help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Collier, F. McL.
Right arrow Articles by Nicholson, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Collier, F. McL.
Right arrow Articles by Nicholson, G. C.
Endocrinology Vol. 139, No. 3 1258-1267
Copyright © 1998 by The Endocrine Society

ARTICLES

Osteoclasts from Human Giant Cell Tumors of Bone Lack Estrogen Receptors1

Fiona McL. Collier, Wen Hua Huang, Wayne R. Holloway, Jason M. Hodge, Matthew T. Gillespie, Lillian L. Daniels, Ming Hao Zheng and Geoffrey C. Nicholson

The University of Melbourne, Department of Medicine (F.M.C., W.R.H., J.M.H., G.C.N.), The Geelong Hospital, Box 281, Geelong 3220, Australia; Department of Orthopaedic Surgery (W.H.H., L.L.D., M.H.Z.), University of Western Australia, QEII Medical Centre, Nedlands, Western Australia 6009, Australia; St. Vincent’s Institute of Medical Research and The University of Melbourne, Department of Medicine (M.T.G.), Fitzroy 3065, Australia

Address all correspondence and requests for reprints to: Professor G. C. Nicholson, The University of Melbourne, Department of Medicine, The Geelong Hospital, P.O. Box 281, Geelong 3220, Australia. E-mail: G.Nicholson{at}medicine.unimelb.edu.au


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although estrogen is important in human skeletal homeostasis, the major target cell in bone is unknown. Estrogen receptors (ER) have been demonstrated in osteoblasts and bone marrow stromal cells, but their presence in osteoclasts remains controversial because completely pure preparations have not been available. We have examined expression of ER-{alpha} and ER-ß messenger RNA (mRNA) by RT-PCR in samples from human giant cell tumor of bone (GCT), including: whole tumor, cultured mononuclear cells, and a pure osteoclast population obtained by microisolation. Whole tumor expressed both ER-{alpha} and calcitonin receptor (CTR) mRNA and apparently lower levels of ER-ß mRNA. Passaged cultures of tumor mononuclear stromal cells also expressed ER-{alpha} and low ER-ß but not CTR mRNA. In pure preparations of microisolated osteoclasts, expression of ER-{alpha} or ER-ß mRNA was not detected, whereas expression of CTR mRNA was readily identified. Microisolated GCT mononuclear cells expressed ER-{alpha}, but no detectable CTR mRNA. Fluorescence in situ hybridization (FISH) using an ER-{alpha} riboprobe demonstrated strong signal in the mononuclear cells but multinucleated osteoclasts showed no detectable signal. In contrast, CTR mRNA was detected in multinucleated osteoclasts but not in stromal-like tumor cells by FISH. 17ß-estradiol consistently showed no effect on bone resorbing activity of osteoclasts from GCT cultured on cortical bone, although calcitonin was a potent inhibitor. These findings indicate that significant expression of ER does not occur in osteoclasts derived from human GCT and suggest that estrogen effects are mediated by other cells of the bone environment.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IT IS WELL established that reduced estrogen levels associated with the menopause result in increased osteoclastic bone resorption and subsequent osteoporosis and that this process can be prevented by estrogen (1). However, direct effects of estrogen on bone in organ culture have been either absent (2) or quite subtle (3) and, as initial studies failed to detect estrogen receptor (ER) in cultured bone cells (4), it was generally accepted that effects of estrogen on bone were indirect. Interest in the possibility of direct effects on bone was renewed in 1988 when low numbers of ER were identified in normal human osteoblasts (5) and osteoblast-like osteosarcoma cells (6). Subsequent studies have supported the presence of ER, albeit in relatively low abundance, in cells of the osteoblast lineage (7, 8, 9, 10, 11) and in related bone marrow stromal cells (12, 13, 14).

Although there is general agreement that cells of the osteoblast lineage possess ER, their presence in osteoclasts has been difficult to prove or disprove because pure preparations have not been available. Some investigators have used enriched osteoclast preparations, in which ER has been examined by molecular techniques (15, 16, 17, 18). Oursler and colleagues found evidence of ER in 90–95% pure preparations of avian osteoclasts using Northern and Western analyses (15), and also in osteoclasts of similar purity derived from giant cell tumor of bone (GCT, also called osteoclastoma) using RT-PCR and Western analysis (16). In both cases, estrogen treatment of the cultures inhibited bone resorption and induced changes in expression of specific messenger RNAs (mRNAs). Mano and colleagues (17) demonstrated low levels of ER mRNA by Northern analysis in 95% pure rabbit osteoclast populations and also showed estrogen-induced inhibition of bone resorption. Recently, Kameda and co-workers (18) also used highly purified rabbit osteoclast preparations to demonstrate expression of ER{alpha} by Northern analysis together with estrogen-induced inhibition of bone resorption and promotion of apoptosis.

Another approach to the problem of contaminated preparations has been direct visualization of ER or ER mRNA using in situ techniques. For example, Pensler and colleagues (19) used immunocytochemistry to demonstrate nuclear ER and progesterone receptors in human osteoclasts. However, other studies using histochemical (20) and immunocytochemical (21) techniques have failed to demonstrate ER in osteoclasts from GCT. In a recent preliminary study employing in situ hybridization, no ER mRNA expression was found in mammalian osteoclasts, although expression was present in chondrocytes and osteoblasts (22). In contrast, ER mRNA was shown in human osteoclasts using the more sensitive technique of in situ RT-PCR, although the signal in osteoclasts was less than in osteoblasts (23). Other recent work has produced evidence that indirect effects mediated by cytokines (24), including IL-6 (25, 26), IL-1 (27), TGFß (28), and TNF (29) are important in the actions of estrogen in bone, although these results do not exclude the possibility of coexistent direct effects.

In summary, although there is evidence that osteoclasts possess ER, there are conflicting data, and the issue remains controversial (30). To overcome the problem of impure osteoclast preparations, we have used the novel technique of microisolation (31) to prepare 100% pure osteoclasts from GCT. Using this approach, together with RT-PCR, we found that multinucleate osteoclasts present in GCT do not express ER mRNA, and we have confirmed this finding using fluorescent in situ hybridization. Furthermore, we found that estrogen has no effect on the bone resorbing activity of GCT osteoclasts.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Tissue culture media and BSA were purchased from Sigma Chemical Co. (St. Louis, MO) and FBS from CSL (Melbourne, Australia). 17ß-estradiol (cell culture tested, water soluble, Sigma) was dissolved in media at a concentration of 10-2 M, aliquoted, and stored at -70 C. Salmon calcitonin (sCT), a gift from Novartis Pharmaceuticals (Sydney, Australia), was dissolved in 0.01% acetic acid at 10-4 M, aliquoted, and stored at -70 C. Total cellular RNA was isolated with RNAzol B (Tel-Test, Inc., Friendswood, TX). Diethyl pyrocarbonate (DEPC) was purchased from BDH Laboratory Supplies (Poole, UK). A first strand complementary DNA (cDNA) synthesis kit (Boehringer Mannheim, Mannheim, Germany) was used for RT reactions and in PCR reactions, deoxynucleotide triphosphates (dNTPs) were obtained from Promega (Madison, WI). Reaction buffer, MgCl2, Taq DNA polymerase and 100 bp DNA ladder were all supplied by Life Technologies (GIBCO-BRL, Gaithersburg, MD). The plasmid, pGEM-T (Promega) was used to synthesize riboprobes that were labeled with a DIG RNA labeling kit (Boehringer Mannheim).

Preparation of whole giant cell tumor mixed cell suspension
The protocol was approved by The Geelong Hospital Human Research and Ethics Advisory Committee. A total of fifteen cases of GCT were collected after informed consent. Tumor tissue was chopped crudely in the operating room and transported on ice to the laboratory in sterile HEPES-buffered medium 199. Tissue fragments were passed initially through a cell dissociation sieve of 380 µm mesh, then filtered through 280 µm mesh to produce a mixed cell suspension. This suspension was used immediately for total RNA extraction and to prepare enriched osteoclasts. Primary cultures of the mixed cells, settled onto bone slices and glass slides, were used for the bone resorption and in situ hybridization experiments, respectively, whereas long-term cultures of two to five passages were used to prepare stromal cells.

Stromal cell culture
Stromal cell cultures were established in 25-cm2 culture flasks by addition of the GCT mixed cell suspension to MEM containing 10% FBS. Cells were cultured until confluent (~3 weeks) and subcultured by treatment with EDTA and trypsin. Total RNA was extracted from one flask of cells at each passage.

Osteoclast enrichment for microisolation and pit assay
To achieve osteoclast enrichment, the GCT mixed cell suspension was layered over 5 ml FBS in a sterile conical tube and allowed to stand for 20 min at 4 C. Two fractions were sequentially removed by pipette and characterized by microscopy. These were: 1) upper fraction, which comprised mainly mononuclear cells; and 2) lower fraction, in which the larger osteoclasts had settled more rapidly into the serum and contained less mononuclear contamination. The FBS sedimentation achieved enrichment of osteoclasts to 10–50% purity, depending on the initial purity of the individual tumor preparation and the number of times the sedimentation was performed (1–3 times).

Osteoclast and mononuclear cell microisolation
Osteoclasts were microisolated from the osteoclast-enriched lower fraction according to Tong et al. (31) with modifications. Thirty microliters of this fraction were added to a sterile culture dish with 10 ml HEPES buffered medium 199 containing 0.85 g/liter sodium bicarbonate, 0.5 mM EDTA, and 10% FBS. Microisolation was performed with a Nikon/Narishige Micromanipulator system (NT-88; Tokyo, Japan) attached to a Nikon inverted microscope. Using phase contrast optics, osteoclasts were identified by their size, multinuclearity, and characteristic appearance. Fifty to 100 of these were individually aspirated into a glass micropipette (tip diameter, 100 µm) with particular care to exclude mononuclear cells. The osteoclasts within the micropipette were then transferred to a culture dish containing fresh medium and checked for any contaminating mononuclear cells that, if present, were removed by aspiration with the micropipette. Likewise, a pure population of 400–600 mononuclear cells was obtained by microisolation of cells from the mononuclear cell-enriched upper fraction. Total RNA was extracted immediately from the microisolated osteoclasts and mononuclear cells.

RNA isolation and RT-PCR
The GCT mixed cell suspension, cultured stromal cells, and microisolated cells were directly lyzed in RNAzol B solution and total RNA extracted according to the manufacturer’s instructions. The RNA pellet was resuspended in DEPC-treated H2O, and the quantity and quality assessed by UV absorbance at 260 nm and 280 nm (except for the microisolated cellular RNA in which the concentration was below the measurement threshold). Ratios were in the range 1.7–2.0.

For RT and PCR reactions, a Perkin Elmer/Cetus DNA Thermal Cycler was used. For most samples, 1 µg total RNA was reverse-transcribed in the presence of 5 mM MgCl2, 1 mM deoxynucleotide mix, 3.2 µg random primers, 50 U RNase inhibitor, and 20 U AMV reverse transcriptase. The final mixture of 20 µl was reacted at 25 C for 10 min, 42 C for 60 min, and 95 C for 5 min to denature the enzyme. In the case of the microisolated cells, all the RNA extracted was dissolved in 5 µl DEPC treated H2O and reverse transcribed to give a 20 µl aliquot of cDNA. One tenth of the cDNA was used in each PCR reaction.

Sense and antisense primers were synthesized on an Oligo100 M synthesizer (Beckman, Fullerton, CA). Oligonucleotide primers for human ER-{alpha} were based on the cDNA sequence, accession number X03635 M11457. The primers (5' to 3') (CTACTGCATCAGATCCAAGG) and (GTCATTGGTACTGGCCAATCT) amplified a 471-bp fragment. Oligonucleotide primers for human ER-ß were based on the cDNA sequence, accession number X99101. The primers (5' to 3') (TGGTCAGGGACATCATCATGG) and (TCAAAGAGGGATGCTCACTTCTG) amplified a 475-bp fragment. Both ER products were confirmed by restriction enzyme digest analysis. The oligonucleotides for human calcitonin receptor (CTR) were: (5' to 3') (hCTR1, GCAATGCTTTCACTCCTGAGAAAC) and (hCTR2, CAGTAAACACACAGCCACGACAAT-GAG). These primers permitted the identification of the two CTR isoforms that differ by inclusion or exclusion of a 16-amino acid insert. The resultant PCR fragments were 364 and 412 bp. To determine the presence of cDNA from microisolated cell samples, oligonucleotide primers specific for human GAPDH were also used. The oligonucleotides were: (5' to 3') (GAPDH 4, CATGGAGAAGGCTGGGGCTC); and (GAPDH 3, CACTGACACGTTGGCAGTGG), which amplified a fragment of 414 bp (32). All the primer pairs spanned intron-exon splice sites allowing for the detection of mRNA only.

PCR amplification was performed with cycles of denaturation at 95 C for 1 min, annealing at 52 C (ER), 55 C (GAPDH), or 56 C (CTR) for 2 min and extension at 72 C for 1 min. The reaction mixture contained 40 pmol of each primer, 200 µM dNTPs, 2 µl of 10 x reaction buffer, optimized concentrations of MgCl2, 0.75 mM (CTR), and 1.0 mM (ER-{alpha}, ER-ß, and GAPDH), 1 U Taq DNA polymerase, and sterile distilled water up to 20 µl. The mixture was then overlayed with paraffin oil. PCR products were resolved on a 1.2% agarose gel and visualized using ethidium bromide. The size of the bands were confirmed by a 100 bp DNA ladder (Life Technologies, GIBCO-BRL). MCF-7 cells (human mammary carcinoma) and Saos-2 cells (human osteoblast-like osteosarcoma), both purchased from ATCC, were used as positive controls for ER-{alpha} and ER-ß, respectively. cDNA from a GCT that had shown maximal inhibition of resorption after treatment with calcitonin (GCT 10) and cDNA lacking the insert isoform were the positive controls for CTR.

Fluorescent in situ hybridization
The GCT mixed cell suspension was settled onto sterile glass cover slips for 2 h, rinsed in PBS, and fixed in freshly prepared 4% paraformaldehyde in DEPC-treated PBS for 15 min. A rat ER-{alpha} cDNA-fragment that also encoded 637 bp of the human ER-{alpha} was subcloned into pGEM-T for generation of riboprobes as described (33). T7 polymerase was used to generate the antisense strand of ER-{alpha} fragment and in situ hybridization was performed as previously described (34). Coverslips were washed in 0.2% Triton X in DEPC-treated PBS for 5 min after fixation. The cells were digested with proteinase K at 2 mg/ml in 0.1 M Tris buffer (pH 8.0) and 50 mM EDTA for 20 min at 37 C in a humidified chamber, followed by 0.1% glycine in PBS for 2 min. They were then postfixed in 4% paraformaldehyde in PBS for 15 min and pretreated with RNase-free DNase (1 U/ml) for 30 min at 37 C before hybridization to ensure specificity of mRNA hybridization. Coverslips were rinsed in PBS between each pretreatment. All procedures were carried out at room temperature unless otherwise indicated. The hybridization solution consisted of 45% deionized formamide, 10% dextran sulfate, 5-fold SSC, and 100 ng/ml of denatured and sonicated salmon sperm DNA. For negative controls, coverslips were incubated with 100 µg/ml of RNase at 37 C for 60 min before prehybridization. Prehybridization was performed at 37 C for 1 h in hybridization solution. The digoxigenin (DIG)-labeled probe of ER-{alpha} was diluted with hybridization solution to a final concentration of 0.2 ng/ml. The mixtures were heated at 65 C for 10 min and then 30 µl placed on each coverslip in a petri dish and incubated at 37 C for 16 h in a humidified chamber. Coverslips were washed twice sequentially in 2-fold, 1-fold, and 0.1-fold SSC at 37 C for 15 min each. They were then incubated with 1% blocking solution for 30 min at room temperature. Probe detection was performed with a fluorescent antibody enhancer set according to the manufacturer’s instructions. The slides were incubated sequentially in anti-DIG (1° antibody), antimouse-DIG (2° antibody), and anti-DIG-fluorescein (3° antibody) each for 60 min at 37 C in a humidified chamber. Slides were rinsed in washing buffer at 37 C after each incubation and the 3° antibody incubation was performed in the dark. Some slides were counterstained with 3 mg/ml of propidium iodide for 30 min at room temperature to view nuclei. After air drying in the dark, the slides were covered with antifade solution and a coverslip. Signal was detected by confocal microscopy.

Bone resorption assay
Methods used were modified from those previously described (35). The GCT mixed cell suspension was settled for 20 or 60 min onto 48 numbered slices of devitalized bovine cortical bone (4 x 4 x 0.1 mm) in a 96-well plate. Bone slices were then washed in medium to remove nonadherent cells. The cultures were incubated in phenol red-free MEM supplemented with 100 IU/ml benzylpenicillin and 0.1% BSA, pH 7.2, at 37 C in a humidified atmosphere of 95% air, 5% CO2, in the presence of vehicle, sCT (10-9 M), or increasing concentrations of 17ß-estradiol (10-11–10-7 M). After incubation for periods from 16–96 h, the cells were fixed in 1% formalin/PBS for 5 min, reacted cytochemically for TRAP and alkaline phosphatase (ALP), and the number of adherent TRAP+ve multinucleated cells and ALP+ve cells counted. The bone slices were then stripped of cells by ultrasonication in 0.25 M NH4OH and processed for scanning electron microscopy. The total number of pits per bone slice was counted in all experiments and pit plan areas measured in representative experiments. Resorption pits were identified by their characteristic surface and defined as being completely circumscribed by unresorbed bone. All measurements were performed blind.

To determine whether length of culture period or degree of stromal/mononuclear cell contamination affected osteoclastic bone resorption in the presence of 17ß-estradiol, the bone resorption assays were established using a number of protocols, including enriched osteoclasts, short settlement (20 min), and long settlement (60 min) of the GCT mixed cell suspension. Bone slices were then incubated for varying times (16, 24, 48, and 96 h).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of ER-{alpha}, ER-ß, and CTR mRNA in GCT mixed cell suspension and stromal cell cultures
Previous studies have shown that primary cultures of GCT contain three types of cells: neoplastic spindle-shaped stromal cells, round macrophage-like cells, and osteoclast-like cells (36, 37). After culture for 1–2 passages, only spindle-shaped stromal tumor cells survive (36). We found that stromal cell cultures grew slowly, requiring 3 weeks to reach confluence, when there were no visible multinucleated TRAP+ve cells remaining and the majority of cells were spindle-shaped mononuclears. RT-PCR analysis of RNA extracts from whole GCT (11 and 12) mixed cell suspension, stromal cell cultures derived from these tumors and control cell lines (Saos-2 and MCF-7) demonstrated expression of ER-{alpha} and ER-ß mRNA in all samples (Fig. 1aGo). The ER-ß signal was much weaker than the ER-{alpha} signal in all the GCT samples. In contrast, the Saos-2 cells showed a much greater signal for ER-ß than ER-{alpha}, suggesting that the disparity in the two signals seen in the GCT samples was not simply due to differences in the efficiency of the PCR reaction. CTR mRNA was expressed in all whole GCT samples examined (see Figs. 1bGo, 2Go, and 4Go).



View larger version (34K):
[in this window]
[in a new window]
  		Figure 1. a, Comparison of ER-{alpha} and ER-ß mRNA expression in mixed cell suspensions from GCT and cultures of stromal cells established from GCT, as demonstrated by RT-PCR, 34 cycles. Samples were prepared from GCT 11 and 12. b, Expression of ER-{alpha} and CTR mRNA in cultures of stromal cells established from GCT, as demonstrated by RT-PCR, 30 cycles. The stromal cell cultures were prepared from GCT 12, 11 & 9 and passaged as described in Methods. The numbers (P1, 2, etc) denote cell passages.

 


View larger version (42K):
[in this window]
[in a new window]
  		Figure 2. Expression of ER-{alpha} and CTR mRNA in microisolated osteoclasts from GCT 12 as demonstrated by RT-PCR. a, CTR mRNA expression. cDNA samples are: A, 80 microisolated osteoclasts; B, GCT 10 whole tumor control; C, CTR control; D, no DNA. A and D were amplified for 51 cycles, B and C for 30 cycles. b, ER-{alpha} mRNA expression. cDNA samples are: A, 80 microisolated osteoclasts; B, GCT 10 whole tumor control; C, MCF-7 control; D, no DNA. All were amplified for 56 cycles.

 


View larger version (26K):
[in this window]
[in a new window]
  		Figure 4. Expression of CTR and ER-{alpha} mRNA in microisolated osteoclasts from GCT 15 as demonstrated by RT-PCR. cDNA samples are: A, 50 microisolated osteoclasts; B, GCT 10 whole tumor control; C, no DNA; D, 50 microisolated osteoclasts; E, MCF-7 control; F, no DNA. A, C, D, and F were amplified for 56 cycles; B and E for 37 cycles.

 
Expression of ER-{alpha} mRNA was demonstrated in stromal cell cultures derived from GCT 9, 11, and 12 and remained evident up to five passages (Fig. 1bGo). In contrast, CTR gene transcript was not detected in any passages after equivalent PCR amplification, indicating that osteoclasts or osteoclast precursors were either absent or present only in low number (Fig. 1bGo). These results demonstrate that GCT stromal cells express ER-{alpha} and ER-ß mRNA but not CTR mRNA.

Detection of ER and CTR mRNA in pure osteoclast and mononuclear preparations
To determine which cells express ER mRNA, pure osteoclasts and mononuclear cells from three tumors (GCT 9, GCT 12, and GCT 15) were microisolated from the lower and upper fractions, respectively, of the FBS sedimentation gradient. Total RNA from the microisolated cells was reverse transcribed to prepare cDNA and one tenth of the cDNA sample was used for the PCR reactions. In 80 osteoclasts microisolated from GCT 12, expression of CTR mRNA was readily demonstrated, whereas there was no band visible for ER-{alpha} mRNA (Fig. 2Go). Evaluation by PCR (52 cycles) showed that total RNA from approximately 400 mononuclear cells was required to produce a GAPDH product equivalent to 50 microisolated osteoclasts (Fig. 3aGo). In a separate experiment, ER-{alpha} PCR product was shown in 600 microisolated mononuclear cells but not in 80 osteoclasts that had been amplified for an equivalent number of cycles (Fig. 3bGo). This demonstrated that ER-{alpha} mRNA was expressed in mononuclear cells but not in a matched quantity of cDNA from pure osteoclasts. A similar result was seen with pure osteoclasts and a sample of mononuclear cells microisolated from GCT 9 (data not shown). Osteoclasts microisolated from a third tumor (GCT 15) demonstrated CTR product but no detectable ER-{alpha} (Fig. 4Go) or ER-ß mRNA (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3. a, Comparison of GAPDH mRNA expression in microisolated osteoclast and mononuclear cells from GCT 9, demonstrated by RT-PCR, 52 cycles. cDNA samples are: A, 50 microisolated osteoclasts; B, 400 mononuclear cells; C, no DNA. b, ER-{alpha} mRNA expression in microisolated osteoclasts and mononuclear cells from GCT 12, demonstrated by RT-PCR. cDNA samples are: A, 80 microisolated osteoclasts; B, 600 mononuclear cells; C, GCT 12 whole tumor control; D, GCT 12 cultured stromal cells, passage 2; E, GCT 10 whole tumor control; F, no DNA. A, B, and F were amplified for 54 cycles; C, D, and E for 30 cycles.

 
Localization by FISH of ER and CTR gene transcripts in GCT
To confirm the RT-PCR findings, FISH for ER-{alpha} and CTR was performed on cultures of whole tumor (Fig. 5Go). Signal for ER-{alpha} mRNA in osteoclasts was no greater than background (Fig. 5aGo, panel A), whereas abundant expression was detected in the cytoplasm of both stromal (panel B) and macrophage-like mononuclear cells (panel C). Signal was absent following treatment with RNase, indicating specificity of the probe for target mRNA sequence (panel D). In contrast, FISH for CTR showed a strong signal in the cytoplasm of the osteoclasts (Fig. 5bGo, panel A) and macrophage-like mononuclear cells (panel C), but there was background signal only in the stromal cells (panel B). RNase treatment resulted in loss of the signal (panel D).



View larger version (56K):
[in this window]
[in a new window]
  		Figure 5. Localization of ER-{alpha} and CTR gene transcripts by fluorescent in situ hybridization in mixed cell cultures from GCT 9. (a), ER-{alpha} gene transcript. A, Osteoclast (arrowed) showing very low signal for ER-{alpha} mRNA that is not significantly greater than background signal (i.e. below the sensitivity of the intensity bar). B, Stromal-like mononuclear cell showing positive signal for ER-{alpha} mRNA. C, Macrophage-like mononuclear cell showing positive signal for ER-{alpha} mRNA. D, The ER-{alpha} mRNA signal was not present when the preparation was treated with RNase before hybridization. The scale bar in panel A relates to all panels and denotes: A, 10 µm; B, 25 µm; C, 25 µm; and D, 15 µm. (b), CTR gene transcript. A, Osteoclast (arrowed) showing positive signal for CTR mRNA. B, Stromal-like mononuclear cell expressing very little CTR mRNA. C, Macrophage-like mononuclear cell expressing abundant CTR mRNA. D, The CTR mRNA signal was not present when the preparation was treated with RNase before hybridization. The scale bar in panel A relates to all panels and denotes: A, 15 µm; B, 30 µm; C, 30 µm; and D, 30 µm.

 
Effect of estrogen on bone resorption
To test the biological response of GCT osteoclasts to sCT and 17ß-estradiol, we performed bone resorption assays with cells from eight different GCT according to the various protocols described in the methods section. The number of TRAP+ve multinucleated cells per bone slice varied between experiments (mean 13 to 350). The number of TRAP-ve mononuclear cells per bone slice also varied considerably (mean 190 to 1570) depending on the protocol used, although the number of ALP+ve mononuclear cells was consistently low (<1% of mononuclears). A photomicrograph of a representative bone slice, reacted for TRAP is shown in Fig. 6aGo. In all experiments, treatment with 17ß-estradiol (10-11–10-7 M) had no effect on osteoclast number or bone resorption as quantified by pit number, pit area, or resorption index (pit number/osteoclast number). However, in all cultures treated with sCT, there was a significant reduction in the number of resorption pits (Fig. 6bGo). The results indicate that under the culture conditions used bone resorbing activity in GCT cultures is modulated by calcitonin but not estrogen.



View larger version (84K):
[in this window]
[in a new window]
  		Figure 6. A, GCT cells cultured on a bovine cortical bone slice. Cells from the mixed GCT suspension were settled on to bone slices for 20 min (short settlement), washed to remove nonadherent cells, and then incubated in phenol red-free MEM/0.1% BSA for 24 h. The cells were fixed in 1% formalin and reacted for TRAP. A group of four osteoclasts with >30 nuclei and two round-shaped mononuclear cells (arrowed), all exhibiting strongly positive reactions for TRAP, are shown. It should be noted that no counterstain has been used and therefore TRAP negative cells, including spindle-shaped stromal cells are not visualized. (bar, 50 µm). B, Effect of calcitonin and 17ß-estradiol on bone resorption as assessed by pit number. Mixed GCT cells were settled on to bone slices for 20 min (short settlement), washed to remove nonadherent cells, and then incubated in absence or presence of sCT (10-9 M) and 17ß-estradiol (10-11–10-8 M) for 24 h. Results expressed as mean ± SEM (n = 8 bone slices/treatment group). *, P < 0.000, one-way ANOVA. These data are representative of 20 other similar experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Human GCT, also referred to as osteoclastomas, are considered to arise from a neoplasm of mesenchymal stromal cells that have the capacity to recruit and interact with macrophages and multinucleated osteoclast-like giant cells (37, 38, 39). We have used GCT as a source of surrogate human osteoclasts because many studies have demonstrated that the giant cells express all the crucial characteristics of the osteoclast phenotype, including expression of TRAP, carbonic anhydrase II, and CTR and also the ability to resorb bone (34, 40, 41, 42).

Our PCR studies showed expression of ER-{alpha} and ER-ß mRNA in both GCT mixed cell suspension and passaged stromal cells from three tumors. ER-ß mRNA expression in the GCT specimens was negligible compared with that demonstrated in control transformed cell lines, suggesting, although not proving, that ER-{alpha} is the predominant subtype in GCT. The expression of ER-ß mRNA has recently been reported in rat osteoblasts and cancellous bone, although its role there remains uncertain (43). The presence of ER-{alpha} mRNA in GCT stroma is in concordance with current evidence that bone marrow stromal cells possess ER (12, 13, 14), and also with a recent study demonstrating that osteoclast-depleted, passaged stromal cells from GCT express osteoblast phenotype and become osteogenic under appropriate culture conditions (44).

Using the novel method of cellular microisolation, we were able to show that ER-{alpha} mRNA expression was not detectable in multinucleate osteoclasts isolated from three GCT. However, after equal amplification, ER-{alpha} mRNA was readily detectable in a matched quantity of cDNA from microisolated mononuclear cells. The mononuclear fraction of GCT is composed of a heterogeneous population of cells, including osteoclast precursors, which have previously been purified and characterized (45). Although we demonstrated expression of ER-{alpha} mRNA in passaged tumor stromal cells, the possibility that other mononuclear cells may also express ER mRNA cannot be excluded. In view of the known effects of estrogen on osteoclastogenesis (46, 47), and the demonstration of ER expression in osteoclast-like cell lines (48), the possibility exists that osteoclast precursors may possess functional ER which are lost with differentiation or fusion.

In support of our findings with the microisolation/RT-PCR procedure, we have used in situ hybridization, a technique that has been useful in the investigation of osteoclast biology (34, 36, 49). The sensitivity and specificity of in situ hydridization is substantially improved by FISH with DIG-FITC enhancer. The latter increases the number of fluorescent molecules per hapten, resulting in higher sensitivity than other in situ hybridization techniques. Using FISH, we have clearly demonstrated that CTR, but no significant ER-{alpha} mRNA, is present in multinucleate osteoclasts. The spindle-shaped mononuclear cells, which were the predominant cell in the mixed cultures, expressed ER-{alpha} but no CTR mRNA. Expression of both transcripts was observed in the less abundant round macrophage-like mononuclear cells, again suggesting that ER may be present on CTR+ve mononuclear osteoclast precursors. Previously, using autoradiography, we found that CTR+ve mononuclears comprised only 1–2% of the total cell population in GCT cultures (42). In the absence of double labeling, we cannot exclude the possibility that ER and CTR are present in two different populations of round mononuclear cells.

We showed that 17ß-estradiol had no effect on bone resorption in 21 bone resorption assays (from eight different GCT) with a wide variation of mononuclear cell contamination. Previous in vitro investigations of estrogen effects on bone resorption have shown variable results. Inhibition has been reported in a number of species, including rabbit osteoclast cultures (17, 18), PTH-stimulated mouse calvarial cultures (3), and purified avian and GCT osteoclasts (15, 16). No effect of estrogen (50) or slight stimulation of resorption (51) has been noted in neonatal rat osteoclast bone resorption assays. Using this rat model, we have consistently found no effect of 17ß estradiol on resorption pit formation (our unpublished results). In some reports, the decrease in resorption has been due to inhibition in osteoclast formation and not to reduction in pit formation per se (46, 47). Overall, the data relating to the effects of estrogen on bone cell cultures are inconsistent and may be dependent on the culture system used and the species studied.

Although we found no effect of 17ß-estradiol on bone resorption, a number of studies provide evidence for indirect effects of estrogen in bone, via the alteration in production of local regulatory cytokines such as IL-1, IL-6 (25, 27), TNF (29), and TGFß (28). In the latter study, Hughes and colleagues reported that estrogen promoted apoptosis of murine osteoclasts, an effect apparently mediated by TGFß. Kameda et al. (18) have also shown that estrogen induces apoptosis of purified rabbit osteoclasts, although they suggested that this was a direct effect. However, we observed no change in osteoclast number in response to estrogen, suggesting that it does not induce apoptosis under the culture conditions used.

A number of studies have looked specifically for the presence of ER in GCT, as the tumors are characterized by female predominance and have a peak incidence in the third and fourth decades of life. Malawer and colleagues (20), using fluorescent histochemical techniques, showed that stromal cells, but not osteoclasts, in GCT possess cytoplasmic estrogen and progesterone binding sites. A recent study by Ishibe et al. (21) also showed that GCT tumor cytosol expressed biochemically detectable estrogen binding sites, but no ER was observed using immunohistochemical techniques. Our results differ from the previous work of Oursler and colleagues, who demonstrated expression of ER mRNA by RT-PCR in highly purified osteoclast populations from GCT (16). However, in view of the high sensitivity of the RT-PCR technique and the fact that their preparation contained 5–10% mononuclear cells, it is possible that the ER PCR product may have derived from these contaminating mononuclear cells. Although these investigators did not find detectable ER protein in the mononuclear fraction, they did not exclude the presence of ER mRNA in the mononuclears by RT-PCR. Furthermore, in contrast to our results, Oursler et al. found that estrogen treatment inhibited bone resorbing activity of GCT osteoclasts. The reason for this divergence is unknown although it may be due to substantial differences in the cell preparation, in particular, the differences in purity.

Our results indicate that significant expression of functional ER does not occur in multinucleate osteoclasts present in human GCT, although ER expression in mononuclear osteoclast precursors cannot be excluded. In view of the neoplastic nature of GCT, these results do not exclude the possibility that significant ER is present in osteoclasts derived from normal human bone and, because of possible species differences, the results cannot be generalized to other species. Nevertheless, as there is no evidence that GCT osteoclasts are different to normal human osteoclasts, we believe that it is likely that significant ER expression is not a feature of the normal human multinucleated osteoclast phenotype. To resolve these issues, further work with pure populations of osteoclasts and sensitive localization techniques is required. These results support the hypothesis that the antiresorptive effects of estrogen in vivo are predominantly mediated indirectly via mononuclear cells present in the bone microenvironment.


   Footnotes
 
1 This work was supported by the National Health and Medical Research Council of Australia. Back

Received July 23, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Turner RT, Riggs BL, Spelsberg TC 1994 Skeletal effects of estrogen. Endocr Rev 15:275–300[CrossRef][Medline]
  2. Caputo CB, Meadows D, Raisz LG 1976 Failure of estrogens and androgens to inhibit bone resorption in tissue culture. Endocrinology 98:1065–1068[Abstract]
  3. Pilbeam CC, Klein-Nulend J, Raisz LG 1989 Inhibition by 17beta-estradiol of PTH stimulated resorption and prostaglandin production in cultured neonatal mouse calvariae. Biochem Biophys Res Commun 163:1319–1324[CrossRef][Medline]
  4. van Paassen HC, Poortman J, Borgart-Cretzburg IH, Thijssen JH, Duursma SA 1978 Oestrogen binding proteins in bone cell cytosol. Calcif Tissue Res 25:249–254[CrossRef][Medline]
  5. Eriksen EF, Colvard DS, Berg NJ, Graham ML, Mann KG, Spelsberg TC, Riggs BL 1988 Evidence of estrogen receptors in normal human osteoblast-like cells. Science 241:84–86[Abstract/Free Full Text]
  6. Komm BS, Terpening CM, Benz DJ, Graeme KA, Gallegos A, Korc M, Greene GL, O’Malley BW, Haussler MR 1988 Estrogen binding, receptor mRNA, and biologic response in osteoblast-like osteosarcoma cells. Science 241:81–84[Abstract/Free Full Text]
  7. Ikegami A, Inohue S, Hosoi T, Mizuno Y, Nakamura T, Ouchi Y, Orimo H 1993 Immunohistochemical detection and northern blot analysis of estrogen receptor in osteoblastic cells. J Bone Miner Res 8:1103–1109[Medline]
  8. Ikegami A, Inoue S, Hosoi T, Kaneki M, Mizuno Y, Akedo Y, Ouchi Y, Orimo H 1994 Cell cycle-dependent expression of estrogen receptor and effect of estrogen on proliferation of synchronized human osteoblast-like osteosarcoma cells. Endocrinology 135:782–789[Abstract]
  9. Leisagang P, Romalo G, Sudmann M, Wolf L, Schweikert HU 1994 Human osteoblast-like cells contain specific, saturable, high affinity glucocorticoid, androgen, estrogen, and 1 alpha, 25-dihydroxycholecalciferol receptors. J Androl 15:194–199[Abstract/Free Full Text]
  10. Slootweg MC, Ederveen AG, Schot LP, Schoonen WG, Kloosterboer HJ 1992 Oestrogen and progestogen synergistically stimulate human and rat osteoblast proliferation. J Endocrinol 133:R5–R8
  11. Braidman IP, Davenport LK, Carter Dh, Selby PL, Mawer EB, Freemont AJ 1995 Preliminary in situ identification of estrogen target cells in bone. J Bone Miner Res 10:74–80[Medline]
  12. Girasole G, Jilka RL, Passeri G, Boswell S, Boder G, Williams DC, Manolagas SC 1992 17ß-estradiol inhibits interleukin-6 production by bone marrow-derived stromal cells and osteoblasts in vitro: a potential mechanism for the antiosteoporotic effect of estrogens. J Clin Invest 89:883–891
  13. Bellido T, Girasole G, Passeri G, Yu XP, Mocharla H, Jilka RL, Notides A, Manolagas SC 1993 Demonstration of estrogen and vitamin D receptors in bone marrow-derived stromal cells: up-regulation of the estrogen receptor by 1,25-dihydroxyvitamin-D3. Endocrinology 133:553–562[Abstract]
  14. Zhang RW, Supowit SC, Xu X, Li H, Christensen MD, Lozano R, Simmons DJ 1995 Expression of selected osteogenic markers in the fibroblast-like cells of rat marrow stroma. Calcif Tissue Int 56:283–291[CrossRef][Medline]
  15. Oursler MJ, Osdoby P, Pyfferoen J, Riggs BL, Spelsberg TC 1991 Avian osteoclasts as estrogen target cells. Proc Natl Acad Sci USA 88:6613–6617[Abstract/Free Full Text]
  16. Oursler MJ, Pederson L, Fitzpatrick L, Riggs BL, Spelsberg T 1994 Human giant cell tumors of the bone (osteoclastomas) are estrogen target cells. Proc Natl Acad Sci USA 91:5227–5231[Abstract/Free Full Text]
  17. Mano H, Yuasa T, Kamedi T, Miyazawa K, Nakamura Y, Shiokawa M, Mori Y, Yamada T, Miyata K, Shindo H, Azuma H, Hakeda Y, Kumegawa M 1996 Mammalian mature osteoclasts as estrogen target cells. Biochem Biophys Res Commun 223:637–642[CrossRef][Medline]
  18. Kameda T, Mano H, Yuasa T, Mori Y, Miyazawa K, Shiokawa M, Nakamaru Y, Hiroi E, Hiura K, Kameda A, Yang NN, Hakeda Y, Kumegawa M 1997 Estrogen inhibits bone resorption by directly inducing apoptosis of the bone-resorbing osteoclasts. J Exp Med 186:489–495[Abstract/Free Full Text]
  19. Pensler JM, Radosevich JA, Higbee R, Langman CB 1990 Osteoclasts isolated from membranous bone in children exhibit nuclear estrogen and progesterone receptors. J Bone Miner Res 5:797–802[Medline]
  20. Malawer M, Bray M, Kass M 1984 Fluorescent histochemical demonstration of estrogen and progesterone binding in giant cell tumors of bone: preliminary observations. J Surg Oncol 25:148–152[Medline]
  21. Ishibe M, Ishibe Y, Ishibashi T, Nojima T, Rosier RN, Puzas JE, Kaneda K 1994 Low content of estrogen receptors in human giant cell tumors of bone. Arch Orthop Trauma Surg 113:106–109
  22. Kusec V, Virdi AS, Prince R, Kenwright J, Triffitt JT 1996 Localisation of estrogen receptor mRNA in skeletal cells by in situ hybridisation. Osteoporosis Int [Suppl 1] 6:84
  23. Hoyland JA, Mee AP, Baird P, Braidman IP, Mawer EB, Freemont AJ 1997 Demonstration of estrogen receptor mRNA in bone using in situ reverse-transcriptase polymerase chain reaction. Bone 20:87–92[Medline]
  24. Pacifici R, Brown C, Puscheck E, Friedrich E, Slatopolsky E, Maggio D, McCracken R, Avioli LV 1991 Effect of surgical menopause and estrogen replacement on cytokine release from human blood mononuclear cells. Proc Natl Acad Sci USA 88:5134–5138[Abstract/Free Full Text]
  25. Jilka RL, Hangoc G, Girasole G, Passeri G, Williams DC, Abrams JS, Boyce B, Broxmeyer H, Mangolas SC 1992 Increased osteoclast development after estrogen loss: mediation by interleukin-6. Science 257:88–92[Abstract/Free Full Text]
  26. Poli V, Balena R, Fattori E, Markatos A, Yamamoto M, Tanaka H, Ciliberto G, Rodan GA 1994 Interleukin-6 deficient mice are protected from bone loss caused by estrogen depletion. EMBO J 13:1189–1196[Medline]
  27. Miyaura C, Kusano K, Masuzawa T, Chaki O, Onoe Y, Aoyagi M, Sasaki T, Tamura T, Koishihara Y, Ohsugi Y, Suda T 1995 Endogenous bone resorbing factors in estrogen deficiency: cooperative effects of IL-1 and IL-6. J Bone Miner Res 10:1365–1373[Medline]
  28. Hughes DE, Dai A, Tiffee JC, Li HH, Mundy GR, Boyce BF 1996 Estrogen promotes apoptosis of murine osteoclasts mediated by TGF-Kimble RB, Bain S, Pacifici R 1997 The functional block of TNF but not of IL-6 prevents bone loss in ovariectomized mice. J Bone Miner Res 12:935–941
  29. Raisz L 1996 Estrogen and bone: new pieces to the puzzle. Nat Med 2:1077–1078[CrossRef][Medline]
  30. Tong H-S, Sakai DD, Sims SM, Dixon SJ, Yamin M, Goldring SR, Snead ML, Minkin C 1994 Murine osteoclasts and spleen cell polykaryons are distinguished by mRNA phenotyping. J Bone Miner Res 9:577–584[Medline]
  31. Southby J, Murphy LM, Martin TJ, Gillespie MT 1996 Cell-specific and regulator-induced promoter usage and messenger ribonucleic acid splicing for parathyroid hormone-related peptide. Endocrinology 137:1349–1357[Abstract]
  32. Huang WH, Lau AT-T, Fujii H, Seydel U, Wood DJ, Papadimitriou JM, Zheng MH Detection of mRNAs for estrogen receptor, carbonic anhydrase II and tartrate resistant acid phosphatase in neonatal rat putative mononuclear osteoclast precursor (MOPC) by fluorescence in situ hybridisation (FISH). J Mol Endocrinol, in press
  33. Zheng MH, Fan Y, Wysocki S, Wood DJ, Papadimitriou JM 1993 Detection of mRNA for carbonic anhydrase II in human osteoclast-like cells by in situ hybridisation. J Bone Miner Res 8:113–118[Medline]
  34. Britto JM, Fenton AJ, Holloway WR, Nicholson GC 1994 Osteoblasts mediate thyroid hormone stimulation of osteoclastic bone resorption. Endocrinology 134:169–176[Abstract]
  35. Zheng MH, Fan Y, Wysocki SJ, Lau AT, Robertson T, Beilharz M, Wood DJ, Papadimitriou JM 1994 Gene expression of transforming growth-ß 1 and its type II receptor in giant cell tumors of bone. Possible involvement in osteoclast-like cell migration. Am J Pathol 145:1095–1104[Abstract]
  36. Goldring SR, Roelke MS, Petrison KK, Bhan AK 1987 Human giant cell tumors of bone identification and characterization of cell types. J Clin Invest 79:483–491
  37. Joyner CJ, Quinn JM, Triffitt JT, Owen ME, Athanasou NA 1992 Phenotypic characterisation of mononuclear and multinucleated cells of giant cell tumour of bone. Bone Miner 16:37–48[CrossRef][Medline]
  38. Oreffo ROC, Marshall GJ, Kirchen M, Garcia C, Gallwitz WE, Chavez J, Mundy GR, Bonewald LF 1993 Characterization of a cell line derived from a human giant cell tumor that stimulates osteoclastic bone resorption. Clin Orthop Relat Res 296:229–241
  39. Chambers TJ, Fuller K, McSheedy PMJ 1985 The effect of calcium-regulating hormones on bone resorption by isolated human osteoclastoma cells. J Pathol 145:297–305[CrossRef][Medline]
  40. Horton MA, Lewis D, McNulty K, Pringle JAS, Chambers TJ 1985 Monoclonal antibodies to osteoclastomas (giant cell tumours): definition of osteoclast-specific cellular antigens. Cancer Res 45:5063–5069
  41. Nicholson GC, Horton MA, Sexton PM, D’Santos CS, Moseley JM, Kemp BE, Pringle JAS, Martin TJ 1987 Calcitonin receptors of human osteoclastoma. Horm Metab Res 19:582–586
  42. Onoe Y, Miyaura C, Ohta H, Nozawa S, Suda T 1997 Expression of estrogen receptor beta in rat bone. Endocrinology 138:4509–4512[Abstract/Free Full Text]
  43. James IE, Dodds RA, Olivera DL, Nuttall ME, Gowen M 1996 Human osteoclastoma-derived stromal cells: correlation of the ability to form mineralized nodules in vitro with formation of bone in vivo. J Bone Miner Res 11:1453–1460[Medline]
  44. James IE, Dodds RA, Lee-Rykaczewski E, Eichman CF, Connor JR, Hart TK, Maleeff BE, Lackman RD, Gowen M 1996 Purification and characterization of fully functional human osteoclast precursors. J Bone Miner Res 11:1608–1618[Medline]
  45. Most W, Schot L, Ederveen A, van-der-Wee-Pals L, Papapoulos S, Lowik C 1995 In vitro and ex vivo evidence that estrogens suppress increased bone resorption induced by ovariectomy or PTH stimulation through an effect on osteoclastogenesis. J Bone Miner Res 10:1523–1530[Medline]
  46. Kawashima K, Inoue T, Tsutsumi N, Endo H 1996 Effect of KCA-098 on the function of osteoblast-like cells and the formation of TRAP-positive multinucleated cells in a mouse bone marrow cell population. Biochem Pharmacol 51:133–139[CrossRef][Medline]
  47. Fiorelli G, Gori F, Petilla M, Tanini A, Benvenuti S, Serio M, Bernabei P, Brandi ML 1995 Functional estrogen receptors in a human preosteoclastic cell line. Proc Natl Acad Sci USA 92:2672–2676[Abstract/Free Full Text]
  48. Hofstetter W, Wetterwald A, Cecchini MC, Felix R, Fleisch H, Mueller C 1992 Detection of transcripts for the receptor for macrophage colony-stimulating factor, c-fms, in murine osteoclasts. Proc Natl Acad Sci USA 89:9637–9641[Abstract/Free Full Text]
  49. Arnett TR, Lindsay R, Kilb LM, Moonga BS, Spowage M, Dempster DW 1996 Selective toxic effects of tamoxifen on osteoclasts: comparison with the effects of oestrogen. J Endocrinol 149:503–508[Abstract]
  50. Tobias JH, Chambers TJ 1991 The effect of sex hormones on bone resorption by rat osteoclasts. Acta Endocrinol (Copenh) 124:121–127[Medline]



This article has been cited by other articles:


Home page
 Eur J EndocrinolHome page
V. Parikka, Z. Peng, T. Hentunen, J. Risteli, T. Elo, H K. Vaananen, and P. Harkonen
Estrogen responsiveness of bone formation in vitro and altered bone phenotype in aged estrogen receptor-{alpha}-deficient male and female mice
Eur. J. Endocrinol., February 1, 2005; 152(2): 301 - 314.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
D. Vanderschueren, L. Vandenput, S. Boonen, M. K. Lindberg, R. Bouillon, and C. Ohlsson
Androgens and Bone
Endocr. Rev., June 1, 2004; 25(3): 389 - 425.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
H Sakai, S Jingushi, T Shuto, K Urabe, T Ikenoue, K Okazaki, T Kukita, A Kukita, and Y Iwamoto
Fibroblasts from the inner granulation tissue of the pseudocapsule in hips at revision arthroplasty induce osteoclast differentiation, as do stromal cells
Ann Rheum Dis, February 1, 2002; 61(2): 103 - 109.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
L. Huang, J. Xu, D. J. Wood, and M. H. Zheng
Gene Expression of Osteoprotegerin Ligand, Osteoprotegerin, and Receptor Activator of NF-{kappa}B in Giant Cell Tumor of Bone : Possible Involvement in Tumor Cell-Induced Osteoclast-Like Cell Formation
Am. J. Pathol., March 1, 2000; 156(3): 761 - 767.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
Estrogen: Consequences and Implications of Human Mutations in Synthesis and Action
J. Clin. Endocrinol. Metab., December 1, 1999; 84(12): 4677 - 4694.
[Abstract] [Full Text]

Home page
 Mol. Endocrinol.Home page
T. C. Spelsberg, M. Subramaniam, B. L. Riggs, and S. Khosla
The Actions and Interactions of Sex Steroids and Growth Factors/Cytokines on the Skeleton
Mol. Endocrinol., June 1, 1999; 13(6): 819 - 828.
[Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Collier, F. McL.
Right arrow Articles by Nicholson, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Collier, F. McL.
Right arrow Articles by Nicholson, G. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals