclasts, in GCT possess cytoplasmic estrogen and progesterone binding sites. A recent study by Ishibe et al. (21) also showed that GCT tumor cytosol expressed biochemically detectable estrogen binding sites, but no ER was observed using immunohistochemical techniques. Our results differ from the previous work of Oursler and colleagues, who demonstrated expression of ER mRNA by RT-PCR in highly purified osteoclast populations from GCT (16). However, in view of the high sensitivity of the RT-PCR technique and the fact that their preparation contained 510% mononuclear cells, it is possible that the ER PCR product may have derived from these contaminating mononuclear cells. Although these investigators did not find detectable ER protein in the mononuclear fraction, they did not exclude the presence of ER mRNA in the mononuclears by RT-PCR. Furthermore, in contrast to our results, Oursler et al. found that estrogen treatment inhibited bone resorbing activity of GCT osteoclasts. The reason for this divergence is unknown although it may be due to substantial differences in the cell preparation, in particular, the differences in purity.
Our results indicate that significant expression of functional ER does not occur in multinucleate osteoclasts present in human GCT, although ER expression in mononuclear osteoclast precursors cannot be excluded. In view of the neoplastic nature of GCT, these results do not exclude the possibility that significant ER is present in osteoclasts derived from normal human bone and, because of possible species differences, the results cannot be generalized to other species. Nevertheless, as there is no evidence that GCT osteoclasts are different to normal human osteoclasts, we believe that it is likely that significant ER expression is not a feature of the normal human multinucleated osteoclast phenotype. To resolve these issues, further work with pure populations of osteoclasts and sensitive localization techniques is required. These results support the hypothesis that the antiresorptive effects of estrogen in vivo are predominantly mediated indirectly via mononuclear cells present in the bone microenvironment.
| Footnotes |
|---|
Received July 23, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
V. Parikka, Z. Peng, T. Hentunen, J. Risteli, T. Elo, H K. Vaananen, and P. Harkonen Estrogen responsiveness of bone formation in vitro and altered bone phenotype in aged estrogen receptor-{alpha}-deficient male and female mice Eur. J. Endocrinol., February 1, 2005; 152(2): 301 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vanderschueren, L. Vandenput, S. Boonen, M. K. Lindberg, R. Bouillon, and C. Ohlsson Androgens and Bone Endocr. Rev., June 1, 2004; 25(3): 389 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Sakai, S Jingushi, T Shuto, K Urabe, T Ikenoue, K Okazaki, T Kukita, A Kukita, and Y Iwamoto Fibroblasts from the inner granulation tissue of the pseudocapsule in hips at revision arthroplasty induce osteoclast differentiation, as do stromal cells Ann Rheum Dis, February 1, 2002; 61(2): 103 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Huang, J. Xu, D. J. Wood, and M. H. Zheng Gene Expression of Osteoprotegerin Ligand, Osteoprotegerin, and Receptor Activator of NF-{kappa}B in Giant Cell Tumor of Bone : Possible Involvement in Tumor Cell-Induced Osteoclast-Like Cell Formation Am. J. Pathol., March 1, 2000; 156(3): 761 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
Estrogen: Consequences and Implications of Human Mutations in Synthesis and Action J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4677 - 4694. [Abstract] [Full Text] |
||||
![]() |
T. C. Spelsberg, M. Subramaniam, B. L. Riggs, and S. Khosla The Actions and Interactions of Sex Steroids and Growth Factors/Cytokines on the Skeleton Mol. Endocrinol., June 1, 1999; 13(6): 819 - 828. [Full Text] |
||||
![]() |
C. Minkin and V.C. Marinho Role of the Osteoclast at the Bone-Implant Interface Advances in Dental Research, June 1, 1999; 13(1): 49 - 56. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |