help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kusano, K.
Right arrow Articles by Suda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kusano, K.
Right arrow Articles by Suda, T.
Endocrinology Vol. 139, No. 3 1338-1345
Copyright © 1998 by The Endocrine Society


ARTICLES

Regulation of Matrix Metalloproteinases (MMP-2, -3, -9, and -13) by Interleukin-1 and Interleukin-6 in Mouse Calvaria: Association of MMP Induction with Bone Resorption1

Kenichiro Kusano2, Chisato Miyaura2, Masaki Inada, Tatsuya Tamura, Akira Ito, Hideaki Nagase, Kyuichi Kamoi and Tatsuo Suda

Department of Biochemistry (Ke.K., C.M., M.I., T.T., T.S.), School of Dentistry, Showa University, Tokyo 142, Japan; Fuji Gotemba Research Laboratories (T.T.), Chugai Pharmaceutical Company, Ltd., Shizuoka 412, Japan; Department of Biochemistry (A.I.), School of Pharmacy, Tokyo University of Pharmacy and Life Science, Tokyo, 192–03, Japan; Department of Biochemistry and Molecular Biology (H.N.), University of Kansas Medical Center, Kansas City, Kansas 66160; and Department of Periodontology (M.I., Ky.K.), School of Dentistry at Tokyo, Nippon Dental University, Tokyo, 102, Japan

Address all correspondence and requests for reprints to: Tatsuo Suda, Department of Biochemistry, School of Dentistry, Showa University, 1–5-8 Hatanodai, Shinagawa-ku, Tokyo 142, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-1 (IL-1) greatly induces osteoclast formation and stimulates bone resorption of mouse calvaria in culture. In the presence of soluble IL-6 receptor (sIL-6R), IL-6 similarly induces osteoclast formation, but the potency of IL-6 in inducing bone resorption in organ culture is weaker than that of IL-1. To study the differences in bone-resorbing activity between IL-1 and IL-6, we examined the effects of the two cytokines on the induction of matrix metalloproteinases (MMPs). In mouse calvarial cultures, IL-1 markedly enhanced the messenger RNA (mRNA) expression of MMP-13 (collagenase 3), MMP-2 (gelatinase A), MMP-9 (gelatinase B), and MMP-3 (stromelysin 1), which associated with increases in bone matrix degradation. A hydroxamate inhibitor of MMPs significantly suppressed bone-resorbing activity induced by IL-1. Gelatin zymography showed that both pro- and active-forms of MMP-2 and MMP-9 were detected in the conditioned medium collected from calvarial cultures, and IL-1 markedly stimulated both pro- and active-forms of the two gelatinases. IL-6 with sIL-6R also stimulated mRNA expression and biological activities of these MMPs, but the potency was much weaker than that of IL-1. Conditioned medium collected from IL-1-treated calvariae degraded native type I collagen, but 3/4- and 1/4-length collagen fragments were not detected, suggesting that both collagenases and gelatinases synergistically degraded type I collagen into smaller fragments. In mouse osteoblastic cells, the expression of MMP-2, MMP-3, and MMP-13 mRNAs could be detected, and they were markedly enhanced by IL-1{alpha} on days 2 and 5. IL-6 with sIL-6R also induced expression of MMP-13 and MMP-2 mRNAs on day 2, but the expression was rather transient. These results demonstrate that the potency of induction of MMPs by IL-1 and IL-6 is closely linked to the respective bone-resorbing activity, suggesting that MMP-dependent degradation of bone matrix plays a key role in bone resorption induced by these cytokines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
INTERLEUKIN-1 (IL-1) markedly stimulates osteoclastic bone resorption in vivo and in vitro by enhancing both osteoclast formation and function (1, 2, 3). Other cytokines (including IL-6 and IL-11, which transduce their signals through the signal-transducing gp130 chain) also induce osteoclast formation in vitro (4, 5, 6). Both IL-1 and IL-6 seem to induce osteoclast formation from its progenitors via a mechanism involving osteoblastic cells (6). We reported previously that the presence of soluble IL-6 receptor (sIL-6R) was essential for the osteoclast formation induced by IL-6 in cocultures of mouse bone marrow cells and osteoblastic cells (4). This suggests that osteoblastic cells lack membrane-bound IL-6 receptors under physiological conditions. The potency of IL-6 with sIL-6R in osteoclast formation was equivalent to that of IL-1, but in organ culture systems such as mouse calvarial cultures, bone-resorbing activity of IL-1 was much greater than that of IL-6, even in the presence of sIL-6R. Bone resorption consists of multiple steps, including osteoclast differentiation, activation of osteoclast function, degradation of bone matrix proteins, and bone mineral mobilization. Because IL-1 and IL-6 similarly stimulate osteoclast differentiation, the differences in bone-resorbing activity between IL-1 and IL-6 may be caused by the actions of these cytokines in other processes, such as matrix degradation.

Degradation of the organic matrix in bone depends on the activity of proteolytic enzymes, which consist of 2 major classes: the cysteine proteinase family (such as catepsin K) and the matrix metalloproteinase (MMPs) family (7, 8, 9, 10, 11). Over the past years, 18 different mammalian MMPs have been identified. These can be divided into 4 subgroups; collagenases (MMP-1, MMP-8, MMP-13, and MMP-18), gelatinases (MMP-2 and MMP-9), stromelysins (MMP-3 and MMP-10), and membrane-type metalloproteinases (MMPs-14–17) (12, 13, 14). These MMPs are all zinc-dependent endopeptidases with the ability to degrade the organic matrix at physiological pH. Sequence comparisons have revealed that mouse and rat collagenases are homologous to the human collagenase 3 identified by Freije et al. (15) and are now referred to as MMP-13. Stromelysins such as MMP-3 not only act as a metalloproteinase but also activate a latent pro-MMP. Therefore, the cooperative effects of collagenases, gelatinases, and stromelysins may be important for MMP-dependent degradation of bone matrix.

Previous reports suggested that MMPs are involved in bone resorption. MMP-13 (collagenase 3) and MMP-2 and MMP-9 (gelatinases A and B) are produced by osteoblasts and/or osteoclasts (8, 10, 16, 17, 18, 19). Tezuka et al. (20) demonstrated the selective expression of MMP-9 in osteoclasts. Hill et al. (21, 22) reported that synthetic inhibitors of collagenase and/or gelatinase prevented bone resorption in vitro. It also has been proposed that osteoblast-derived collagenase is responsible for degrading the nonmineralized osteoid layer covering bone surfaces, which is essential for exposing the mineralized matrix to osteoclasts (9, 23). More recently, it was reported that not only denatured, but also native type I collagens could be degraded by MMP-2 (24). MMP-9 failed to degrade native type I collagen. Osteoblasts produce gelatinases such as MMP-2 (16). The regulation of MMP-2 in osteoblasts and involvement of gelatinases in bone resorption, however, are not well understood.

In this study, we examined the regulation of expression of several MMPs by IL-1 and IL-6 at the messenger RNA (mRNA) level in mouse calvarial cultures. Not only MMP-13 (collagenase 3), but also MMP-2 and MMP-9 (gelatinases) and MMP-3 (stromelysin 1), were markedly induced by IL-1 and moderately induced by IL-6. These MMPs may act in concert for the degradation of bone matrix associated with bone resorption.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and drugs
Newborn (5 days old) and adult ddy mice (7 weeks old) were obtained from Shizuoka Laboratory Animal Center (Shizuoka, Japan). Recombinant human IL-1{alpha} was purchased from Genzyme (Cambridge, MA). Recombinant mouse IL-6 and sIL-6R were prepared from CHO cells transfected with a mouse IL-6 complementary DNA (cDNA) expression vector and a mouse sIL-6R cDNA expression vector, respectively, as reported (4). Purified human collagenase (MMP-1) and gelatinase (MMP-2) were purchased from Yagai Co. Ltd. (Yamagata, Japan). A hydroxamate inhibitor of MMPs [HONHCOCH2CH(i-Bu)CO-Trp-NHMe; GM6001X] was kindly provided by Dr. J. Oleksyszyn (OsteoArthritis Science, Inc. Cambridge, MA). All other chemicals were of analytical grade.

Mouse calvarial culture
Five-day-old mice were killed and their calvariae were aseptically harvested and dissected free of suture tissues. The calvariae were divided into paired halves and cultured for 24 h at 37 C under 5% CO2 in air in 0.5 ml BGJb medium (Gibco BRL, Rockville, MD) containing 1 mg/ml BSA (fraction V, Sigma, St. Louis, MO). After preculture for 24 h, each half calvaria was transferred to fresh medium, with and without respective cytokines, and cultured for an additional 5 days. To determine bone-resorbing activity of test materials, the concentration of calcium in the conditioned medium was measured on day 5 using a calcium kit (Calcium C-test Wako; Wako Pure Chemical, Osaka, Japan). On day 5, to detect osteoclasts, calvariae were fixed with 10% formalin and stained with tartrate-resistant acid phosphatase (TRAP). TRAP-stained calvariae were counterstained with alkaline phosphatase.

Culture of primary mouse osteoblastic cells
Primary osteoblastic cells were isolated from 1-day-old mouse calvariae after five routine sequential digestions with 0.1% collagenase (Wako) and 0.2% dispase (Godo Shusei, Tokyo, Japan), as described (25). Osteoblasts isolated from fractions 3–5 were combined and cultured in {alpha}-modified MEM ({alpha}MEM), supplemented with 10% FBS at 37 C in a humidified atmosphere of 5% CO2 in air. To measure steady-state levels of MMP mRNAs, osteoblastic cells were cultured for 24 h in {alpha}MEM with 1% FBS and further cultured for an additional 5 days with cytokines.

Northern blot analysis
Total cellular RNA was extracted from cultured mouse calvariae and osteoblastic cells using the acid guanidium-phenol-chloroform method (25). For Northern blotting, 20 µg total RNA were resolved by electrophoresis in a 1% agarose-formaldehyde gel and transferred onto nylon membranes (Hybond N, Amersham, Arlington Heights, IL), then hybridized with a [32P]-labeled cDNA probe, as reported (25). The signals were densitometrically quantified using an image analyzer (Micro Computer Imaging Device, Fuji Film, Tokyo, Japan). Mouse MMP-13 cDNA probe (26) was amplified by RT-PCR (sense primer: 5' CTTCTGGTCTTCTGGCACACG 3', antisense primer: 5' CCCCACCCCATACATCTGAAA 3') and cut with EcoRI, yielding a 485-bp fragment. A 250-bp fragment of human MMP-2 cDNA (27) was used as a probe, which specifically hybridized with mouse MMP-2 mRNA. A 1500-bp fragment of human MMP-3 cDNA was used as a probe for MMP-3 (28). Mouse MMP-9 cDNA probe (29), a 459-bp fragment, was amplified by PCR (sense primer: 5' TGTTCAGCAAGGGGCGTGTC 3', antisense primer: 5' AAACAGTCCAACAAGAAAGG 3'). Human tissue inhibitor of matrix metalloproteinase (TIMP)-1 cDNA was kindly provided by Dr. M. Naruto (Toray Industries, Inc., Kanagawa, Japan).

Assay of collagenase and gelatinase activities
To measure collagenase and gelatinase activities, conditioned media of calvarial cultures were treated for 4 h with 4-aminophenylmercuric acetate (APMA), which activates pro-MMPs into the respective active forms. Collagenase and gelatinase activities were measured by the degradation of fluorescein isothiocyanate (FITC)-labeled type I and type IV collagen using a type I collagenase activity assay kit and a type IV collagenase activity assay kit, respectively (Yagai Co.). One unit of these activities degrades 1 µg of respective collagen per min at 37 C.

Gelatin zymography
Gelatinase activity in the conditioned medium of calvarial cultures was analyzed by zymography after incubation for 4 h, with or without 10 mM APMA, as reported previously (30). Aliquots (10 µl) were mixed with 5 µl of nonreducing SDS-PAGE sample buffer, then subjected to SDS-PAGE using 10% polyacrylamide gels containing 0.6 mg/ml of gelatin. After electrophoresis, gels were incubated for 1 h in washing buffer consisting of 50 mM Tris-HCl, containing 5 mM CaCl2, 1 µM ZnCl2, and 2.5% Triton X-100 to remove SDS, and then in the same buffer without Triton X-100 at 37 C for 3 h. Gels were stained with 0.1% (wt/vol) Coomassie brilliant blue in 50% (vol/vol) methanol, 10% (vol/vol) acetic acid, and destained in a solution of 30% (vol/vol) methanol and 1% (vol/vol) formic acid. Enzyme activity was detected as a clear zone in a darkly stained background.

SDS-PAGE
SDS-PAGE was performed to detect the degradation of native type I collagen by conditioned medium of calvarial cultures. Conditioned medium was incubated with 10 mM APMA for 4 h, and further incubated for 20 h at 37 C with 2 µg purified bovine type I collagen (Yagai Co.); then the reaction was stopped by adding 10 mM EDTA. As standard collagenase and gelatinase, purified human MMP-1 and human MMP-2 (Yagai Co.) were used for incubation with type I collagen. The samples were then subjected to SDS-PAGE using a 10% polyacrylamide gel. After electrophoresis, the gels were stained with Coomassie brilliant blue solution.

Statistical analysis
Statistical analysis was carried out by Dunnett’s t test, and the data are expressed as means ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bone-resorbing activities of IL-1 and IL-6
IL-1 markedly stimulates osteoclastic bone resorption in vitro by enhancing both osteoclast formation and function. We have reported previously that IL-6 induces osteoclast formation in cocultures of mouse bone marrow cells and osteoblastic cells when sIL-6R is present (4). To compare the bone-resorbing activities of IL-1 and IL-6, we measured the concentration of calcium in the medium on day 5 in mouse calvarial cultures. Both IL-1{alpha} (2 ng/ml) and IL-6 (100 ng/ml) in the presence of sIL-6R (200 ng/ml) stimulated bone resorption, but the activity of IL-1{alpha} was significantly more potent than that of IL-6 (Fig. 1AGo). The concentrations of IL-1{alpha}, IL-6, and sIL-6R used were the doses sufficient to induce maximal bone resorption. In the cultures treated with 100 ng/ml IL-6, a higher concentration of sIL-6R (400 ng/ml) showed an effect on bone-resorbing activity similar to that induced by 200 ng/ml sIL-6R (data not shown). A large number of TRAP-positive osteoclasts were detected in calvarial tissues cultured with IL-1{alpha} or IL-6 with sIL-6R (Fig. 1BGo). This indicated that both IL-1 and IL-6 markedly stimulate osteoclast formation in calvarial cultures. Therefore, the difference of bone-resorbing activity between IL-1 and IL-6 seems to be caused by other processes of bone resorption, such as matrix degradation regulated by MMPs. When a hydroxamate inhibitor of MMPs was added to calvarial cultures, IL-1-induced bone resorption was markedly inhibited on day 5. In addition, IL-6-induced bone resorption also was suppressed by the same inhibitor to a similar level to IL-1 plus hydroxamate. The medium calcium (mg/dl) levels were: control, 6.43 ± 0.04; IL-1{alpha}, 14.04 ± 0.45; IL-1{alpha} plus 30 µM hydroxamate, 8.08 ± 0.48; IL-6 with sIL-6R, 9.38 ± 0.25; IL-6 with sIL-6R plus 30 µM hydroxamate, 8.06 ± 0.11.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 1. Effects of IL-1{alpha} and IL-6 in the presence of sIL-6R on bone-resorbing activity in cultured mouse calvariae. Five-day-old neonatal mouse calvariae were cultured for 5 days with vehicle, IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml). The concentrations of IL-1{alpha}, IL-6, and sIL-6R used were the doses sufficient to induce maximal bone resorption. A, Conditioned media were collected, and the concentration of calcium in the medium was measured to monitor the bone-resorbing activity. The data are expressed as means ± SEM of 9 cultures, significantly different from the control (**, P < 0.01) and from cultures treated with IL-1{alpha} (#, P < 0.01). B, Calvariae were fixed and stained with TRAP, shown in red, as described in Materials and Methods.

 
Expression of MMP mRNAs in mouse calvariae treated with IL-1 and IL-6 with sIL-6R
To compare the effects of IL-1 and IL-6 on expression of MMP mRNAs, we performed Northern blot analysis using total RNA extracted from mouse calvariae. IL-1{alpha} stimulated expression of MMP-13, MMP-2, and MMP-3 mRNAs on day 2, and the enhanced levels were maintained on day 5 (Fig. 2Go). Treatment with IL-6 together with sIL-6R also stimulated expression of MMP-13, MMP-2, and MMP-3 mRNAs on day 2, but the increased levels decreased to the respective control levels on day 5 (Fig. 2Go). MMP-3 has been reported to activate other pro-MMPs, which suggests that the induction of MMP-2, -3, and -13 is cooperatively involved in MMP-dependent matrix degradation. Expression of mRNA encoding TIMP-1, a negative regulator of activated MMPs in target tissues, also was enhanced by IL-1 and IL-6 with sIL-6R (Fig. 2Go). The expression of TIMP-1 mRNA was further increased by IL-1{alpha}, but not by IL-6, on day 5 (Fig. 2Go). Expression of MMP-9 mRNA was similarly enhanced by IL-1 and IL-6 with sIL-6R (Fig. 2Go).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Effects of IL-1{alpha} and IL-6 in the presence of sIL-6R on expression of MMP and TIMP-1 mRNAs in cultured mouse calvariae. A, Mouse calvariae were cultured for 2 or 5 days with IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml). Total RNA was extracted, and Northern blotting was performed using [32P]-labeled cDNA probes for MMP-13, MMP-2, MMP-3, MMP-9, TIMP-1, and tubulin, as described in Materials and Methods. B, Signals in Northern blots shown in A were quantified and normalized by the expression of tubulin mRNA using an image analyzer.

 
Collagenase and gelatinase activities
To analyze the functional activities of MMPs expressed in mouse calvariae, collagenase and gelatinase activities in the conditioned medium of calvarial cultures were measured by the degradation of FITC-labeled type I and type IV collagen. IL-1{alpha} markedly stimulated both collagenase and gelatinase activities (Fig. 3Go). In the presence of sIL-6R, IL-6 also stimulated collagenase and gelatinase activities, but the effects were much less than those of IL-1{alpha}. The differences between collagenase and gelatinase activities induced by IL-1 and those induced by IL-6 were consistent with the potency of the respective cytokines in inducing expression of MMP-13 and MMP-2 mRNAs (Fig. 2Go).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Effects of IL-1{alpha} and IL-6 in the presence of sIL-6R on collagenase and gelatinase activities in the conditioned media collected from cultured mouse calvariae. Mouse calvariae were cultured for 5 days with IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml). Conditioned media were collected and treated for 4 h with 10 mM APMA to activate pro-MMPs, then incubated for 4 h with FITC-labeled type I collagen to detect collagenase activity (A) or FITC-labeled type IV collagen for gelatinase activity (B). Both activities were calculated by the degradation of FITC-labeled collagens, as described in Materials and Methods. The data are expressed as means ± SEM of 4–6 independent experiments, significantly different from the control (*, P < 0.05; **, P < 0.01).

 
Effects of IL-1 and IL-6 on the production of pro- and active-forms of MMP-2
To compare the effects of IL-1 and IL-6 on the production of gelatinases, conditioned media from calvarial cultures collected on day 5 were incubated for 4 h, with or without APMA, and used for gelatin zymography. In the absence of APMA, not only pro-MMP-2 (72 kDa) but also a small amount of active-MMP-2 (67 kDa) was detected on the gel from the control cultures. Levels of expression of both pro- and active-forms of MMP-2 were markedly enhanced by treatment with IL-1{alpha}. Pro-MMP-9 also was detected, and it was markedly enhanced by IL-1. Treatment with IL-6 together with sIL-6R slightly enhanced the production of pro-MMP-2 and pro-MMP-9, but the effect was much less than that of IL-1. When the respective conditioned medium was incubated with APMA, most of the pro-MMP-2 and pro-MMP-9 induced by IL-1{alpha} was processed into the respective active forms (Fig. 4Go). In the presence of APMA, pro-MMP-2 induced by IL-6 was also processed into active-MMP-2, but pro-MMP-9 was not (Fig. 4Go). The lack of pro-MMP-9 activation by APMA is most likely caused by the short period of time exposed to APMA, as human pro-MMP-9 requires about 48 h incubation at 37 C with APMA to be fully activated (31).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Detection of MMP-2 and MMP-9 in the conditioned media collected from cultured mouse calvariae, by gelatin zymography. Mouse calvariae were cultured for 5 days with IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml), and conditioned media were collected and treated for 4 h with or without 10 mM APMA. For gelatin zymography, the samples were run on a polyacrylamide gel (10%) containing 0.6 mg/ml of gelatin and were analyzed as described in Materials and Methods. Gelatinase activities corresponding to pro-MMP-2, active-MMP-2, pro-MMP-9, and active-MMP-9 are indicated by arrows.

 
Collagenase and gelatinase cooperatively degrade type I collagen
It is well known that collagenase cleaves native type I collagen into 3/4- and 1/4-length collagen fragments. Recent studies have indicated that MMP-2 also cleaves native type I collagen under appropriate conditions (24). To analyze collagenolytic activities of conditioned media from calvarial cultures, we performed SDS-PAGE to detect the degraded products of native type I collagen. When type I collagen was incubated with conditioned medium from calvarial cultures treated with IL-1{alpha}, levels of both {alpha}1 and {alpha}2 chains were markedly decreased, but no 3/4- or 1/4-length fragments, such as {alpha}1A and {alpha}2A, could be detected (Fig. 5BGo). Purified collagenase, human MMP-1, cleaved type I collagen to generate {alpha}A fragments, but human MMP-2 did not (Fig. 5AGo). When type I collagen was incubated with both purified MMP-1 and MMP-2, type I collagen was degraded into smaller fragments but not into {alpha}A fragments (Fig. 5AGo). The conditioned media from calvarial cultures treated with IL-6 and sIL-6R slightly degraded type I collagen, but the collagenolytic activity was much weaker than that of IL-1{alpha}.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. Effects of the conditioned media collected from cultured mouse calvariae on the degradation of type I collagen. Mouse calvariae were cultured for 5 days with IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml). Conditioned media were collected and treated for 4 h with 10 mM APMA to activate pro-MMPs. A, Type I collagen was incubated with purified collagenase (human MMP-1) and/or purified gelatinase (human MMP-2) at 37 C for 20 h. B, Type I collagen was incubated with vehicle or activated conditioned media (control, IL-1{alpha}, IL-6 + sIL-6R) at 37 C for 20 h. The generated products were subjected to SDS-PAGE and were stained as described in Materials and Methods.

 
Expression of MMP mRNAs in osteoblasts
To examine the regulation of MMPs in bone, we performed Northern blot analysis using osteoblastic cells collected from newborn mouse calvariae. Osteoblastic cells expressed MMP-13 and MMP-2 mRNAs, and the levels of expression of these MMPs were markedly enhanced by IL-1{alpha} on days 2 and 5 (Fig. 6Go). MMP-3 was slightly detected in the control osteoblastic cells, and it was markedly enhanced by treatment with IL-1 on days 2 and 5. IL-6 with sIL-6R similarly induced expression of MMP-2 and MMP-13 mRNAs on day 2, but the stimulated expression of these MMPs was decreased on day 5. MMP-3 mRNA was slightly enhanced by IL-6 with sIL-6R on day 5. MMP-9 mRNA was not detected in osteoblastic cells, irrespective of the presence or absence of IL-1 and IL-6 (Fig. 6Go), but it was detected in osteoclast-like cells formed in cocultures of bone marrow cells and osteoblastic cells (data not shown). These results indicate that MMP-2, MMP-3, and MMP-13 are expressed in osteoblasts, and they are markedly enhanced by IL-1 and moderately enhanced by IL-6 with sIL-6R.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Effects of IL-1{alpha} and IL-6 in the presence of sIL-6R on mRNA expression of MMPs in mouse primary osteoblastic cells. A, Osteoblastic cells were cultured for 24 h in {alpha}MEM containing 1% FBS and were further cultured for 2 or 5 days with IL-1{alpha} (2 ng/ml) or IL-6 (100 ng/ml) with sIL-6R (200 ng/ml). Total RNA was extracted, and Northern blotting was performed using [32P]-labeled cDNA probes for MMP-13, MMP-2, MMP-3, MMP-9, and tubulin. B, Signals in Northern blots shown in A were quantified and normalized by the expression of tubulin mRNA using an image analyzer.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study clearly demonstrated that both IL-1 and IL-6 with sIL-6R induce mRNA expression of various MMPs, including MMP-13, MMP-2, MMP-9, and MMP-3 in mouse calvarial cultures. The potency of IL-1 was much greater and lasted longer than that of IL-6, which was correlated well with the potencies of bone-resorbing activity of these cytokines. We have reported that IL-1 and IL-6 with sIL-6R similarly stimulate osteoclast formation in cocultures of mouse bone marrow cells and osteoblastic cells (4, 6). Consistently, IL-1 and IL-6 with sIL-6R similarly induced osteoclast formation in mouse calvarial cultures (Fig. 1BGo). In addition to osteoclast formation, matrix degradation is another important step in the process of bone resorption in calvarial cultures. We found that not only MMP-13 (collagenase), but also MMP-2 (gelatinase) and MMP-3 (stromelysin), were markedly induced by IL-1 in calvarial cultures (Fig. 2Go). In the presence of sIL-6R, IL-6 also stimulated expression of these MMP mRNAs in calvarial cultures but only slightly and rather transiently. As reported previously, IL-1 markedly induces PGE2 production in calvarial cultures (2). The potency of IL-6 in inducing PGE2 synthesis was less than that of IL-1 in calvarial cultures (data not shown). When indomethacin was added to the calvarial cultures, IL-1-induced bone-resorbing activity, as well as collagenase and gelatinase activities, were similarly suppressed to the respective levels induced by IL-6 with sIL-6R (Miyaura, C. et al., unpublished results). In addition, PGE2 markedly stimulated the expression of MMP-13 and MMP-2 mRNAs in osteoblasts (data not shown). These findings suggest that PGE2 production is involved in the MMP induction by IL-1 in calvarial cultures.

Transcriptional regulation of collagenases, human MMP-1, and mouse MMP-13 has been reported in various cell types such as connective tissue cells, monocyte-macrophages, and endothelial cells. Human MMP-1 can be stimulated by various growth factors and cytokines, including basic fibroblast growth factor, epidermal growth factor, IL-1, and tumor necrosis factor {alpha}. The promoter regions of the genes encoding human MMP-1 and MMP-3 have been sequenced and analyzed. These promoters contain AP-1 sites, and their expression is up-regulated by 12-O-tetradecanoylphorbol-13-acetate and IL-1 (32, 33, 34). In contrast, no AP-1 sites have been found in the promoter region of the human MMP-2 gene (35). Neither 12-O-tetradecanoylphorbol-13-acetate nor IL-1 induced MMP-2 mRNA in most cell types reported, except for glomerular mesangial cells (13, 27, 36). In the present study, both IL-1 and IL-6 with sIL-6R markedly induced not only MMP-13 but also MMP-2 mRNA in osteoblasts. Little is known about the effects of bone-resorbing factors on the regulation of MMP-2. Lorenzo et al. (16) reported that MMP-2 expressed in osteoblasts was not regulated by bone-resorbing factors. Recently, Franchimont et al. (37) reported that IL-6 with sIL-6R caused a marked induction of MMP-13 expression in rat osteoblasts by transcriptional mechanism. Further studies are necessary to examine the mechanism of transcription of MMP-2 and MMP-13 genes by IL-1 and IL-6 in mouse osteoblasts.

MMP-9 has been reported to be localized in monocyte-macrophages and osteoclasts. In the present study, MMP-9 mRNA was not detected in osteoblastic cells (Fig. 6Go), but it was detected in osteoclasts, using an in situ hybridization technique, in calvarial cultures (data not shown). These results are consistent with the previous findings (19, 20, 38). In calvarial cultures, both IL-1 and IL-6 with sIL-6R stimulated the expression of MMP-9 mRNA, which was correlated with the induction of osteoclast-like cell formation (Figs. 1Go and 2Go). Therefore, the increased expression of MMP-9 mRNA in calvarial organ cultures seems to be caused by the increased number of osteoclasts. Jimi et al. (39) have reported that IL-1, but not IL-6, directly acts on osteoclast-like cells and supports their survival in vitro. However, it is not known whether IL-1 directly regulates MMP-9 expression in osteoclasts. Further studies are needed to define the regulation and biological roles of MMPs in osteoclasts.

The activation of pro-MMPs is essential for matrix degradation. MMP-3 was reported to activate pro-MMPs such as pro-MMP-1 and pro-MMP-9 (40, 41, 42). In calvarial cultures, IL-1 markedly induced the expression of MMP-3 mRNA (Fig. 2Go), whereas IL-6 did so only weakly, even in the presence of sIL-6R. These results are consistent with the observation that both pro- and active-forms of MMP-2 and MMP-9 could be detected in gelatin zymography using conditioned media collected from IL-1-treated cultures (Fig. 4Go), suggesting that MMP-3 may act as an activator for other pro-MMPs induced by IL-1 and IL-6. Recently, Kinoh et al. (43) reported that membrane type (MT)1-MMP was coexpressed with pro-MMP-2 in mouse embryonic osteoblasts. Sato et al. (44) also demonstrated the presence of MT1-MMP in rabbit osteoclasts. MT1-MMP was reported to activate pro-MMP-2 and pro-MMP-13 and act as a collagenase (45, 46). Further studies are needed to define the role(s) of MT1-MMP in bone resorption.

Recently, Hill et al. (21, 22) reported that synthetic inhibitors of MMPs prevent bone resorption induced by IL-1, 1{alpha},25-dihydroxyvitamin D3, and PTH. Using concentration-dependent selective inhibitors of collagenase and gelatinase, they concluded that both collagenase and gelatinase are involved in bone resorption (22). In the present study, conditioned media from calvarial cultures treated with IL-1 showed marked collagenolytic activity, but the collagenase-induced typical cleavage products of type I collagen, 3/4- and 1/4-length fragments, could not be detected (Fig. 5BGo). The degraded pattern of type I collagen was similar to that by simultaneous treatment with purified collagenase and gelatinase (Fig. 5AGo). Therefore, it is likely that gelatinases are also involved in the subsequent degradation of the collagen fragments cleaved by collagenase in bone.

It is essential to elucidate the distribution of MMPs in bone tissues to determine the selective role of each MMP in bone remodeling. It has been reported that MMP-13 is expressed preferentially in osteoblasts (8, 10, 17, 18), whereas MMP-9 is expressed selectively in osteoclasts (19, 20, 38). Gack et al. (47) demonstrated strong expression of MMP-13 in osteoblastic cells located adjacent to mature osteoclasts. Fuller and Chambers (48) have also reported that MMP-13 mRNA is expressed in osteoblastic cells adjacent to osteoclasts at the sites of active bone resorption. Therefore, MMP-13 in osteoblasts and MMP-9 in osteoclasts may act in concert to promote bone matrix degradation. MMP-13 produced by osteoblasts is responsible for removing the unmineralized osteoid tissues, which protect bone mineral from osteoclastic bone resorption, because osteoclasts cannot adhere to the unmineralized osteoid layer.

In conclusion, IL-1 markedly stimulates expression of MMP-2, -3, and -13 mRNAs in mouse calvariae, but IL-6 stimulates their expression only slightly, even in the presence of sIL-6R. IL-1 and IL-6 similarly induce osteoclast formation, resulting in an increase in the expression of MMP-9 mRNA. Because the differences in the potency of MMP induction between IL-1 and IL-6 correlated well with the bone-resorbing activities of these cytokines, it is likely that the MMP-dependent matrix degradation is the rate-limiting step in osteoclastic bone resorption.


    Acknowledgments
 
We thank Dr. J. Oleksyszyn (OsteoArthritis Science, Inc.) for his generous gift of the hydroxamate MMP inhibitor. We also thank Dr. M. Naruto (Toray Industries, Inc.) for his generous gift of human TIMP-1 cDNA, and Dr. S. Konno (Yagai Co.) for his helpful discussion.


    Footnotes
 
1 This work was supported by Grants-in-Aid 08407060 (to T.S.) and 08457493 (to C.M.) from the Ministry of Science, Education and Culture of Japan and NIH Grant AR-39189 (to H.N.). Back

2 Equal first authors. Back

Received September 4, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gowen M, Wood DD, Ihrie EJ, McGuire MKB, Russell RGG 1983 An interleukin-1-like factor stimulates bone resorption in vitro. Nature 306:378–380[CrossRef][Medline]
  2. Akatsu T, Takahashi N, Udagawa N, Imamura K, Yamaguchi A, Sato K, Nagata N, Suda T 1991 Role of prostaglandins in interleukin-1-induced bone resorption in mice in vitro. J Bone Miner Res 6:183–190[Medline]
  3. Sato K, Fujii Y, Kasono K, Saji M, Tsushima T, Shizume K 1986 Stimulation of prostaglandin E2 and bone resorption by recombinant human interleukin 1 alpha in fetal mouse bones. Biochem Biophys Res Commun 138:618–624[CrossRef][Medline]
  4. Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S, Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, Kishimoto T, Suda T 1993 Soluble interleukin-6 receptor triggers osteoclast formation by interleukin 6. Proc Natl Acad Sci USA 90:11924–11928[Abstract/Free Full Text]
  5. Girasole G, Passeri G, Jilka RL, Manolagas SC 1994 Interleukin-11: a new cytokine critical for osteoclast development. J Clin Invest 93:1516–1524
  6. Suda T, Takahashi N, Martin TJ 1992 Modulation of osteoclast differentiation. Endocr Rev 13:66–80[Abstract/Free Full Text]
  7. Everts V, Delaisse JM, Korper W, Niehof A, Vaes G, Beerts W 1992 Degradation of collagen in the bone-resorbing compartment underlying the osteoclast involves both cysteine-proteinases and matrix metalloproteinases. J Cell Physiol 150:221–231[CrossRef][Medline]
  8. Partridge NC, Jeffrey JJ, Ehlich LS, Teitelbaum SL, Fliszar C, Welgus HG, Kahn AJ 1987 Hormonal regulation of the production of collagenase and collagenase inhibitor activity by rat osteogenic sarcoma cells. Endocrinology 120:1956–1962[Abstract/Free Full Text]
  9. Chambers TJ, Fuller K 1985 Bone cells predispose bone surfaces to resorption by exposure of mineral to osteoclastic contact. J Cell Sci 76:155–165[Abstract]
  10. Meikle MC, Bord S, Hembry RM, Compston J, Croucher PI, Reynolds JJ 1992 Human osteoblasts in culture synthesize collagenase and other matrix metalloproteinases in response to osteotropic hormones and cytokines. J Cell Sci 103:1093–1099[Abstract/Free Full Text]
  11. Inui T, Ishibashi O, Inaoka T, Origane Y, Kumegawa M, Kokubo T, Yamamura T 1997 Cathepsin K antisense oligodeoxynucleotide inhibits osteoclastic bone resorption. J Biol Chem 272:8109–8112[Abstract/Free Full Text]
  12. Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ, Birkedal-Hansen B, DeCarlo A, Engler JA 1993 Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 4:197–250[Abstract/Free Full Text]
  13. Mauviel A 1993 Cytokine regulation of metalloproteinase gene expression. J Cell Biochem 53:288–295[CrossRef][Medline]
  14. Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M 1994 A matrix metalloproteinase expressed on the surface of invasive tumor cells. Nature 370:61–65[CrossRef][Medline]
  15. Freije JMP, Diez-Itza I, Balbin M, Sanchez LM, Blasco R, Tolivia J, Lopez-Otin C 1994 Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas. J Biol Chem 269:16766–16773[Abstract/Free Full Text]
  16. Lorenzo JA, Pilbeam CC, Kalinowski JF, Hibbs MS 1992 Production of both 92- and 72-kDa gelatinases by bone cells. Matrix 12:282–290[Medline]
  17. Heath JK, Atkinson SJ, Meikle MC, Reynolds JJ 1984 Mouse osteoblasts synthesize collagenase in response to bone resorbing agents. Biochim Biophys Acta 802:151–154[Medline]
  18. Quinn CO, Scott DK, Brinckerhoff CE, Matrisian LM, Jeffrey JJ, Partridge NC 1990 Rat collagenase: cloning amino acid sequence comparison and parathyroid hormone regulation in osteoblastic cells. J Biol Chem 265:22342–22347[Abstract/Free Full Text]
  19. Reponen P, Sahlberg C, Muhnaut C, Thesleff I, Tryggvason K 1994 High expression of 92-kDa type IV collagenase (gelatinase B) in the osteoclast lineage during mouse development. J Biol Chem 124:1091–1102
  20. Tezuka K, Nemoto K, Tezuka Y, Sato T, Ikeda Y, Kobori M, Kawashima H, Eguchi H, Hakeda Y, Kumegawa M 1994 Identification of matrix metalloproteinase 9 in rabbit osteoclasts. J Biol Chem 269:15006–15009[Abstract/Free Full Text]
  21. Hill PA, Murphy G, Docherty AJP, Hembry RM, Millican A, Reynolds JJ, Meikle MC 1994 The effects of selective inhibitors of matrix metalloproteinases (MMPs) on bone resorption and the identification of MMPs and TIMP-1 in isolated osteoclasts. J Cell Sci 107:3055–3064[Abstract]
  22. Hill PA, Docherty AJP, Bottomley KMK, O’Connell JP, Morphy JR, Reynolds JJ, Meikle MC 1995 Inhibition of bone resorption in vitro by selective inhibitors of gelatinase and collagenase. Biochem J 308:167–175
  23. Chambers TJ, Darby JA, Fuller K 1985 Mammalian collagenase predisposes bone surfaces to osteoclastic resorption. Cell Tissue Res 241:671–675[Medline]
  24. Aimes RT, Quigley JP 1995 Matrix metalloproteinase-2 is an interstitial collagenase. J Biol Chem 270:5872–5876[Abstract/Free Full Text]
  25. Onoe Y, Miyaura C, Kaminakayashiki T, Nagai Y, Noguchi K, Chen QR, Seo H, Ohta H, Nozawa S, Kudo I, Suda T 1996 IL-13 and IL-4 inhibit bone resorption by suppressing cyclooxygenase-2-dependent prostaglandin synthesis in osteoblasts. J Immunol 156:758–764[Abstract]
  26. Henriet P, Rousseau GG, Eeckhout Y 1992 Cloning and sequencing of mouse collagenase cDNA. FEBS Lett 310:175–178[CrossRef][Medline]
  27. Collier IE, Wilhelm SM, Eisen AZ, Marmer BL, Grant GA, Seltzer JL, Kronberger A, He C, Bauer EA, Goldberg GI 1988 H-ras oncogene-transformed human bronchial epithelial cells (TBE-1) secrete a single metalloprotease capable of degrading basement membrane collagen. J Biol Chem 263:6579–6587[Abstract/Free Full Text]
  28. Saus J, Quinones S, Otani Y, Nagase H, Harris ED, Kurkinen M 1988 The complete primary structure of human matrix metalloproteinase-3. J Biol Chem 263:6742–6745[Abstract/Free Full Text]
  29. Tanaka H, Hojo K, Yoshida H, Yoshioka T, Sugita K 1993 Molecular cloning and expression of the mouse 105-kDa gelatinase cDNA. Biochem Biophys Res Commun 190:732–740[CrossRef][Medline]
  30. Takahashi S, Ito A, Nagino M, Mori Y., Xie B, Nagase H 1991 Cyclic adenosine 3', 5'-monophosphate suppresses interleukin-1-induced synthesis of matrix metalloproteinases but not of tissue inhibitor of metalloproteinases in human uterine cervical fibroblasts. J Biol Chem 266:19894–19899[Abstract/Free Full Text]
  31. Morodomi T, Ogata Y, Sasaguri Y, Morimatsu M, Nagase H 1992 Purification and characterization of matrix metalloproteinase 9 from U937 monocytic leukaemia and HT1080 fibrosarcoma cells. Biochem J 285:603–611
  32. Brenner DA, O’Hara M, Angel P, Chojkier M, Karin ML 1989 Prolonged activation of jun and collagenase genes by tumor necrosis factor-{alpha}. Nature 337:661–663[CrossRef][Medline]
  33. Schonthal A, Herrlich P, Rahmsdorf HJ, Ponta H 1988 Requirement for fos expression in the transcriptional activation of collagenase by other oncogenes and phorbol esters. Cell 54:325–334[CrossRef][Medline]
  34. McDonnell SE, Kerr LD, Matrisian LM 1990 Epidermal growth factor stimulation of stromelysin mRNA in rat fibroblasts requires induction of proto-oncogenes c-fos and c-jun and activation of protein kinase C. Mol Cell Biol 10:4284–4293[Abstract/Free Full Text]
  35. Frisch S, Morisaki JH 1990 Positive and negative transcriptional elements of the human type IV collagenase gene. Mol Cell Biol 10:6524–6532[Abstract/Free Full Text]
  36. Marti H, McNeil L, Davies M, Martin J, Lovett DH 1993 Homology cloning of rat 72 kDa type IV collagenase: cytokine and second-messenger inducibility in glomerular mesangial cells. Biochem J 291:441–446
  37. Franchimont N, Rydziel S, Delany AM, Canalis E 1997 Interleukin-6 and its soluble receptor cause a marked induction of collagenase 3 expression in rat osteoblast cultures. J Biol Chem 272:12144–12150[Abstract/Free Full Text]
  38. Okada Y, Naka K, Kawamura K, Matsumoto T, Nakanishi I, Fujimoto N, Sato H, Seiki M 1995 Localization of matrix metalloproteinase 9 (92-kilodalton gelatinase/type IV collagenase = gelatinase B) in osteoclasts: implications for bone resorption. Lab Invest 72:311–322[Medline]
  39. Jimi E, Shuto T, Koga T 1995 Macrophage colony-stimulating factor and interleukin-1{alpha} maintain the survival of osteoclast-like cells. Endocrinology 136:808–811[Abstract]
  40. Murphy G, Cockett MI, Stephens PE, Smith BJ, Docherty AJP 1987 Stromelysin is an activator of procollagenase. Biochem J 248:265–268[Medline]
  41. Suzuki K, Enghild JJ, Morodomi T, Salvesen G, Nagase H 1990 Mechanisms of activation of tissue procollagenase by matrix metalloproteinase 3. Biochemistry 29:10261–10270[CrossRef][Medline]
  42. Ogata Y, Enghild JJ, Nagase H 1992 Matrix metalloproteinase 3 (stromelysin) activates the precursor for the human matrix metalloproteinases 9. J Biol Chem 267:3581–3584[Abstract/Free Full Text]
  43. Kinoh H, Sato H, Tsunezuka Y, Takino T, Kawashima A, Okada Y, Seiki M 1996 MT-MMP, the cell surface activator of proMMP-2 (pro-gelatinase A), is expressed with its substrate in mouse tissue during embryogenesis. J Cell Sci 109:953–959[Abstract]
  44. Sato T, Ovejero MC, Hou P, Heegaard AM, Kumegawa M, Foged NT, Delaisse JM 1997 Identification of the membrane-type matrix metalloproteinase MT1-MMP in osteoclasts. J Cell Sci 110:589–596[Abstract]
  45. Knauper V, Will H, Lopez-Otin C, Smith B, Atkinson SJ, Stanton H, Hembry RM, Murphy G 1996 Cellular mechanisms for human procollagenase-3 (MMP-13) activation. J Biol Chem 271:17124–17131[Abstract/Free Full Text]
  46. Ohuchi E, Imai K, Fujii Y, Sato H, Seiki M, Okada Y 1997 Membrane type 1 matrix metalloproteinase digests interstitial collagens and other extracellular matrix macromolecules. J Biol Chem 272:2446–2451[Abstract/Free Full Text]
  47. Gack S, Vallon R, Schmidt J, Grigoriadis A, Tuckermann J, Schenkel J, Weiher H, Wagner EF, Angel P 1995 Expression of interstitial collagenase during skeletal development of the mouse is restricted to osteoblast-like cells and hypertrophic chondrocytes. Cell Growth Differ 6:759–767[Abstract]
  48. Fuller K, Chambers TJ 1995 Localization of mRNA for collagenase in osteocytic, bone surface and chondrocytic cells but not osteoclasts. J Cell Sci 108:2221–2230[Abstract]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. MacLauchlan, E. A. Skokos, N. Meznarich, D. H. Zhu, S. Raoof, J. M. Shipley, R. M. Senior, P. Bornstein, and T. R. Kyriakides
Macrophage fusion, giant cell formation, and the foreign body response require matrix metalloproteinase 9
J. Leukoc. Biol., April 1, 2009; 85(4): 617 - 626.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
J. M. Ruddy, J. A. Jones, F. G. Spinale, and J. S. Ikonomidis
Regional heterogeneity within the aorta: Relevance to aneurysm disease.
J. Thorac. Cardiovasc. Surg., November 1, 2008; 136(5): 1123 - 1130.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Kominsky, S. M. Abdelmagid, M. Doucet, K. Brady, and K. L. Weber
Macrophage Inflammatory Protein-1{delta}: A Novel Osteoclast Stimulating Factor Secreted by Renal Cell Carcinoma Bone Metastasis
Cancer Res., March 1, 2008; 68(5): 1261 - 1266.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
A. A.N. Rose, F. Pepin, C. Russo, J. E. Abou Khalil, M. Hallett, and P. M. Siegel
Osteoactivin Promotes Breast Cancer Metastasis to Bone
Mol. Cancer Res., October 1, 2007; 5(10): 1001 - 1014.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
K. J. Greenlee, Z. Werb, and F. Kheradmand
Matrix Metalloproteinases in Lung: Multiple, Multifarious, and Multifaceted
Physiol Rev, January 1, 2007; 87(1): 69 - 98.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Inada, C. Matsumoto, S. Uematsu, S. Akira, and C. Miyaura
Membrane-Bound Prostaglandin E Synthase-1-Mediated Prostaglandin E2 Production by Osteoblast Plays a Critical Role in Lipopolysaccharide-Induced Bone Loss Associated with Inflammation
J. Immunol., August 1, 2006; 177(3): 1879 - 1885.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. Qi, A. M. Fox, L. G. Alexopoulos, L. Chi, D. Bynum, F. Guilak, and A. J. Banes
IL-1beta decreases the elastic modulus of human tenocytes
J Appl Physiol, July 1, 2006; 101(1): 189 - 195.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
A. P. Hall, F. R. Westwood, and P. F. Wadsworth
Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate
Toxicol Pathol, February 1, 2006; 34(2): 131 - 147.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
S. Oka, Y. Kubota, T. Yamashiro, S. Ogata, T. Ninomiya, S. Ito, and K. Shirasuna
Effects of Positive Pressure in Odontogenic Keratocysts
Journal of Dental Research, October 1, 2005; 84(10): 913 - 918.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. G. Choi, H. S. Koh, D. Kluess, D. O'Connor, A. Mathur, G. A. Truskey, J. Rubin, D. X. F. Zhou, and K.-L. P. Sung
Effects of titanium particle size on osteoblast functions in vitro and in vivo
PNAS, March 22, 2005; 102(12): 4578 - 4583.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Inada, Y. Wang, M. H. Byrne, M. U. Rahman, C. Miyaura, C. Lopez-Otin, and S. M. Krane
Critical roles for collagenase-3 (Mmp13) in development of growth plate cartilage and in endochondral ossification
PNAS, December 7, 2004; 101(49): 17192 - 17197.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D.-Q. Li, Z. Chen, X. J. Song, L. Luo, and S. C. Pflugfelder
Stimulation of Matrix Metalloproteinases by Hyperosmolarity via a JNK Pathway in Human Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci., December 1, 2004; 45(12): 4302 - 4311.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
P. J. Barnes
Mediators of Chronic Obstructive Pulmonary Disease
Pharmacol. Rev., December 1, 2004; 56(4): 515 - 548.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Kitamura, Y. Nakamoto, S. Kaneko, and N. Mukaida
Pivotal roles of interleukin-6 in transmural inflammation in murine T cell transfer colitis
J. Leukoc. Biol., December 1, 2004; 76(6): 1111 - 1117.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Mori, M. Shibanuma, and K. Nose
Invasive Potential Induced under Long-Term Oxidative Stress in Mammary Epithelial Cells
Cancer Res., October 15, 2004; 64(20): 7464 - 7472.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth
Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification
Endocr. Rev., August 1, 2004; 25(4): 629 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. M. Wright and J. S. Friedland
Regulation of monocyte chemokine and MMP-9 secretion by proinflammatory cytokines in tuberculous osteomyelitis
J. Leukoc. Biol., June 1, 2004; 75(6): 1086 - 1092.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Selvamurugan, S. Kwok, T. Alliston, M. Reiss, and N. C. Partridge
Transforming Growth Factor-{beta}1 Regulation of Collagenase-3 Expression in Osteoblastic Cells by Cross-talk between the Smad and MAPK Signaling Pathways and Their Components, Smad2 and Runx2
J. Biol. Chem., April 30, 2004; 279(18): 19327 - 19334.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
T. M. Doherty, L. A. Fitzpatrick, A. Shaheen, T. B. Rajavashisth, and R. C. Detrano
Genetic Determinants of Arterial Calcification Associated With Atherosclerosis
Mayo Clin. Proc., February 1, 2004; 79(2): 197 - 210.
[Abstract] [PDF]


Home page
J. Immunol.Home page
N. G. Sandler, M. M. Mentink-Kane, A. W. Cheever, and T. A. Wynn
Global Gene Expression Profiles During Acute Pathogen-Induced Pulmonary Inflammation Reveal Divergent Roles for Th1 and Th2 Responses in Tissue Repair
J. Immunol., October 1, 2003; 171(7): 3655 - 3667.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Matsuyama, N. Sakai, M. Ishigami, H. Hiraoka, S. Kashine, A. Hirata, T. Nakamura, S. Yamashita, and Y. Matsuzawa
Matrix Metalloproteinases as Novel Disease Markers in Takayasu Arteritis
Circulation, September 23, 2003; 108(12): 1469 - 1473.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Q. ESCARTIN, C. LALLAM-LAROYE, B. BAROUKH, F. O. MORVAN, J. P. CARUELLE, G. GODEAU, D. BARRITAULT, and J. L. SAFFAR
A new approach to treat tissue destruction in periodontitis with chemically modified dextran polymers
FASEB J, April 1, 2003; 17(6): 644 - 651.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B.-K. Choi, H. J. Lee, J. H. Kang, G. J. Jeong, C. K. Min, and Y.-J. Yoo
Induction of Osteoclastogenesis and Matrix Metalloproteinase Expression by the Lipooligosaccharide of Treponema denticola
Infect. Immun., January 1, 2003; 71(1): 226 - 233.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Onodera, J. Nishihira, K. Iwabuchi, Y. Koyama, K. Yoshida, S. Tanaka, and A. Minami
Macrophage Migration Inhibitory Factor Up-regulates Matrix Metalloproteinase-9 and -13 in Rat Osteoblasts. RELEVANCE TO INTRACELLULAR SIGNALING PATHWAYS
J. Biol. Chem., March 1, 2002; 277(10): 7865 - 7874.
[Abstract] [Full Text] [PDF]


Home page
ptjournalHome page
A. E Barr and M. F Barbe
Pathophysiological Tissue Changes Associated With Repetitive Movement: A Review of the Evidence
Physical Therapy, February 1, 2002; 82(2): 173 - 187.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Varghese, S. Rydziel, and E. Canalis
Basic Fibroblast Growth Factor Stimulates Collagenase-3 Promoter Activity in Osteoblasts through an Activator Protein-1-Binding Site
Endocrinology, June 1, 2000; 141(6): 2185 - 2191.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Suzawa, C. Miyaura, M. Inada, T. Maruyama, Y. Sugimoto, F. Ushikubi, A. Ichikawa, S. Narumiya, and T. Suda
The Role of Prostaglandin E Receptor Subtypes (EP1, EP2, EP3, and EP4) in Bone Resorption: An Analysis Using Specific Agonists for the Respective EPs
Endocrinology, April 1, 2000; 141(4): 1554 - 1559.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Solis-Herruzo, R. A. Rippe, L. W. Schrum, P. de la Torre, I. Garcia, J. J. Jeffrey, T. Munoz-Yague, and D. A. Brenner
Interleukin-6 Increases Rat Metalloproteinase-13 Gene Expression through Stimulation of Activator Protein 1 Transcription Factor in Cultured Fibroblasts
J. Biol. Chem., October 22, 1999; 274(43): 30919 - 30926.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
R. C. Pereira, V. Jorgetti, and E. Canalis
Triiodothyronine induces collagenase-3 and gelatinase B expression in murine osteoblasts
Am J Physiol Endocrinol Metab, September 1, 1999; 277(3): E496 - E504.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
B. C. Kieseier, R. Paul, U. Koedel, T. Seifert, J. M. Clements, A. J. H. Gearing, H.-W. Pfister, and H.-P. Hartung
Differential expression of matrix metalloproteinases in bacterial meningitis
Brain, August 1, 1999; 122(8): 1579 - 1587.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. J. G. Jimenez, M. Balbin, J. M. Lopez, J. Alvarez, T. Komori, and C. Lopez-Otin
Collagenase 3 Is a Target of Cbfa1, a Transcription Factor of the runt Gene Family Involved in Bone Formation
Mol. Cell. Biol., June 1, 1999; 19(6): 4431 - 4442.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
S. Varghese, K. Yu, and E. Canalis
Leukemia inhibitory factor and oncostatin M stimulate collagenase-3 expression in osteoblasts
Am J Physiol Endocrinol Metab, March 1, 1999; 276(3): E465 - E471.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Miyaura, M. Inada, T. Suzawa, Y. Sugimoto, F. Ushikubi, A. Ichikawa, S. Narumiya, and T. Suda
Impaired Bone Resorption to Prostaglandin E2 in Prostaglandin E Receptor EP4-knockout Mice
J. Biol. Chem., June 23, 2000; 275(26): 19819 - 19823.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Winchester, N. Selvamurugan, R. C. D'Alonzo, and N. C. Partridge
Developmental Regulation of Collagenase-3 mRNA in Normal, Differentiating Osteoblasts through the Activator Protein-1 and the runt Domain Binding Sites
J. Biol. Chem., July 21, 2000; 275(30): 23310 - 23318.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. J.G. Jimenez, M. Balbin, J. Alvarez, T. Komori, P. Bianco, K. Holmbeck, H. Birkedal-Hansen, J. M. Lopez, and C. Lopez-Otin
A regulatory cascade involving retinoic acid, Cbfa1, and matrix metalloproteinases is coupled to the development of a process of perichondrial invasion and osteogenic differentiation during bone formation
J. Cell Biol., December 24, 2001; 155(7): 1333 - 1344.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kusano, K.
Right arrow Articles by Suda, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kusano, K.
Right arrow Articles by Suda, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals