help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Mulholland, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Mulholland, J.
Endocrinology Vol. 139, No. 3 961-966
Copyright © 1998 by The Endocrine Society

ARTICLES

Mediators of Estradiol-Stimulated Mitosis in the Rat Uterine Luminal Epithelium1

Zhiming Zhang2, Jane Laping, Stanley Glasser, Peter Day and Joy Mulholland

Department of Cell Biology, Baylor College of Medicine (Z.Z., J.L., S.G., J.M.), Houston, Texas 77030; and the Department of Obstetrics and Gynecology, Thomas Jefferson University (P.D., J.M.), Philadelphia, Pennsylvania 19107

Address all correspondence and requests for reprints to: Dr. Joy Mulholland, Department of Obstetrics and Gynecology, Thomas Jefferson University, 834 Chestnut Street, Suite 400, Philadelphia, Pennsylvania 19107. E-mail: mulholl2{at}jeflin.tju.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effects of estradiol treatment, which stimulates cell division in rat uterine epithelial cells, on the in vivo expression of heparin-binding epidermal growth factor (HB-EGF), cyclin D1, and cyclin B1 messenger RNA (mRNA) in these cells have been examined using ribonuclease protection assays. Estradiol gave rise to significant increases in steady state levels of HB-EGF 2 and 24 h after treatment. Cyclin D1 mRNA levels were elevated 8 and 10 h after estradiol administration, corresponding to the G1 phase of the mitotic cycle, and cyclin B1 mRNA was only expressed 16–24 h after estradiol treatment, which corresponds to the G2 and M phases of the rat uterine epithelial cell cycle. Estradiol-stimulated increases in HB-EGF mRNA were not affected by treatment with cycloheximide, but were inhibited by the estrogen antagonist compound, ICI 164,384, demonstrating that the estrogen-stimulated increase in HB-EGF mRNA is a primary, estrogen receptor-mediated response of rat uterine epithelium to estradiol. Progesterone treatment, which blocks epithelial cells in G1 of the cycle, suppressed levels of HB-EGF mRNA below those observed in ovariectomized rats. These results indicate that HB-EGF mediates the regulatory effects of both estradiol and progesterone on rat uterine epithelial cell proliferation through an effect on the production of G1 phase molecules such as cyclin D1.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ESTRADIOL and progesterone regulate mitosis in the epithelial and stromal cells of the rat and mouse uterus in mature animals. In the mature, ovariectomized rat model, estradiol treatment induces DNA synthesis 12–16 h after treatment, and mitosis follows at 18–24 h (1, 2). Progesterone inhibits DNA synthesis in the epithelium, but stimulates mitosis in stromal cells (1, 3). Progesterone and estradiol administered jointly also stimulate uterine stromal cell mitosis (3). The long interval between estradiol treatment and DNA synthesis and mitosis in uterine luminal epithelial cells denotes that the synthesis of intermediate molecules is required in this pathway, and a number of growth factors and oncogene products have been proposed as mediators of estrogen action in the stimulation of uterine epithelial cell mitosis (4). However, none of the candidate estrogen-stimulated growth factors is affected by progesterone, and the mechanism for progesterone inhibition of uterine epithelial cell division remains unknown (4).

Heparin-binding epidermal growth factor (HB-EGF) is an EGF-like growth factor that binds to heparin, activates EGF receptors, and is mitogenic in epithelial, fibroblastic, and smooth muscle cells in vitro (5, 6, 7, 8). Our original study of HB-EGF expression in the rat uterus indicated that HB-EGF messenger RNA (mRNA) expression is regulated in rat uterine epithelial and stromal cells with the same cell specificity as mitosis. Estradiol treatment for 24 h stimulated HB-EGF mRNA expression in uterine luminal and glandular epithelial cells (9). Progesterone treatment for 72 h inhibited HB-EGF mRNA expression in epithelial cells and stimulated expression of this growth factor in uterine stromal cells when administered alone or in conjunction with estradiol (9). HB-EGF, therefore, is the first growth factor to be described that has the potential to mediate the effects of both progesterone and estradiol on uterine epithelial cell proliferation. If HB-EGF synthesis in response to estradiol stimulates epithelial cell mitosis, then HB-EGF must be expressed soon after treatment with estradiol and before DNA synthesis is initiated. Similarly, if the inhibition of HB-EGF expression in response to progesterone prevents epithelial cell mitosis, then HB-EGF expression must be repressed soon after progesterone treatment and remain suppressed as long as progesterone treatment is maintained. In our first study, HB-EGF expression was examined only at a single time after estradiol (24 h) or progesterone (72 h) treatment. In this paper we have examined HB-EGF expression at closely spaced time points to determine how quickly it responds to estradiol or progesterone treatment and how the time of HB-EGF expression compares with known times of induction of rat uterine epithelial cell DNA synthesis and cell division after estradiol treatment.

Progesterone treatment arrests uterine epithelial cells in the G1 phase of the cell cycle, thereby preventing DNA synthesis and subsequent mitosis, whereas estradiol stimulates epithelial cells to enter the S phase and replicate DNA (4, 10). If HB-EGF acts as a mediator of steroid regulation of uterine epithelial cell mitosis, it may function by stimulating the production of molecules such as cyclins, which are required to propel epithelial cells through the G1 phase and into the S phase for DNA synthesis. Cyclins are essential regulators of DNA replication and cell mitosis. By complexing with and activating cyclin-dependent kinases, specific cyclins initiate different stages of the cell cycle. In mammalian cells, cyclins D, E, and A function in the progression of cells from G1 to S phase (11, 12, 13). Expression of the D cyclins is stimulated by mitogenic growth factors, and D cyclins are thought to determine whether cells continue with the proliferative cycle or become arrested (14). Cyclins E and A are produced later in the G1 stage than the D cyclins and do not appear to be induced by growth factors (14). As progesterone arrests uterine epithelial cells in G1, and estradiol induces DNA synthesis in these cells, it is likely that HB-EGF mediates the effects of both progesterone and estradiol on epithelial cell proliferation by regulating the production of D cyclins. In this report we compare the time of induction of HB-EGF and cyclin D1 expression by estradiol to determine whether regulation of cyclin D1 could be the mechanism through which HB-EGF mediates the effects of estradiol and progesterone on uterine epithelial cell mitosis. In contrast to cyclin D1, which acts in the G1 phase of the cell cycle, the B cyclins regulate mitosis and reset the mitotic program so a new cycle can be initiated (12, 13). B cyclins first appear during the G2-M transition in the cell cycle. Cyclin B is then degraded during anaphase, allowing the cell to complete mitosis and return to G1 (12, 13). Cyclin B should not be expressed by cells that are arrested in G1, i.e. uterine epithelial cells after progesterone treatment. In this study the times of expression of cyclins B1 and D1 are examined to determine whether either of these molecules might be regulated by HB-EGF. The results of this study imply that estradiol-stimulated HB-EGF expression leads to the expression of cyclin D1 in these cells, and that the inhibition of HB-EGF expression by progesterone blocks cyclin D1 expression, thereby arresting uterine epithelial cells in the G1 phase and preventing DNA synthesis and mitosis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mature (150-g) female, Sprague-Dawley rats were ovariectomized and left untreated for 10 days to clear residual steroids from the circulation before further treatment. Estradiol was administered as a single treatment of 200 ng/rat, and progesterone was administered at 5 mg/rat. These treatments are known to give rise to rat uterine epithelial cell (estradiol) or stromal cell (progesterone) division (1, 2) and have previously been used to examine the effects of these hormones on HB-EGF expression in these cell types (9). All hormones were solubilized in peanut oil for injection. Cycloheximide (800 µg/rat in saline) was given as a single dose 30 min before estradiol treatment, and animals were killed 2 h after estradiol injection. This dose of cycloheximide has previously been shown to inhibit protein synthesis in the rat uterus (15). ICI 164,384 (Zeneca Pharmaceuticals, Cheshire, UK) was injected at 100 µg/rat in saline, 15 min before estradiol treatment. At the indicated times after treatment, animals were killed by an overdose of anesthetic (Avertin). Uterine epithelial cells were isolated as described by Bitton-Casimiri et al. (16), and total cellular RNA was extracted with RNAzol B (Cinnabiotex, Friendswood, TX). Each untreated (ovariectomized) and hormone treatment sample contained RNA from 15–20 rats. Each complete time-course assay was conducted with a single group of animals that was ovariectomized and treated as a single experimental group, and each assay was repeated two to four times using independent groups of animals. Animals were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals.

Methods for ribonuclease (RNase) protection assays (RPA) have been reported in detail previously (9, 17). Briefly, radiolabeled antisense RNA probes were synthesized using the Stratagene system, and probes were hybridized with 10–20 µg RNA using the Ambion RPA II system (Ambion, Austin, TX) according to the manufacturer’s instructions. All RPA samples were probed with target probes and with two standard probes. Sense strand RNA probes and yeast RNA were used as controls for nonspecific hybridization. The standard probes were A1, mitochondrial cytochrome oxidase subunit 1, which was provided by Drs. Brian Pentecost and Richard Lyttle (18), and ß-actin supplied by Ambion. The rat HB-EGF complementary DNA (cDNA) used for RNA probes was isolated by our group from a subtracted rat uterine stromal cell cDNA library and has been described previously (9). Rat cyclin B1 cDNA was kindly provided by Dr. Hiroshi Nojima (Osaka, Japan) (19). Rat cyclin D1 cDNA was synthesized from rat liver RNA by PCR using the forward primer GCCGCCAAGCTTATGGAACACCAGCTCCTG and the reverse primer CCCGGTTCTAGATCAGATGTCCACATCTCG to yield an 887-bp cDNA that was cloned into the Bluescript SK II vector (Stratagene, La Jolla, CA). RNA and probes were hybridized overnight at 42–45 C, then digested for 1 h at 15 C with RNase to remove unhybridized RNA. Hybridized RNA was fractionated on 8% acrylamide-8 M urea gels. Gels were exposed to x-ray film with intensifying screens, and the resulting films were scanned for quantitative analysis.

Films from each RPA were scanned and analyzed using Kodak 1-D digital image analysis software (Eastman Kodak, Rochester, NY). Variability in RNA sample loading or degradation was corrected by comparing the number of densitometric units for the target probe (dt) to the number of densitometric units for the standard probes (ds) for each sample. This ratio dt/ds for steroid-treated samples was then divided by the ratio for the ovariectomized, untreated sample within each experimental group and multiplied by 100 to determine the percent difference between the treated and untreated samples. The ratio of dt/ds for ovariectomized, untreated animals was set at 100% and marked as a line across the data on each graph. The mean percent difference for each time point of steroid-treated animals was calculated from three or four independent experiments. The graphed data were analyzed for statistical significance by ANOVA, using Fisher’s protected least significant difference test, requiring P < 0.05 for significance.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
After a single injection of each rat with 200 ng estradiol, uterine luminal epithelial cell RNA was isolated at intervals up to 24 h and analyzed to determine steady state levels of HB-EGF mRNA. Message levels for this growth factor increased significantly in two intervals, 2 and 24 h after treatment with estradiol (Fig. 1Go). HB-EGF mRNA levels were below ovariectomized levels at 12 and 16 h (Fig. 1Go). Treatment with cycloheximide 30 min before injection of estradiol did not prevent the estradiol-stimulated increase in HB-EGF mRNA at 2 h (Fig. 2Go), indicating that the synthesis of new proteins is not required and that estradiol has a direct effect on HB-EGF mRNA levels. It was not possible to determine the effects of cycloheximide on the 24 h peak in HB-EGF mRNA because of its toxicity to the animals. Cycloheximide alone had no effect on HB-EGF mRNA levels (Fig. 2Go). The estrogen antagonist ICI 164,384 also had no direct effect on HB-EGF mRNA levels. However, when given 15 min before estradiol, ICI 164,384 at 100 µg/rat inhibited the estradiol stimulation of HB-EGF message levels at both 2 and 24 h (Fig. 3Go).



View larger version (39K):
[in this window]
[in a new window]
  		Figure 1. Effects of estradiol (E) on steady state levels of HB-EGF mRNA in luminal epithelial cells from 1–24 h. A, RNase protection assay from one estrogen time-course experiment. In this particular experiment, actin was used as the standard to normalize the amount of total RNA in each sample. + and - RNase lanes contain yeast RNA hybridized with probe and then treated (+) or not treated (-) with RNase. B, Densitometric data from scans of three independent RNase protection experiments. Values from estradiol-treated animals are expressed as a percentage of the value for ovariectomized, untreated rats (OVX), which is set at 100% and indicated by a line through the data. P < 0.05 at 2, 12, 16, and 24 h.

 


View larger version (82K):
[in this window]
[in a new window]
  		Figure 2. RNase protection assay showing HB-EGF (H) and actin (A) mRNA expression after cycloheximide (CHX) treatment. Cycloheximide was administered 30 min before estradiol, and animals were killed 2 h after estradiol treatment. Two independent assays were performed.

 


View larger version (55K):
[in this window]
[in a new window]
  		Figure 3. RNase protection assay showing the effects of the estrogen antagonist, ICI 164,384, on the expression of HB-EGF mRNA. The ICI compound was administered 15 min before estradiol. Time points are from the time of estradiol injection. Two independent assays were performed.

 
In contrast, progesterone treatment (5 mg/rat) significantly suppressed HB-EGF mRNA levels in luminal epithelial cells. At every time point examined after progesterone treatment, HB-EGF mRNA levels were 60% or less of levels observed in ovariectomized, untreated animals (Fig. 4Go).



View larger version (27K):
[in this window]
[in a new window]
  		Figure 4. Effects of progesterone on steady state levels of HB-EGF mRNA in luminal epithelial cells from 4–24 h. A, RNase protection assay from one progesterone time-course experiment. B, Densitometric data from scans of three independent experiments. P < 0.05 at 4 and 24 h.

 
Time-course studies were also used to examine the effects of estradiol on the expression of mRNA for cyclins D1 and B1. Cyclin D1 mRNA, which is normally expressed during the G1 phase of the cell cycle, was significantly increased in uterine luminal epithelial cells 8 h after estradiol administration and declined to ovariectomized levels by 12 h (Fig. 5Go). Cyclin B1 mRNA, which is normally expressed during G2 and M phases, was not detected until 16 h after estradiol treatment, but was then expressed through 24 h (Fig. 6Go). Cyclin B1 mRNA expression was never detectable in luminal epithelial cells after progesterone treatment (data not shown).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 5. Cyclin D1 mRNA expression in luminal epithelial cells after estradiol treatment. A, RNase protection assay from one estrogen time-course experiment. Y+, Yeast RNA with RNase treatment; Y-, yeast RNA without RNase treatment. B, Densitometric data from scans of four independent experiments (the 10 h point was examined in only one experiment). P < 0.05 at 8 h.

 


View larger version (28K):
[in this window]
[in a new window]
  		Figure 6. Cyclin B1 mRNA expression in uterine luminal epithelial cells after estradiol treatment. Representative RNase protection assay for cyclin B1 and A1 mRNA. Y+, Yeast RNA with RNase treatment; Y-, yeast RNA without RNase treatment. Two independent assays were performed.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
These studies have compared the time course of HB-EGF expression in rat uterine epithelial cells in vivo after treatment with estradiol or progesterone with the patterns of expression of cyclins D1 and B1 to determine whether it is possible for HB-EGF to regulate the production of either cyclin. Estradiol treatment gave rise to two peaks of HB-EGF mRNA expression at 2 and 24 h, and both peaks were found to represent statistically significant increases in the level of HB-EGF mRNA. The 2 h peak was unaffected by pretreatment with cycloheximide. This failure of cycloheximide treatment to inhibit the effect of estradiol on HB-EGF mRNA expression indicates that estradiol acts directly on the HB-EGF gene and does not stimulate the production of intermediate protein molecules to enhance HB-EGF mRNA levels. The estrogen antagonist ICI 164,384 binds to estrogen receptor and inhibits receptor-mediated actions of estradiol (20). Pretreatment of rats with the ICI compound prevented both the 2 and 24 h increases in steady state levels of HB-EGF mRNA after estradiol administration. These results demonstrate that the stimulation of HB-EGF mRNA levels in rat uterine epithelium is estrogen receptor mediated. Taken together, this group of experiments demonstrates for the first time that an increase in steady state levels of HB-EGF mRNA is an early, primary response of rat uterine epithelial cells to estradiol treatment. As the first peak of HB-EGF expression occurs 10 h before the initiation of DNA synthesis, HB-EGF could act as an intermediate in estrogen-induced mitosis in these cells.

In previous studies we showed that the decline in steady state levels of HB-EGF mRNA in uterine epithelial cells 24 h after progesterone treatment is a primary, progesterone receptor-mediated response (17). As the suppression of uterine epithelial cell proliferation by progesterone is known to be a progesterone receptor-mediated event (21), progesterone must actively inhibit mitosis through a molecular pathway. The evidence that genes that are rapidly induced by estradiol, such as c-fos, c-myc, and ornithine decarboxylase, play a role in steroid-induced cell proliferation in the uterus has recently been reviewed (4). However, although estradiol treatment stimulates the production of ornithine decarboxylase, c-fos, and c-myc in the mouse uterine epithelium, the production of these molecules is not sufficient for the induction of DNA synthesis, and progesterone pretreatment does not inhibit these responses even while inhibiting epithelial mitosis (4, 22). Therefore, these molecules are probably not primary intermediates in the regulation of uterine epithelial cell proliferation. In the time-course study presented above, progesterone treatment significantly suppressed HB-EGF mRNA levels within 4 h to 50–60% of the levels found in the epithelium of ovariectomized rats. We have previously shown that these levels remain suppressed with continued, daily progesterone treatment (9). In this paper we have established that estradiol treatment stimulates HB-EGF expression within 2 h, and that progesterone inhibits HB-EGF expression within 4 h. The regulation of HB-EGF expression by both steroids is receptor mediated. As DNA synthesis occurs 12–16 h after estradiol treatment and is inhibited completely by progesterone treatment (1, 2, 3), the results of time-course and receptor antagonist studies presented in this paper reveal that HB-EGF could mediate both the stimulatory effects of estradiol and the inhibitory effects of progesterone on rat uterine epithelial cell proliferation.

One possible mechanism for the regulation of epithelial cell mitosis by HB-EGF is that this growth factor controls the production of cyclin molecules that act to stimulate DNA synthesis. The G1 phase cyclins stimulate eukaryotic cells to complete G1 and begin to replicate DNA. As the production of D cyclins is known to be stimulated by growth factors and is thought to be determinative for DNA synthesis (14), HB-EGF is likely to act by stimulating the production of D cyclins. The results presented above demonstrate that estradiol-stimulated expression of mRNA for HB-EGF precedes that of cyclin D1 mRNA by 6 h, strongly suggesting that HB-EGF is required for the production of cyclin D1. Cycloheximide treatment appeared to attenuate the effects of estradiol treatment on cyclin D1 mRNA expression at 8 h, indicating that the synthesis of intermediates is necessary for stimulating cyclin D1 expression. However, cycloheximide administered alone also substantially stimulated cyclin D1 mRNA levels at 8 h, and the interpretation of these results is unclear (data not shown). Superinduction of D cyclins in the immature mouse uterus by cycloheximide has also been described by Geum et al., but the mechanism for this effect is unknown (23). Stimulation of cyclin D1 mRNA levels is restricted to a short (4- to 6-h) interval that precedes the onset of the S phase. Both HB-EGF and cyclin D1 mRNA levels are low in rat uterine epithelial cells during the S phase (12–16 h), but HB-EGF levels rise again after mitosis (24 h). Estradiol treatment shortens the time necessary for uterine epithelial cells to complete a cell cycle, and G1 is the most affected phase (10). The second increase in HB-EGF expression shortly after mitosis could act to reduce the G1 interval (by subsequent rapid induction of cyclin D1 expression) and prepare the cells for another mitotic cycle. Alternatively, the second rise in HB-EGF mRNA levels might reflect a second population of epithelial cells that was originally estrogen stimulated at a different point in the cell cycle and that, therefore, appears to lag in its response to estradiol treatment (10). Although the timing of expression of mRNA for HB-EGF and cyclin D1 after estradiol treatment suggests a functional relationship between these two molecules, experiments that show a direct effect of HB-EGF on cyclin D1 expression and uterine epithelial cell mitosis will be necessary to determine whether this is indeed the mechanism by which HB-EGF mediates the effects of estradiol and progesterone on uterine epithelial cell proliferation.

In contrast to cyclin D1, cyclin B1 mRNA expression appears to be stimulated as a consequence of DNA synthesis in uterine epithelium rather than a direct response to estradiol treatment. As mRNA for cyclin B1 and HB-EGF are both increased at the same time point (24 h), and cyclin B1 mRNA levels begin to rise at 16 h when HB-EGF mRNA levels are very low, HB-EGF is unlikely to stimulate cyclin B1 expression. After progesterone treatment, cyclin B1 mRNA was undetectable in uterine epithelial cells, confirming that progesterone-treated cells are arrested in G1.

HB-EGF is a potent mitogen for many cell types, including epithelial cells (6, 7, 8); however, other mitogenic growth factors are also expressed in uterine epithelium, e.g. EGF and insulin-like growth factor I (IGF-I) (24). EGF is thought to mediate the mitogenic action of estrogen in mouse uterine epithelium, as its synthesis is stimulated in mouse uterus in response to estradiol treatment (25, 26). In the ovariectomized, mature mouse, chronic administration of EGF induced uterine epithelial cell proliferation after 48–96 h of treatment (24). No other growth factors have been similarly tested in vivo for their ability to induce proliferation of the uterine epithelium; however, and although the synthesis of both EGF and IGF-I is stimulated in mouse uterine epithelial cells by estradiol, there is no evidence that either of these growth factors functions in the progesterone-induced arrest of uterine epithelial cell mitosis. Mitogenic growth factors such as EGF, IGF-I, and HB-EGF may all be required for estrogen-stimulated mitosis in mice and rats. Alternatively, uterine epithelial cell proliferation may be regulated by different mechanisms in mice and rats. The regulation of HB-EGF mRNA expression differs in the uteri of these two species, as progesterone treatment markedly enhances HB-EGF mRNA levels in uterine stromal cells in the rat, but has no effect on HB-EGF expression in uterine stromal cells in mice (9, 17, 27). In the mouse, cyclin D1 expression after estradiol treatment was stimulated by estradiol over an 8- to 12-h interval, which is indicative of an extended G1 period (23). In the rat, cyclin D1 expression was stimulated for only 4–6 h, suggesting that the G1 phase is shorter in rat than in mouse uterine epithelium. In preliminary experiments we found that the homology between mouse and rat mRNA for cyclin D1 was insufficient to allow heterologous binding of mouse antisense RNA probes to rat mRNA. Furthermore, in preparing cDNA for rat cyclin D1 by PCR, we discovered marked differences in the mRNA sequences of cyclin D1 from rat kidney and rat liver (data not shown). Cyclin D1 regulation and the subsequent regulation of DNA synthesis may be cell and tissue as well as species specific.

In conclusion, these studies submit that HB-EGF is an important intermediate in the steroid regulation of uterine epithelial cell proliferation. HB-EGF mRNA expression is stimulated by estradiol several hours before DNA synthesis and is also rapidly inhibited by progesterone through receptor-mediated mechanisms. The results of these studies also suggest that HB-EGF regulates the G1 phase of the rat uterine epithelial cell cycle by stimulating the production of cyclin D1.


   Acknowledgments
 
We thank Dr. Hiroshi Nojima for providing cyclin B1 cDNA, Drs. Brian Pentecost and Richard Lyttle for supplying A1 cDNA, and Dr. Alan Wakeling at Zeneca Pharmaceuticals for providing ICI 164,384.


   Footnotes
 
1 This work was supported by grants from the NIH (HD-22785), the Texas Advanced Technology Program (4949100), and the Mellon Foundation. Back

2 Current address: Women’s Health Research Institute, Wyeth-Ayerst Research, Radnor, Pennsylvania 19087. Back

Received July 18, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Clark BF 1971 The effects of oestrogen and progesterone on uterine cell division and epithelial morphology in spayed, adrenalectomized rats. J Endocrinol 50:527–528[Abstract/Free Full Text]
  2. Martin, L 1980 Estrogens, anti-estrogens and the regulation of cell proliferation in the female reproductive tract in vivo. In: McLachlan J (ed) Estrogens in the Environment. Elsevier/North Holland, Amsterdam, pp 103–129
  3. Tachi C, Tachi S, Lindner HR 1972 Modification by progesterone of oestradiol-induced cell proliferation, RNA synthesis and oestradiol distribution in the rat uterus. J Reprod Fertil 31:59–76[Abstract/Free Full Text]
  4. Pollard JW 1990 Regulation of polypeptide growth factor synthesis and growth factor-related gene expression in the rat and mouse uterus before and after implantation. J Reprod Fertil 88:721–731[Abstract/Free Full Text]
  5. Beerli RR, Hynes NE 1996 Epidermal growth factor-related peptides activate distinct subsets of ErbB receptors and differ in their biological activities. J Biol Chem 271:6071–6076[Abstract/Free Full Text]
  6. Higashiyama S, Abraham JA, Miller J, Fiddes JC, Klagsbrun M 1991 A heparin-binding growth factor secreted by macrophage-like cells that is related to EGF. Science 251:936–939[Abstract/Free Full Text]
  7. Temizer DH, Yoshizumi M, Perella MA, Susanni EE, Quertermous T, Lee M-E 1992 Induction of heparin-binding epidermal growth factor-like growth factor mRNA by phorbol ester and angiotensin II in rat aortic smooth muscle cells. J Biol Chem 267:24892–24896[Abstract/Free Full Text]
  8. Ito N, Kawata S, Tamura S, Kiso S, Tsushima H, Damm D, Abraham J, Higashiyama S, Taniguchi N, Matsuzawa Y 1991 Heparin-binding EGF-like growth factor is a potent mitogen for rat hepatocytes. Biochem Biophys Res Commun 198:25–31
  9. Zhang Z, Funk C, Roy D, Glasser S, Mulholland J 1994 Heparin-binding epidermal growth factor-like growth factor is differentially regulated by progesterone and estradiol in rat uterine epithelial and stromal cells. Endocrinology 134:1089–1094[Abstract/Free Full Text]
  10. Galand P, de Maertelaer V 1992 Models of oestrogen action: a cell kineticist’s view. Epith Cell Biol 1:177–188[Medline]
  11. Heichman KA, Roberts JM 1994 Rules to replicate by. Cell 79:557–562[CrossRef][Medline]
  12. King RW, Jackson PK, Kirschner MW 1994 Mitosis in transition. Cell 79:563–571[CrossRef][Medline]
  13. Nurse P 1994 Ordering S phase and M phase in the cell cycle. Cell 79:547–550[CrossRef][Medline]
  14. Sherr CJ 1993 Mammalian G1 cyclins. Cell 73:1059–1065[Medline]
  15. Mukku V, Stancel GM 1985 Regulation of epidermal growth factor receptor by estrogen. J Biol Chem 260:9820–9824[Abstract/Free Full Text]
  16. Bitton-Casimiri V, Rath NC, Psychoyos A 1977 A simple method for separation and culture of rat uterine epithelial cells. J Endocrinol 73:537–538[Abstract/Free Full Text]
  17. Zhang Z, Funk C, Glasser SR, Mulholland J 1994 Progesterone regulation of heparin-binding epidermal growth factor-like growth factor gene expression during sensitization and decidualization in the rat uterus: effects of the antiprogestin, ZK98.299. Endocrinology 135:1256–1263[Abstract]
  18. Sundstrom SA, Komm BS, Ponce-de-Leon H, Yi Z, Teuscher C, Lyttle CR 1989 Estrogen regulation of tissue-specific expression of complement C3. J Biol Chem 264:16941–16947[Abstract/Free Full Text]
  19. Tamura K, Kanaoka Y, Jinno S, Nagata A, Ogiso Y, Shimizu K, Hayakawa T, Nojima H, Okayama H 1993 Cyclin G: a new mammalian cyclin with homology to fission yeast Cig1. Oncogene 8:2113–2118[Medline]
  20. Wakeling AE, Bowler J 1988 Novel antioestrogens without partial agonist activity. J Steroid Biochem 31:645–653[CrossRef][Medline]
  21. Cullingford TE, Pollard JW 1988 RU 486 completely inhibits the action of progesterone on cell proliferation in the mouse uterus. J Reprod Fertil 83:909–914[Abstract/Free Full Text]
  22. Persico E, Scalona M, Cicatiello L, Sica V, Bresciani F, Weisz 1990 Activation of ‘immediate-early’ genes by estrogen is not sufficient to achieve stimulation of DNA synthesis in rat uterus. Biochem Biophys Res Commun 171:287–292[CrossRef][Medline]
  23. Geum D, Sun W, Park SK, Lee CC, Kim K 1997 Estrogen-induced cyclin D1 and D3 gene expression during mouse uterine cell proliferation in vivo: differential induction mechanism of cyclin D1 and D3. Mol Reprod Dev 46:450–458[CrossRef][Medline]
  24. Nelson KG, Takahashi T, Bossert NL, Walmer DK, McLachlan JA 1991 Epidermal growth factor replaces estrogen in the stimulation of female genital-tract growth and differentiation. Proc Natl Acad Sci USA 88:21–25[Abstract/Free Full Text]
  25. DiAugustine RP, Petrusz P, Bell GI, Brown CF, Korach KS, McLachlan JA, Teng CT 1988 Influence of estrogens on mouse uterine epidermal growth factor precursor protein and messenger ribonucleic acid. Endocrinology 122:2355–2363[Abstract/Free Full Text]
  26. Huet-Hudson YM, Chakraborty C, De SK, Suzuki Y, Andrews GK, Dey SK 1990 Estrogen regulates the synthesis of epidermal growth factor in mouse uterine epithelial cells. Mol Endocrinol 4:510–523[Abstract/Free Full Text]
  27. Wang XN, Das SK, Damm D, Klagsbrun M, Abraham JA, Dey SK 1994 Differential regulation of heparin-binding epidermal growth factor-like growth factor in the adult ovariectomized mouse uterus by progesterone and estrogen. Endocrinology 135:1264–1271[Abstract]



This article has been cited by other articles:


Home page
 J AndrolHome page
A. Wagner, N. Messe, M. Bergmann, O. Lekhkota, and R. Claus
Effects of Estradiol Infusion in GnRH Immunized Boars on Spermatogenesis
J Androl, November 1, 2006; 27(6): 880 - 889.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
J. Wang, N. Ohara, S. Takekida, Q. Xu, and T. Maruo
Comparative effects of heparin-binding epidermal growth factor-like growth factor on the growth of cultured human uterine leiomyoma cells and myometrial cells
Hum. Reprod., June 1, 2005; 20(6): 1456 - 1465.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
N. Kanda and S. Watanabe
17{beta}-Estradiol enhances heparin-binding epidermal growth factor-like growth factor production in human keratinocytes
Am J Physiol Cell Physiol, April 1, 2005; 288(4): C813 - C823.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
F. L Lopes, J. A Desmarais, and B. D Murphy
Embryonic diapause and its regulation
Reproduction, December 1, 2004; 128(6): 669 - 678.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
K. C. Fertuck, J. E. Eckel, C. Gennings, and T. R. Zacharewski
Identification of temporal patterns of gene expression in the uteri of immature, ovariectomized mice following exposure to ethynylestradiol
Physiol Genomics, October 17, 2003; 15(2): 127 - 141.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol PatholHome page
M. Yoshida, A. Takenaka, S.-I. Katsuda, Y. Kurokawa, and A. Maekawa
Neonatal Exposure to p-tert-octylphenol Causes Abnormal Expression of Estrogen Receptor {alpha} and Subsequent Alteration of Cell Proliferating Activity in the Developing Donryu Rat Uterus
Toxicol Pathol, April 1, 2002; 30(3): 357 - 364.
[Abstract] [PDF]

Home page
 Biol. Reprod.Home page
W. B. Nothnick
Disruption of the Tissue Inhibitor of Metalloproteinase-1 Gene in Reproductive-Age Female Mice Is Associated with Estrous Cycle Stage-Specific Increases in Stromelysin Messenger RNA Expression and Activity
Biol Reprod, December 1, 2001; 65(6): 1780 - 1788.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
C. L. Chaffin, K. M. Schwinof, and R. L. Stouffer
Gonadotropin and Steroid Control of Granulosa Cell Proliferation During the Periovulatory Interval in Rhesus Monkeys
Biol Reprod, September 1, 2001; 65(3): 755 - 762.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Lu and G. Serrero
Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor)
PNAS, December 22, 2000; (2000) 11525198.
[Abstract] [Full Text]

Home page
 J. Histochem. Cytochem.Home page
T. Uchide, H. Masuda, Y.-S. Lee, Y. Makiyama, Y. Mitsui, and K. Saida
Fluctuating Gene Expression and Localized Cellular Distribution of Vasoactive Intestinal Contractor (VIC) in Mouse Uterus
J. Histochem. Cytochem., May 1, 2000; 48(5): 699 - 708.
[Abstract] [Full Text]

Home page
 EndocrinologyHome page
Y. Fang, P. Lepont, J. T. Fassett, S. P. Ford, A. Mubaidin, R. T. Hamilton, and M. Nilsen-Hamilton
Signaling between the Placenta and the Uterus Involving the Mitogen-Regulated Protein/Proliferins
Endocrinology, November 1, 1999; 140(11): 5239 - 5249.
[Abstract] [Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Orimo, S. Inoue, O. Minowa, N. Tominaga, Y. Tomioka, M. Sato, J. Kuno, H. Hiroi, Y. Shimizu, M. Suzuki, et al.
Underdeveloped uterus and reduced estrogen responsiveness in mice with disruption of the estrogen-responsive finger protein gene, which is a direct target of estrogen receptor alpha
PNAS, October 12, 1999; 96(21): 12027 - 12032.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
D. Dai and T. F. Ogle
Progesterone Regulation of Epidermal Growth Factor Receptor in Rat Decidua Basalis during Pregnancy
Biol Reprod, July 1, 1999; 61(1): 326 - 332.
[Abstract] [Full Text]

Home page
 Biol. Reprod.Home page
P. S. Cooke, D. L. Buchanan, D. B. Lubahn, and G. R. Cunha
Mechanism of Estrogen Action: Lessons from the Estrogen Receptor-{alpha} Knockout Mouse
Biol Reprod, July 1, 1998; 59(3): 470 - 475.
[Full Text]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Lu and G. Serrero
Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor)
PNAS, January 2, 2001; 98(1): 142 - 147.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Mulholland, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Mulholland, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals