| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Biochemistry (Ke.K., C.M., M.I., T.T., T.S.), School of Dentistry, Showa University, Tokyo 142, Japan; Fuji Gotemba Research Laboratories (T.T.), Chugai Pharmaceutical Company, Ltd., Shizuoka 412, Japan; Department of Biochemistry (A.I.), School of Pharmacy, Tokyo University of Pharmacy and Life Science, Tokyo, 19203, Japan; Department of Biochemistry and Molecular Biology (H.N.), University of Kansas Medical Center, Kansas City, Kansas 66160; and Department of Periodontology (M.I., Ky.K.), School of Dentistry at Tokyo, Nippon Dental University, Tokyo, 102, Japan
Address all correspondence and requests for reprints to: Tatsuo Suda, Department of Biochemistry, School of Dentistry, Showa University, 15-8 Hatanodai, Shinagawa-ku, Tokyo 142, Japan.
| Abstract |
|---|
|
|
|---|
on
days 2 and 5. IL-6 with sIL-6R also induced expression of MMP-13 and
MMP-2 mRNAs on day 2, but the expression was rather transient. These
results demonstrate that the potency of induction of MMPs by IL-1 and
IL-6 is closely linked to the respective bone-resorbing activity,
suggesting that MMP-dependent degradation of bone matrix plays a key
role in bone resorption induced by these cytokines. | Introduction |
|---|
|
|
|---|
Degradation of the organic matrix in bone depends on the activity of proteolytic enzymes, which consist of 2 major classes: the cysteine proteinase family (such as catepsin K) and the matrix metalloproteinase (MMPs) family (7, 8, 9, 10, 11). Over the past years, 18 different mammalian MMPs have been identified. These can be divided into 4 subgroups; collagenases (MMP-1, MMP-8, MMP-13, and MMP-18), gelatinases (MMP-2 and MMP-9), stromelysins (MMP-3 and MMP-10), and membrane-type metalloproteinases (MMPs-1417) (12, 13, 14). These MMPs are all zinc-dependent endopeptidases with the ability to degrade the organic matrix at physiological pH. Sequence comparisons have revealed that mouse and rat collagenases are homologous to the human collagenase 3 identified by Freije et al. (15) and are now referred to as MMP-13. Stromelysins such as MMP-3 not only act as a metalloproteinase but also activate a latent pro-MMP. Therefore, the cooperative effects of collagenases, gelatinases, and stromelysins may be important for MMP-dependent degradation of bone matrix.
Previous reports suggested that MMPs are involved in bone resorption. MMP-13 (collagenase 3) and MMP-2 and MMP-9 (gelatinases A and B) are produced by osteoblasts and/or osteoclasts (8, 10, 16, 17, 18, 19). Tezuka et al. (20) demonstrated the selective expression of MMP-9 in osteoclasts. Hill et al. (21, 22) reported that synthetic inhibitors of collagenase and/or gelatinase prevented bone resorption in vitro. It also has been proposed that osteoblast-derived collagenase is responsible for degrading the nonmineralized osteoid layer covering bone surfaces, which is essential for exposing the mineralized matrix to osteoclasts (9, 23). More recently, it was reported that not only denatured, but also native type I collagens could be degraded by MMP-2 (24). MMP-9 failed to degrade native type I collagen. Osteoblasts produce gelatinases such as MMP-2 (16). The regulation of MMP-2 in osteoblasts and involvement of gelatinases in bone resorption, however, are not well understood.
In this study, we examined the regulation of expression of several MMPs by IL-1 and IL-6 at the messenger RNA (mRNA) level in mouse calvarial cultures. Not only MMP-13 (collagenase 3), but also MMP-2 and MMP-9 (gelatinases) and MMP-3 (stromelysin 1), were markedly induced by IL-1 and moderately induced by IL-6. These MMPs may act in concert for the degradation of bone matrix associated with bone resorption.
| Materials and Methods |
|---|
|
|
|---|
was purchased from Genzyme (Cambridge, MA).
Recombinant mouse IL-6 and sIL-6R were prepared from CHO cells
transfected with a mouse IL-6 complementary DNA (cDNA) expression
vector and a mouse sIL-6R cDNA expression vector, respectively, as
reported (4). Purified human collagenase (MMP-1) and gelatinase (MMP-2)
were purchased from Yagai Co. Ltd. (Yamagata, Japan). A hydroxamate
inhibitor of MMPs [HONHCOCH2CH(i-Bu)CO-Trp-NHMe; GM6001X] was kindly
provided by Dr. J. Oleksyszyn (OsteoArthritis Science, Inc. Cambridge,
MA). All other chemicals were of analytical grade.
Mouse calvarial culture
Five-day-old mice were killed and their calvariae were
aseptically harvested and dissected free of suture tissues. The
calvariae were divided into paired halves and cultured for 24 h at
37 C under 5% CO2 in air in 0.5 ml BGJb medium (Gibco BRL,
Rockville, MD) containing 1 mg/ml BSA (fraction V, Sigma, St. Louis,
MO). After preculture for 24 h, each half calvaria was transferred
to fresh medium, with and without respective cytokines, and cultured
for an additional 5 days. To determine bone-resorbing activity of test
materials, the concentration of calcium in the conditioned medium was
measured on day 5 using a calcium kit (Calcium C-test Wako; Wako Pure
Chemical, Osaka, Japan). On day 5, to detect osteoclasts, calvariae
were fixed with 10% formalin and stained with tartrate-resistant acid
phosphatase (TRAP). TRAP-stained calvariae were counterstained with
alkaline phosphatase.
Culture of primary mouse osteoblastic cells
Primary osteoblastic cells were isolated from 1-day-old mouse
calvariae after five routine sequential digestions with 0.1%
collagenase (Wako) and 0.2% dispase (Godo Shusei, Tokyo, Japan), as
described (25). Osteoblasts isolated from fractions 35 were combined
and cultured in
-modified MEM (
MEM), supplemented with 10% FBS
at 37 C in a humidified atmosphere of 5% CO2 in air. To
measure steady-state levels of MMP mRNAs, osteoblastic cells were
cultured for 24 h in
MEM with 1% FBS and further cultured for
an additional 5 days with cytokines.
Northern blot analysis
Total cellular RNA was extracted from cultured mouse calvariae
and osteoblastic cells using the acid guanidium-phenol-chloroform
method (25). For Northern blotting, 20 µg total RNA were resolved by
electrophoresis in a 1% agarose-formaldehyde gel and transferred onto
nylon membranes (Hybond N, Amersham, Arlington Heights, IL), then
hybridized with a [32P]-labeled cDNA probe, as
reported (25). The signals were densitometrically quantified using an
image analyzer (Micro Computer Imaging Device, Fuji Film, Tokyo,
Japan). Mouse MMP-13 cDNA probe (26) was amplified by RT-PCR (sense
primer: 5' CTTCTGGTCTTCTGGCACACG 3', antisense primer: 5'
CCCCACCCCATACATCTGAAA 3') and cut with EcoRI, yielding a
485-bp fragment. A 250-bp fragment of human MMP-2 cDNA (27) was used as
a probe, which specifically hybridized with mouse MMP-2 mRNA. A 1500-bp
fragment of human MMP-3 cDNA was used as a probe for MMP-3 (28). Mouse
MMP-9 cDNA probe (29), a 459-bp fragment, was amplified by PCR (sense
primer: 5' TGTTCAGCAAGGGGCGTGTC 3', antisense primer: 5'
AAACAGTCCAACAAGAAAGG 3'). Human tissue inhibitor of matrix
metalloproteinase (TIMP)-1 cDNA was kindly provided by Dr. M. Naruto
(Toray Industries, Inc., Kanagawa, Japan).
Assay of collagenase and gelatinase activities
To measure collagenase and gelatinase activities, conditioned
media of calvarial cultures were treated for 4 h with
4-aminophenylmercuric acetate (APMA), which activates pro-MMPs into the
respective active forms. Collagenase and gelatinase activities were
measured by the degradation of fluorescein isothiocyanate
(FITC)-labeled type I and type IV collagen using a type I collagenase
activity assay kit and a type IV collagenase activity assay kit,
respectively (Yagai Co.). One unit of these activities degrades 1 µg
of respective collagen per min at 37 C.
Gelatin zymography
Gelatinase activity in the conditioned medium of calvarial
cultures was analyzed by zymography after incubation for 4 h, with
or without 10 mM APMA, as reported previously (30).
Aliquots (10 µl) were mixed with 5 µl of nonreducing SDS-PAGE
sample buffer, then subjected to SDS-PAGE using 10% polyacrylamide
gels containing 0.6 mg/ml of gelatin. After electrophoresis, gels were
incubated for 1 h in washing buffer consisting of 50
mM Tris-HCl, containing 5 mM CaCl2,
1 µM ZnCl2, and 2.5% Triton X-100 to remove
SDS, and then in the same buffer without Triton X-100 at 37 C for
3 h. Gels were stained with 0.1% (wt/vol) Coomassie brilliant
blue in 50% (vol/vol) methanol, 10% (vol/vol) acetic acid, and
destained in a solution of 30% (vol/vol) methanol and 1% (vol/vol)
formic acid. Enzyme activity was detected as a clear zone in a darkly
stained background.
SDS-PAGE
SDS-PAGE was performed to detect the degradation of native type
I collagen by conditioned medium of calvarial cultures. Conditioned
medium was incubated with 10 mM APMA for 4 h, and
further incubated for 20 h at 37 C with 2 µg purified bovine
type I collagen (Yagai Co.); then the reaction was stopped by adding 10
mM EDTA. As standard collagenase and gelatinase, purified
human MMP-1 and human MMP-2 (Yagai Co.) were used for incubation with
type I collagen. The samples were then subjected to SDS-PAGE using a
10% polyacrylamide gel. After electrophoresis, the gels were stained
with Coomassie brilliant blue solution.
Statistical analysis
Statistical analysis was carried out by Dunnetts t
test, and the data are expressed as means ± SEM.
| Results |
|---|
|
|
|---|
(2 ng/ml) and IL-6 (100
ng/ml) in the presence of sIL-6R (200 ng/ml) stimulated bone
resorption, but the activity of IL-1
was significantly more potent
than that of IL-6 (Fig. 1A
, IL-6, and sIL-6R used were the doses
sufficient to induce maximal bone resorption. In the cultures treated
with 100 ng/ml IL-6, a higher concentration of sIL-6R (400 ng/ml)
showed an effect on bone-resorbing activity similar to that induced by
200 ng/ml sIL-6R (data not shown). A large number of TRAP-positive
osteoclasts were detected in calvarial tissues cultured with IL-1
or
IL-6 with sIL-6R (Fig. 1B
, 14.04 ± 0.45; IL-1
plus 30
µM hydroxamate, 8.08 ± 0.48; IL-6 with sIL-6R,
9.38 ± 0.25; IL-6 with sIL-6R plus 30 µM
hydroxamate, 8.06 ± 0.11.
|
stimulated expression of MMP-13, MMP-2,
and MMP-3 mRNAs on day 2, and the enhanced levels were maintained on
day 5 (Fig. 2
, but not by IL-6, on day 5 (Fig. 2
|
markedly stimulated
both collagenase and gelatinase activities (Fig. 3
. The differences between collagenase
and gelatinase activities induced by IL-1 and those induced by IL-6
were consistent with the potency of the respective cytokines in
inducing expression of MMP-13 and MMP-2 mRNAs (Fig. 2
|
.
Pro-MMP-9 also was detected, and it was markedly enhanced by IL-1.
Treatment with IL-6 together with sIL-6R slightly enhanced the
production of pro-MMP-2 and pro-MMP-9, but the effect was much less
than that of IL-1. When the respective conditioned medium was incubated
with APMA, most of the pro-MMP-2 and pro-MMP-9 induced by IL-1
was
processed into the respective active forms (Fig. 4
|
, levels of both
1 and
2 chains were markedly
decreased, but no 3/4- or 1/4-length fragments, such as
1A and
2A, could be detected (Fig. 5B
A fragments, but
human MMP-2 did not (Fig. 5A
A fragments (Fig. 5A
.
|
on
days 2 and 5 (Fig. 6
|
| Discussion |
|---|
|
|
|---|
Transcriptional regulation of collagenases, human MMP-1, and mouse
MMP-13 has been reported in various cell types such as connective
tissue cells, monocyte-macrophages, and endothelial cells. Human MMP-1
can be stimulated by various growth factors and cytokines, including
basic fibroblast growth factor, epidermal growth factor, IL-1, and
tumor necrosis factor
. The promoter regions of the genes encoding
human MMP-1 and MMP-3 have been sequenced and analyzed. These promoters
contain AP-1 sites, and their expression is up-regulated by
12-O-tetradecanoylphorbol-13-acetate and IL-1 (32, 33, 34). In contrast, no
AP-1 sites have been found in the promoter region of the human MMP-2
gene (35). Neither 12-O-tetradecanoylphorbol-13-acetate nor IL-1
induced MMP-2 mRNA in most cell types reported, except for glomerular
mesangial cells (13, 27, 36). In the present study, both IL-1 and IL-6
with sIL-6R markedly induced not only MMP-13 but also MMP-2 mRNA in
osteoblasts. Little is known about the effects of bone-resorbing
factors on the regulation of MMP-2. Lorenzo et al. (16)
reported that MMP-2 expressed in osteoblasts was not regulated by
bone-resorbing factors. Recently, Franchimont et al. (37)
reported that IL-6 with sIL-6R caused a marked induction of MMP-13
expression in rat osteoblasts by transcriptional mechanism. Further
studies are necessary to examine the mechanism of transcription of
MMP-2 and MMP-13 genes by IL-1 and IL-6 in mouse osteoblasts.
MMP-9 has been reported to be localized in monocyte-macrophages and
osteoclasts. In the present study, MMP-9 mRNA was not detected in
osteoblastic cells (Fig. 6
), but it was detected in osteoclasts, using
an in situ hybridization technique, in calvarial cultures
(data not shown). These results are consistent with the previous
findings (19, 20, 38). In calvarial cultures, both IL-1 and IL-6 with
sIL-6R stimulated the expression of MMP-9 mRNA, which was correlated
with the induction of osteoclast-like cell formation (Figs. 1
and 2
).
Therefore, the increased expression of MMP-9 mRNA in calvarial organ
cultures seems to be caused by the increased number of osteoclasts.
Jimi et al. (39) have reported that IL-1, but not IL-6,
directly acts on osteoclast-like cells and supports their survival
in vitro. However, it is not known whether IL-1 directly
regulates MMP-9 expression in osteoclasts. Further studies are needed
to define the regulation and biological roles of MMPs in
osteoclasts.
The activation of pro-MMPs is essential for matrix degradation. MMP-3
was reported to activate pro-MMPs such as pro-MMP-1 and pro-MMP-9
(40, 41, 42). In calvarial cultures, IL-1 markedly induced the expression
of MMP-3 mRNA (Fig. 2
), whereas IL-6 did so only weakly, even in the
presence of sIL-6R. These results are consistent with the observation
that both pro- and active-forms of MMP-2 and MMP-9 could be detected in
gelatin zymography using conditioned media collected from IL-1-treated
cultures (Fig. 4
), suggesting that MMP-3 may act as an activator for
other pro-MMPs induced by IL-1 and IL-6. Recently, Kinoh et
al. (43) reported that membrane type (MT)1-MMP was coexpressed
with pro-MMP-2 in mouse embryonic osteoblasts. Sato et al.
(44) also demonstrated the presence of MT1-MMP in rabbit osteoclasts.
MT1-MMP was reported to activate pro-MMP-2 and pro-MMP-13 and act as a
collagenase (45, 46). Further studies are needed to define the role(s)
of MT1-MMP in bone resorption.
Recently, Hill et al. (21, 22) reported that synthetic
inhibitors of MMPs prevent bone resorption induced by IL-1,
1
,25-dihydroxyvitamin D3, and PTH. Using concentration-dependent
selective inhibitors of collagenase and gelatinase, they concluded that
both collagenase and gelatinase are involved in bone resorption (22).
In the present study, conditioned media from calvarial cultures treated
with IL-1 showed marked collagenolytic activity, but the
collagenase-induced typical cleavage products of type I collagen,
3/4- and 1/4-length fragments, could not be detected
(Fig. 5B
). The degraded pattern of type I collagen was similar to that
by simultaneous treatment with purified collagenase and gelatinase
(Fig. 5A
). Therefore, it is likely that gelatinases are also involved
in the subsequent degradation of the collagen fragments cleaved by
collagenase in bone.
It is essential to elucidate the distribution of MMPs in bone tissues to determine the selective role of each MMP in bone remodeling. It has been reported that MMP-13 is expressed preferentially in osteoblasts (8, 10, 17, 18), whereas MMP-9 is expressed selectively in osteoclasts (19, 20, 38). Gack et al. (47) demonstrated strong expression of MMP-13 in osteoblastic cells located adjacent to mature osteoclasts. Fuller and Chambers (48) have also reported that MMP-13 mRNA is expressed in osteoblastic cells adjacent to osteoclasts at the sites of active bone resorption. Therefore, MMP-13 in osteoblasts and MMP-9 in osteoclasts may act in concert to promote bone matrix degradation. MMP-13 produced by osteoblasts is responsible for removing the unmineralized osteoid tissues, which protect bone mineral from osteoclastic bone resorption, because osteoclasts cannot adhere to the unmineralized osteoid layer.
In conclusion, IL-1 markedly stimulates expression of MMP-2, -3, and -13 mRNAs in mouse calvariae, but IL-6 stimulates their expression only slightly, even in the presence of sIL-6R. IL-1 and IL-6 similarly induce osteoclast formation, resulting in an increase in the expression of MMP-9 mRNA. Because the differences in the potency of MMP induction between IL-1 and IL-6 correlated well with the bone-resorbing activities of these cytokines, it is likely that the MMP-dependent matrix degradation is the rate-limiting step in osteoclastic bone resorption.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received September 4, 1997.
| References |
|---|
|
|
|---|
. Nature 337:661663[CrossRef][Medline]
maintain the survival of
osteoclast-like cells. Endocrinology 136:808811[Abstract]
This article has been cited by other articles:
![]() |
S. MacLauchlan, E. A. Skokos, N. Meznarich, D. H. Zhu, S. Raoof, J. M. Shipley, R. M. Senior, P. Bornstein, and T. R. Kyriakides Macrophage fusion, giant cell formation, and the foreign body response require matrix metalloproteinase 9 J. Leukoc. Biol., April 1, 2009; 85(4): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Ruddy, J. A. Jones, F. G. Spinale, and J. S. Ikonomidis Regional heterogeneity within the aorta: Relevance to aneurysm disease. J. Thorac. Cardiovasc. Surg., November 1, 2008; 136(5): 1123 - 1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Kominsky, S. M. Abdelmagid, M. Doucet, K. Brady, and K. L. Weber Macrophage Inflammatory Protein-1{delta}: A Novel Osteoclast Stimulating Factor Secreted by Renal Cell Carcinoma Bone Metastasis Cancer Res., March 1, 2008; 68(5): 1261 - 1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A.N. Rose, F. Pepin, C. Russo, J. E. Abou Khalil, M. Hallett, and P. M. Siegel Osteoactivin Promotes Breast Cancer Metastasis to Bone Mol. Cancer Res., October 1, 2007; 5(10): 1001 - 1014. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Greenlee, Z. Werb, and F. Kheradmand Matrix Metalloproteinases in Lung: Multiple, Multifarious, and Multifaceted Physiol Rev, January 1, 2007; 87(1): 69 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inada, C. Matsumoto, S. Uematsu, S. Akira, and C. Miyaura Membrane-Bound Prostaglandin E Synthase-1-Mediated Prostaglandin E2 Production by Osteoblast Plays a Critical Role in Lipopolysaccharide-Induced Bone Loss Associated with Inflammation J. Immunol., August 1, 2006; 177(3): 1879 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qi, A. M. Fox, L. G. Alexopoulos, L. Chi, D. Bynum, F. Guilak, and A. J. Banes IL-1beta decreases the elastic modulus of human tenocytes J Appl Physiol, July 1, 2006; 101(1): 189 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Hall, F. R. Westwood, and P. F. Wadsworth Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate Toxicol Pathol, February 1, 2006; 34(2): 131 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oka, Y. Kubota, T. Yamashiro, S. Ogata, T. Ninomiya, S. Ito, and K. Shirasuna Effects of Positive Pressure in Odontogenic Keratocysts Journal of Dental Research, October 1, 2005; 84(10): 913 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Choi, H. S. Koh, D. Kluess, D. O'Connor, A. Mathur, G. A. Truskey, J. Rubin, D. X. F. Zhou, and K.-L. P. Sung Effects of titanium particle size on osteoblast functions in vitro and in vivo PNAS, March 22, 2005; 102(12): 4578 - 4583. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Inada, Y. Wang, M. H. Byrne, M. U. Rahman, C. Miyaura, C. Lopez-Otin, and S. M. Krane Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification PNAS, December 7, 2004; 101(49): 17192 - 17197. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-Q. Li, Z. Chen, X. J. Song, L. Luo, and S. C. Pflugfelder Stimulation of Matrix Metalloproteinases by Hyperosmolarity via a JNK Pathway in Human Corneal Epithelial Cells Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4302 - 4311. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Barnes Mediators of Chronic Obstructive Pulmonary Disease Pharmacol. Rev., December 1, 2004; 56(4): 515 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitamura, Y. Nakamoto, S. Kaneko, and N. Mukaida Pivotal roles of interleukin-6 in transmural inflammation in murine T cell transfer colitis J. Leukoc. Biol., December 1, 2004; 76(6): 1111 - 1117. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mori, M. Shibanuma, and K. Nose Invasive Potential Induced under Long-Term Oxidative Stress in Mammary Epithelial Cells Cancer Res., October 15, 2004; 64(20): 7464 - 7472. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification Endocr. Rev., August 1, 2004; 25(4): 629 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Wright and J. S. Friedland Regulation of monocyte chemokine and MMP-9 secretion by proinflammatory cytokines in tuberculous osteomyelitis J. Leukoc. Biol., June 1, 2004; 75(6): 1086 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Selvamurugan, S. Kwok, T. Alliston, M. Reiss, and N. C. Partridge Transforming Growth Factor-{beta}1 Regulation of Collagenase-3 Expression in Osteoblastic Cells by Cross-talk between the Smad and MAPK Signaling Pathways and Their Components, Smad2 and Runx2 J. Biol. Chem., April 30, 2004; 279(18): 19327 - 19334. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Doherty, L. A. Fitzpatrick, A. Shaheen, T. B. Rajavashisth, and R. C. Detrano Genetic Determinants of Arterial Calcification Associated With Atherosclerosis Mayo Clin. Proc., February 1, 2004; 79(2): 197 - 210. [Abstract] [PDF] |
||||
![]() |
N. G. Sandler, M. M. Mentink-Kane, A. W. Cheever, and T. A. Wynn Global Gene Expression Profiles During Acute Pathogen-Induced Pulmonary Inflammation Reveal Divergent Roles for Th1 and Th2 Responses in Tissue Repair J. Immunol., October 1, 2003; 171(7): 3655 - 3667. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matsuyama, N. Sakai, M. Ishigami, H. Hiraoka, S. Kashine, A. Hirata, T. Nakamura, S. Yamashita, and Y. Matsuzawa Matrix Metalloproteinases as Novel Disease Markers in Takayasu Arteritis Circulation, September 23, 2003; 108(12): 1469 - 1473. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. ESCARTIN, C. LALLAM-LAROYE, B. BAROUKH, F. O. MORVAN, J. P. CARUELLE, G. GODEAU, D. BARRITAULT, and J. L. SAFFAR A new approach to treat tissue destruction in periodontitis with chemically modified dextran polymers FASEB J, April 1, 2003; 17(6): 644 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-K. Choi, H. J. Lee, J. H. Kang, G. J. Jeong, C. K. Min, and Y.-J. Yoo Induction of Osteoclastogenesis and Matrix Metalloproteinase Expression by the Lipooligosaccharide of Treponema denticola Infect. Immun., January 1, 2003; 71(1): 226 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Onodera, J. Nishihira, K. Iwabuchi, Y. Koyama, K. Yoshida, S. Tanaka, and A. Minami Macrophage Migration Inhibitory Factor Up-regulates Matrix Metalloproteinase-9 and -13 in Rat Osteoblasts. RELEVANCE TO INTRACELLULAR SIGNALING PATHWAYS J. Biol. Chem., March 1, 2002; 277(10): 7865 - 7874. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E Barr and M. F Barbe Pathophysiological Tissue Changes Associated With Repetitive Movement: A Review of the Evidence Physical Therapy, February 1, 2002; 82(2): 173 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Varghese, S. Rydziel, and E. Canalis Basic Fibroblast Growth Factor Stimulates Collagenase-3 Promoter Activity in Osteoblasts through an Activator Protein-1-Binding Site Endocrinology, June 1, 2000; 141(6): 2185 - 2191. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Suzawa, C. Miyaura, M. Inada, T. Maruyama, Y. Sugimoto, F. Ushikubi, A. Ichikawa, S. Narumiya, and T. Suda The Role of Prostaglandin E Receptor Subtypes (EP1, EP2, EP3, and EP4) in Bone Resorption: An Analysis Using Specific Agonists for the Respective EPs Endocrinology, April 1, 2000; 141(4): 1554 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Solis-Herruzo, R. A. Rippe, L. W. Schrum, P. de la Torre, I. Garcia, J. J. Jeffrey, T. Munoz-Yague, and D. A. Brenner Interleukin-6 Increases Rat Metalloproteinase-13 Gene Expression through Stimulation of Activator Protein 1 Transcription Factor in Cultured Fibroblasts J. Biol. Chem., October 22, 1999; 274(43): 30919 - 30926. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Pereira, V. Jorgetti, and E. Canalis Triiodothyronine induces collagenase-3 and gelatinase B expression in murine osteoblasts Am J Physiol Endocrinol Metab, September 1, 1999; 277(3): E496 - E504. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Kieseier, R. Paul, U. Koedel, T. Seifert, J. M. Clements, A. J. H. Gearing, H.-W. Pfister, and H.-P. Hartung Differential expression of matrix metalloproteinases in bacterial meningitis Brain, August 1, 1999; 122(8): 1579 - 1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. G. Jimenez, M. Balbin, J. M. Lopez, J. Alvarez, T. Komori, and C. Lopez-Otin Collagenase 3 Is a Target of Cbfa1, a Transcription Factor of the runt Gene Family Involved in Bone Formation Mol. Cell. Biol., June 1, 1999; 19(6): 4431 - 4442. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Varghese, K. Yu, and E. Canalis Leukemia inhibitory factor and oncostatin M stimulate collagenase-3 expression in osteoblasts Am J Physiol Endocrinol Metab, March 1, 1999; 276(3): E465 - E471. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Miyaura, M. Inada, T. Suzawa, Y. Sugimoto, F. Ushikubi, A. Ichikawa, S. Narumiya, and T. Suda Impaired Bone Resorption to Prostaglandin E2 in Prostaglandin E Receptor EP4-knockout Mice J. Biol. Chem., June 23, 2000; 275(26): 19819 - 19823. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Winchester, N. Selvamurugan, R. C. D'Alonzo, and N. C. Partridge Developmental Regulation of Collagenase-3 mRNA in Normal, Differentiating Osteoblasts through the Activator Protein-1 and the runt Domain Binding Sites J. Biol. Chem., July 21, 2000; 275(30): 23310 - 23318. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J.G. Jimenez, M. Balbin, J. Alvarez, T. Komori, P. Bianco, K. Holmbeck, H. Birkedal-Hansen, J. M. Lopez, and C. Lopez-Otin A regulatory cascade involving retinoic acid, Cbfa1, and matrix metalloproteinases is coupled to the development of a process of perichondrial invasion and osteogenic differentiation during bone formation J. Cell Biol., December 24, 2001; 155(7): 1333 - 1344. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |